Phenotypic Mutation 'gobble' (pdf version)
Allelegobble
Mutation Type critical splice donor site (2 bp from exon)
Chromosome1
Coordinate34,165,155 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Dst
Gene Name dystonin
Synonym(s) BPAG1-n, ah, athetoid, bullous pemphigoid antigen 1, A830042E19Rik, Macf2, nmf339, Bpag1, nmf203, bullous pemphigoid antigen 1, BPAG1, Bpag, 2310001O04Rik
Chromosomal Location 33,908,225-34,308,661 bp (+)
MGI Phenotype PHENOTYPE: Mutations in this gene produce peripheral nervous system demyelination resulting in impaired muscle function and shorter lifespan. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001276764, NM_134448, NM_133833, NM_010081; MGI:104627

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000095392 ] [ENSMUSP00000095393 ] [ENSMUSP00000110756 ] [ENSMUSP00000138308 ] [ENSMUSP00000138376 ] [ENSMUSP00000141127 ] [ENSMUSP00000139888 ] [ENSMUSP00000140560 ]   † probably from a misspliced transcript
PDB Structure
Crystal Structure of a protease resistant fragment of the plakin domain of Bullous Pemphigoid Antigen1 (BPAG1) [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000095392
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.09e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.08e-51 SMART
low complexity region 7224 7242 N/A INTRINSIC
low complexity region 7252 7264 N/A INTRINSIC
low complexity region 7313 7336 N/A INTRINSIC
PDB:3GJO|H 7364 7393 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000095393
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 6e-43 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 2e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 2e-62 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
SPEC 1555 1664 2.19e-1 SMART
internal_repeat_6 1757 1797 1.18e-5 PROSPERO
SPEC 1838 1957 1.75e-9 SMART
SPEC 1964 2070 3.7e-8 SMART
SPEC 2077 2176 4.56e-8 SMART
SPEC 2186 2285 3.78e0 SMART
low complexity region 2358 2374 N/A INTRINSIC
SPEC 2433 2538 1.98e-8 SMART
SPEC 2545 2649 3.62e-11 SMART
SPEC 2659 2759 1.65e-5 SMART
SPEC 2766 2868 7.75e-11 SMART
SPEC 2875 2975 2.3e-4 SMART
SPEC 2985 3084 3.01e0 SMART
SPEC 3091 3194 2.74e-2 SMART
SPEC 3201 3305 2.46e-4 SMART
SPEC 3312 3414 1.27e-15 SMART
SPEC 3421 3523 1.54e-14 SMART
SPEC 3530 3632 8.07e-2 SMART
SPEC 3639 3741 3.67e-12 SMART
SPEC 3748 3849 1.97e-12 SMART
SPEC 3856 3962 4.19e-7 SMART
SPEC 3969 4071 2.06e-15 SMART
SPEC 4078 4181 2.89e-10 SMART
SPEC 4188 4290 2.61e-26 SMART
SPEC 4297 4399 5.31e-18 SMART
SPEC 4406 4508 1.25e-14 SMART
SPEC 4515 4618 9.1e-17 SMART
SPEC 4625 4726 9.3e-23 SMART
SPEC 4733 4835 5.43e-15 SMART
SPEC 4845 4975 1.5e-8 SMART
EFh 5009 5037 4.12e-3 SMART
EFh 5045 5073 1.25e-2 SMART
GAS2 5084 5162 3.08e-51 SMART
low complexity region 5210 5228 N/A INTRINSIC
low complexity region 5238 5250 N/A INTRINSIC
low complexity region 5299 5322 N/A INTRINSIC
PDB:3GJO|H 5350 5379 1e-9 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000110756
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.08e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.85e-52 SMART
low complexity region 7200 7218 N/A INTRINSIC
low complexity region 7228 7240 N/A INTRINSIC
low complexity region 7326 7349 N/A INTRINSIC
PDB:3GJO|H 7377 7406 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138308
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
CH 215 314 1.62e-28 SMART
CH 331 428 3.72e-19 SMART
PDB:2ODU|A 439 657 1e-42 PDB
low complexity region 698 723 N/A INTRINSIC
SPEC 780 877 8.64e-9 SMART
SPEC 880 980 2.94e-11 SMART
Blast:SPEC 987 1151 5e-73 BLAST
coiled coil region 1273 1310 N/A INTRINSIC
Blast:SPEC 1354 1463 8e-63 BLAST
SPEC 1470 1599 4.11e0 SMART
SPEC 1617 1716 4.66e0 SMART
PLEC 1715 1759 9.05e-3 SMART
PLEC 1760 1797 2.7e0 SMART
PLEC 1835 1872 2.23e0 SMART
PLEC 1873 1910 4.25e1 SMART
PLEC 1913 1948 1.39e2 SMART
PLEC 1949 1986 7.4e-8 SMART
PLEC 1989 2024 5.8e-1 SMART
PLEC 2025 2062 2.71e1 SMART
PLEC 2064 2100 4.66e0 SMART
low complexity region 2472 2485 N/A INTRINSIC
low complexity region 2544 2559 N/A INTRINSIC
low complexity region 2655 2669 N/A INTRINSIC
low complexity region 2744 2771 N/A INTRINSIC
low complexity region 2839 2853 N/A INTRINSIC
low complexity region 2971 2977 N/A INTRINSIC
low complexity region 3017 3025 N/A INTRINSIC
low complexity region 3224 3235 N/A INTRINSIC
low complexity region 3472 3492 N/A INTRINSIC
SPEC 3499 3605 5.36e-1 SMART
low complexity region 3693 3705 N/A INTRINSIC
low complexity region 3726 3736 N/A INTRINSIC
SPEC 3747 3856 2.19e-1 SMART
internal_repeat_12 3949 3989 5.99e-5 PROSPERO
SPEC 4030 4149 1.75e-9 SMART
SPEC 4156 4262 3.7e-8 SMART
SPEC 4269 4368 4.56e-8 SMART
SPEC 4378 4477 3.78e0 SMART
low complexity region 4550 4566 N/A INTRINSIC
SPEC 4625 4730 1.98e-8 SMART
SPEC 4737 4841 3.62e-11 SMART
SPEC 4851 4951 1.65e-5 SMART
SPEC 4958 5060 7.75e-11 SMART
SPEC 5067 5167 2.3e-4 SMART
SPEC 5177 5276 3.01e0 SMART
SPEC 5283 5386 2.74e-2 SMART
SPEC 5393 5497 2.46e-4 SMART
SPEC 5504 5606 1.27e-15 SMART
SPEC 5613 5715 1.69e-11 SMART
SPEC 5722 5824 9.33e-5 SMART
SPEC 5831 5933 8.07e-2 SMART
SPEC 5940 6042 3.67e-12 SMART
SPEC 6049 6150 1.97e-12 SMART
SPEC 6157 6263 4.19e-7 SMART
SPEC 6270 6372 2.06e-15 SMART
SPEC 6379 6482 2.89e-10 SMART
SPEC 6489 6591 2.61e-26 SMART
SPEC 6598 6700 5.31e-18 SMART
SPEC 6707 6809 1.25e-14 SMART
SPEC 6816 6919 9.1e-17 SMART
SPEC 6926 7027 9.3e-23 SMART
SPEC 7034 7136 5.43e-15 SMART
SPEC 7146 7276 1.5e-8 SMART
EFh 7310 7338 4.12e-3 SMART
EFh 7346 7374 1.25e-2 SMART
GAS2 7385 7463 3.08e-51 SMART
low complexity region 7511 7529 N/A INTRINSIC
low complexity region 7539 7551 N/A INTRINSIC
low complexity region 7637 7660 N/A INTRINSIC
PDB:3GJO|H 7688 7717 9e-10 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000138376
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
PDB:2ODU|A 2 95 4e-7 PDB
low complexity region 136 161 N/A INTRINSIC
SPEC 218 315 5.4e-11 SMART
SPEC 318 418 1.8e-13 SMART
Blast:SPEC 425 589 1e-73 BLAST
coiled coil region 711 748 N/A INTRINSIC
Blast:SPEC 792 901 4e-63 BLAST
SPEC 908 1037 2.6e-2 SMART
coiled coil region 1071 1805 N/A INTRINSIC
PLEC 2061 2098 1.6e-6 SMART
PLEC 2099 2136 4.4e-10 SMART
PLEC 2137 2172 7.8e-5 SMART
PLEC 2173 2210 6.8e-8 SMART
PLEC 2252 2297 2.7e-3 SMART
PLEC 2298 2348 3.7e-1 SMART
PLEC 2368 2407 5.5e-6 SMART
PLEC 2408 2445 1.5e-14 SMART
PLEC 2446 2483 1.1e-10 SMART
PLEC 2484 2521 1.3e-7 SMART
PLEC 2522 2559 5e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000141127
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
PDB:2ODU|A 56 153 6e-8 PDB
low complexity region 194 219 N/A INTRINSIC
SPEC 276 373 5.4e-11 SMART
SPEC 376 476 1.8e-13 SMART
Blast:SPEC 483 647 1e-73 BLAST
coiled coil region 769 806 N/A INTRINSIC
Blast:SPEC 850 959 1e-62 BLAST
SPEC 966 1095 2.6e-2 SMART
SPEC 1113 1212 2.9e-2 SMART
SPEC 1229 1338 1.4e-3 SMART
internal_repeat_10 1431 1471 9.93e-6 PROSPERO
SPEC 1512 1631 1.1e-11 SMART
SPEC 1638 1744 2.3e-10 SMART
SPEC 1751 1850 2.9e-10 SMART
SPEC 1860 1959 2.4e-2 SMART
low complexity region 2032 2048 N/A INTRINSIC
SPEC 2107 2212 1.2e-10 SMART
SPEC 2219 2323 2.3e-13 SMART
SPEC 2333 2433 1.1e-7 SMART
SPEC 2440 2542 5e-13 SMART
SPEC 2549 2649 1.4e-6 SMART
SPEC 2659 2758 1.9e-2 SMART
SPEC 2765 2868 1.8e-4 SMART
SPEC 2875 2979 1.5e-6 SMART
SPEC 2986 3088 8.2e-18 SMART
SPEC 3095 3197 1.1e-13 SMART
SPEC 3204 3306 6e-7 SMART
SPEC 3313 3415 5.1e-4 SMART
SPEC 3422 3524 2.3e-14 SMART
SPEC 3531 3632 1.3e-14 SMART
SPEC 3639 3745 2.6e-9 SMART
SPEC 3752 3854 1.3e-17 SMART
SPEC 3861 3964 1.8e-12 SMART
SPEC 3971 4073 1.6e-28 SMART
SPEC 4080 4182 3.3e-20 SMART
SPEC 4189 4291 7.6e-17 SMART
SPEC 4298 4401 5.6e-19 SMART
SPEC 4408 4509 5.9e-25 SMART
SPEC 4516 4618 3.4e-17 SMART
SPEC 4628 4758 9.7e-11 SMART
EFh 4792 4820 2e-5 SMART
EFh 4828 4856 6e-5 SMART
GAS2 4867 4945 9.8e-56 SMART
low complexity region 4969 4987 N/A INTRINSIC
low complexity region 4997 5009 N/A INTRINSIC
low complexity region 5095 5118 N/A INTRINSIC
PDB:3GJO|H 5146 5175 3e-9 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139888
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
PDB:2ODU|A 56 161 6e-8 PDB
low complexity region 194 219 N/A INTRINSIC
SPEC 276 373 5.4e-11 SMART
SPEC 376 476 1.8e-13 SMART
Blast:SPEC 483 648 3e-75 BLAST
coiled coil region 770 807 N/A INTRINSIC
Blast:SPEC 849 960 2e-58 BLAST
SPEC 967 1096 2.6e-2 SMART
SPEC 1114 1213 2.9e-2 SMART
PLEC 1212 1256 5.5e-5 SMART
PLEC 1257 1294 1.7e-2 SMART
PLEC 1332 1369 1.4e-2 SMART
PLEC 1370 1407 2.7e-1 SMART
PLEC 1410 1445 8.7e-1 SMART
PLEC 1446 1483 4.8e-10 SMART
PLEC 1486 1521 3.6e-3 SMART
PLEC 1522 1559 1.7e-1 SMART
PLEC 1561 1597 3e-2 SMART
low complexity region 1969 1982 N/A INTRINSIC
low complexity region 2041 2056 N/A INTRINSIC
low complexity region 2152 2166 N/A INTRINSIC
low complexity region 2241 2268 N/A INTRINSIC
low complexity region 2336 2350 N/A INTRINSIC
low complexity region 2468 2474 N/A INTRINSIC
low complexity region 2514 2522 N/A INTRINSIC
low complexity region 2721 2732 N/A INTRINSIC
low complexity region 2969 2987 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000140560
Gene: ENSMUSG00000026131

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
CH 77 176 8.1e-31 SMART
CH 193 290 1.8e-21 SMART
PDB:2ODU|A 301 519 1e-43 PDB
SCOP:d1hcia1 308 423 4e-39 SMART
low complexity region 560 585 N/A INTRINSIC
SPEC 642 739 5.4e-11 SMART
SPEC 742 842 1.8e-13 SMART
Blast:SPEC 849 1013 3e-73 BLAST
coiled coil region 1135 1172 N/A INTRINSIC
Blast:SPEC 1216 1325 2e-62 BLAST
SPEC 1332 1461 2.6e-2 SMART
Predicted Effect probably null
Meta Mutation Damage Score 0.9474 question?
Is this an essential gene? Possibly nonessential (E-score: 0.382) question?
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological
Body Weight - decreased 16087202
DSS: sensitive day 7
FACS B1a cells in B1 cells - increased
FACS B1b cells in B1 cells - increased
FACS CD11c+ DCs - increased
growth/size
TLR signaling defect: hypersensitivity to CpG + IFNg
Candidate Explorer Status CE: potential candidate; human score: -0.5; ML prob: 0.396
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(297) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(274) Spontaneous(15) Targeted(3) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Dst APN 1 34251839 missense probably damaging 1.00
IGL00309:Dst APN 1 34160652 missense probably damaging 1.00
IGL00334:Dst APN 1 34166292 missense probably damaging 1.00
IGL00470:Dst APN 1 34188962 missense probably damaging 1.00
IGL00481:Dst APN 1 34169329 splice site probably benign
IGL00499:Dst APN 1 34290423 missense probably damaging 0.99
IGL00803:Dst APN 1 34164124 missense possibly damaging 0.89
IGL00850:Dst APN 1 34306624 missense probably damaging 1.00
IGL00957:Dst APN 1 34228407 missense probably benign 0.27
IGL00975:Dst APN 1 34188312 missense possibly damaging 0.86
IGL00984:Dst APN 1 34256320 missense probably damaging 1.00
IGL01284:Dst APN 1 34163928 missense probably damaging 1.00
IGL01393:Dst APN 1 34167625 missense possibly damaging 0.91
IGL01397:Dst APN 1 34257744 missense probably damaging 1.00
IGL01399:Dst APN 1 34117517 missense probably benign 0.41
IGL01412:Dst APN 1 34242620 missense probably benign 0.21
IGL01527:Dst APN 1 34247653 missense probably damaging 1.00
IGL01537:Dst APN 1 34275320 missense probably damaging 1.00
IGL01618:Dst APN 1 34188909 nonsense probably null
IGL01636:Dst APN 1 34215569 missense probably damaging 1.00
IGL01642:Dst APN 1 34189389 missense probably damaging 1.00
IGL01672:Dst APN 1 34225693 missense probably damaging 1.00
IGL01685:Dst APN 1 34170452 missense probably damaging 0.99
IGL01694:Dst APN 1 34188160 missense probably benign 0.13
IGL01777:Dst APN 1 34199397 missense probably benign 0.07
IGL01800:Dst APN 1 34262092 missense probably damaging 1.00
IGL01811:Dst APN 1 34164092 missense probably damaging 1.00
IGL01960:Dst APN 1 34290489 missense probably damaging 1.00
IGL02031:Dst APN 1 34189917 missense possibly damaging 0.95
IGL02103:Dst APN 1 34190118 missense possibly damaging 0.90
IGL02121:Dst APN 1 34228657 missense probably damaging 1.00
IGL02315:Dst APN 1 34198665 missense probably damaging 1.00
IGL02317:Dst APN 1 34295163 missense probably damaging 1.00
IGL02469:Dst APN 1 34188828 missense probably damaging 1.00
IGL02492:Dst APN 1 34152193 splice site probably benign
IGL02510:Dst APN 1 34229251 splice site probably null
IGL02522:Dst APN 1 34250700 splice site probably benign
IGL02540:Dst APN 1 34135204 missense probably damaging 1.00
IGL02588:Dst APN 1 34117484 missense probably damaging 1.00
IGL02676:Dst APN 1 34307587 missense probably damaging 1.00
IGL02688:Dst APN 1 34195952 missense probably damaging 1.00
IGL02700:Dst APN 1 34262120 missense probably damaging 1.00
IGL02794:Dst APN 1 34270829 missense probably damaging 1.00
IGL02823:Dst APN 1 34192083 missense possibly damaging 0.83
IGL02935:Dst APN 1 34186845 nonsense probably null
IGL02940:Dst APN 1 34289587 missense probably benign 0.36
IGL02994:Dst APN 1 34229252 splice site probably benign
IGL02996:Dst APN 1 34188398 missense possibly damaging 0.93
IGL02998:Dst APN 1 34268275 missense probably damaging 1.00
IGL03027:Dst APN 1 34186025 missense possibly damaging 0.51
IGL03033:Dst APN 1 34169745 splice site probably benign
IGL03099:Dst APN 1 34275781 missense probably damaging 1.00
IGL03119:Dst APN 1 34161062 missense probably damaging 1.00
IGL03121:Dst APN 1 34217803 splice site probably benign
IGL03132:Dst APN 1 34256641 missense probably benign 0.06
IGL03220:Dst APN 1 34185995 missense probably damaging 0.99
IGL03230:Dst APN 1 34184052 nonsense probably null
IGL03245:Dst APN 1 34211148 splice site probably null
IGL03380:Dst APN 1 34257800 missense probably damaging 1.00
Doodle UTSW 1 34208558 nonsense probably null
Phelps UTSW 1 34223795 splice site probably null
tinsel UTSW 1 34164167 missense probably damaging 1.00
Wastable UTSW 1 34295289 missense probably damaging 1.00
E0370:Dst UTSW 1 34249471 splice site probably benign
FR4304:Dst UTSW 1 34200964 missense probably damaging 0.99
IGL02799:Dst UTSW 1 34179849 missense possibly damaging 0.92
R0006:Dst UTSW 1 34228918 missense probably benign 0.30
R0006:Dst UTSW 1 34228918 missense probably benign 0.30
R0023:Dst UTSW 1 34189119 missense probably damaging 1.00
R0023:Dst UTSW 1 34189119 missense probably damaging 1.00
R0024:Dst UTSW 1 34189119 missense probably damaging 1.00
R0027:Dst UTSW 1 34189119 missense probably damaging 1.00
R0049:Dst UTSW 1 34275781 missense probably damaging 1.00
R0053:Dst UTSW 1 34294550 splice site probably null
R0053:Dst UTSW 1 34294550 splice site probably null
R0058:Dst UTSW 1 34006224 missense possibly damaging 0.93
R0066:Dst UTSW 1 34189553 missense possibly damaging 0.67
R0066:Dst UTSW 1 34189553 missense possibly damaging 0.67
R0085:Dst UTSW 1 34229187 missense probably damaging 1.00
R0125:Dst UTSW 1 34270903 missense probably damaging 1.00
R0152:Dst UTSW 1 34189119 missense probably damaging 1.00
R0165:Dst UTSW 1 34154646 splice site probably benign
R0172:Dst UTSW 1 34270854 missense probably damaging 1.00
R0207:Dst UTSW 1 34186935 missense probably benign 0.02
R0219:Dst UTSW 1 34303478 missense probably damaging 0.99
R0349:Dst UTSW 1 34199553 missense probably benign 0.12
R0386:Dst UTSW 1 34217836 missense probably damaging 1.00
R0389:Dst UTSW 1 34294550 splice site probably null
R0395:Dst UTSW 1 34189119 missense probably damaging 1.00
R0423:Dst UTSW 1 34278035 missense possibly damaging 0.95
R0443:Dst UTSW 1 34294550 splice site probably null
R0472:Dst UTSW 1 34266960 critical splice donor site probably null
R0490:Dst UTSW 1 34307368 nonsense probably null
R0513:Dst UTSW 1 34219531 splice site probably benign
R0539:Dst UTSW 1 34189119 missense probably damaging 1.00
R0562:Dst UTSW 1 34227981 missense probably damaging 1.00
R0569:Dst UTSW 1 34293427 missense probably damaging 1.00
R0600:Dst UTSW 1 34189119 missense probably damaging 1.00
R0608:Dst UTSW 1 34290356 splice site probably null
R0609:Dst UTSW 1 34266960 critical splice donor site probably null
R0630:Dst UTSW 1 34193450 missense probably benign 0.05
R0630:Dst UTSW 1 34199473 missense probably damaging 0.98
R0632:Dst UTSW 1 34271413 missense probably damaging 1.00
R0713:Dst UTSW 1 34189119 missense probably damaging 1.00
R0724:Dst UTSW 1 34188677 missense probably benign 0.00
R0761:Dst UTSW 1 34182767 missense probably benign 0.33
R0801:Dst UTSW 1 34170389 missense probably damaging 0.99
R0829:Dst UTSW 1 34163220 missense probably damaging 1.00
R0939:Dst UTSW 1 34244383 missense probably damaging 1.00
R0945:Dst UTSW 1 34271419 missense probably damaging 1.00
R0992:Dst UTSW 1 34199536 missense probably damaging 0.97
R1018:Dst UTSW 1 34194093 missense probably damaging 1.00
R1077:Dst UTSW 1 34164167 missense probably damaging 1.00
R1079:Dst UTSW 1 34186863 missense possibly damaging 0.86
R1127:Dst UTSW 1 34275277 missense probably damaging 1.00
R1129:Dst UTSW 1 34199554 missense probably benign 0.28
R1141:Dst UTSW 1 34188696 missense possibly damaging 0.85
R1167:Dst UTSW 1 34223858 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1333:Dst UTSW 1 34228347 missense probably damaging 1.00
R1352:Dst UTSW 1 34229248 critical splice donor site probably null
R1365:Dst UTSW 1 34188194 missense probably benign 0.02
R1382:Dst UTSW 1 34268833 missense probably damaging 0.99
R1389:Dst UTSW 1 34211232 missense probably damaging 1.00
R1394:Dst UTSW 1 34165155 critical splice donor site probably null
R1395:Dst UTSW 1 34165155 critical splice donor site probably null
R1435:Dst UTSW 1 34113945 missense probably damaging 1.00
R1450:Dst UTSW 1 34188395 missense probably damaging 1.00
R1450:Dst UTSW 1 34212259 missense probably damaging 0.99
R1453:Dst UTSW 1 34189446 missense possibly damaging 0.85
R1479:Dst UTSW 1 34264515 splice site probably null
R1483:Dst UTSW 1 34252998 missense probably damaging 1.00
R1491:Dst UTSW 1 34154594 missense probably damaging 0.99
R1536:Dst UTSW 1 34260372 splice site probably benign
R1551:Dst UTSW 1 34192212 missense probably benign 0.01
R1573:Dst UTSW 1 34201231 missense probably damaging 1.00
R1614:Dst UTSW 1 34275263 missense probably damaging 1.00
R1615:Dst UTSW 1 34199371 missense probably damaging 1.00
R1645:Dst UTSW 1 34225722 missense probably damaging 1.00
R1655:Dst UTSW 1 34282576 nonsense probably null
R1663:Dst UTSW 1 34163385 missense probably damaging 1.00
R1674:Dst UTSW 1 34223795 splice site probably null
R1702:Dst UTSW 1 34167340 missense probably damaging 1.00
R1707:Dst UTSW 1 34167646 missense probably damaging 1.00
R1747:Dst UTSW 1 34160709 missense probably damaging 1.00
R1760:Dst UTSW 1 34228603 missense probably damaging 1.00
R1773:Dst UTSW 1 34291899 missense probably damaging 0.99
R1793:Dst UTSW 1 34152471 nonsense probably null
R1842:Dst UTSW 1 34164119 missense probably null 0.98
R1869:Dst UTSW 1 34252832 missense probably damaging 0.99
R1879:Dst UTSW 1 34188843 missense probably benign 0.15
R1883:Dst UTSW 1 34189308 missense possibly damaging 0.74
R1912:Dst UTSW 1 34291850 missense probably damaging 1.00
R1920:Dst UTSW 1 34161029 missense probably damaging 0.99
R1921:Dst UTSW 1 34161029 missense probably damaging 0.99
R1943:Dst UTSW 1 34228369 missense possibly damaging 0.67
R1958:Dst UTSW 1 34163721 missense probably damaging 1.00
R1962:Dst UTSW 1 34191016 missense possibly damaging 0.47
R1991:Dst UTSW 1 34190258 missense probably benign 0.11
R1998:Dst UTSW 1 34256347 missense probably damaging 1.00
R2001:Dst UTSW 1 34184063 missense probably damaging 0.97
R2007:Dst UTSW 1 34226012 splice site probably benign
R2021:Dst UTSW 1 34166291 missense possibly damaging 0.70
R2022:Dst UTSW 1 34166291 missense possibly damaging 0.70
R2035:Dst UTSW 1 34271413 missense probably damaging 1.00
R2077:Dst UTSW 1 34211170 missense probably damaging 1.00
R2103:Dst UTSW 1 34190258 missense probably benign 0.11
R2111:Dst UTSW 1 34169178 missense probably damaging 1.00
R2112:Dst UTSW 1 34169178 missense probably damaging 1.00
R2113:Dst UTSW 1 34275236 missense probably damaging 0.97
R2201:Dst UTSW 1 34195921 missense possibly damaging 0.60
R2214:Dst UTSW 1 34271401 missense probably damaging 1.00
R2219:Dst UTSW 1 34170433 missense probably damaging 1.00
R2233:Dst UTSW 1 34274262 missense probably damaging 1.00
R2267:Dst UTSW 1 34295466 missense probably damaging 1.00
R2290:Dst UTSW 1 34229200 missense probably damaging 1.00
R2323:Dst UTSW 1 34228437 missense possibly damaging 0.93
R2424:Dst UTSW 1 34167060 missense probably damaging 1.00
R2426:Dst UTSW 1 34192812 missense probably benign 0.03
R2495:Dst UTSW 1 34199373 missense probably damaging 0.99
R2507:Dst UTSW 1 34011909 missense probably damaging 0.98
R2507:Dst UTSW 1 34188417 missense possibly damaging 0.85
R2510:Dst UTSW 1 34212286 missense probably benign
R2831:Dst UTSW 1 34275292 missense probably damaging 1.00
R2929:Dst UTSW 1 34167062 nonsense probably null
R3033:Dst UTSW 1 34152285 missense probably damaging 0.99
R3121:Dst UTSW 1 34289648 missense probably damaging 1.00
R3424:Dst UTSW 1 34198505 splice site probably benign
R3437:Dst UTSW 1 34190222 missense probably damaging 1.00
R3699:Dst UTSW 1 34213074 splice site probably benign
R3739:Dst UTSW 1 34268894 splice site probably benign
R3796:Dst UTSW 1 34181915 missense probably benign 0.15
R3847:Dst UTSW 1 34212319 missense probably damaging 1.00
R3848:Dst UTSW 1 34212319 missense probably damaging 1.00
R3849:Dst UTSW 1 34212319 missense probably damaging 1.00
R3850:Dst UTSW 1 34189274 nonsense probably null
R3850:Dst UTSW 1 34212319 missense probably damaging 1.00
R3873:Dst UTSW 1 34289620 missense probably damaging 1.00
R3875:Dst UTSW 1 34171247 missense probably damaging 1.00
R3973:Dst UTSW 1 34011898 missense probably benign 0.34
R4014:Dst UTSW 1 34191282 nonsense probably null
R4043:Dst UTSW 1 34190684 missense probably benign 0.03
R4057:Dst UTSW 1 34186054 splice site probably benign
R4074:Dst UTSW 1 34192269 missense probably benign 0.20
R4074:Dst UTSW 1 34228461 missense probably damaging 0.97
R4075:Dst UTSW 1 34192269 missense probably benign 0.20
R4076:Dst UTSW 1 34192269 missense probably benign 0.20
R4206:Dst UTSW 1 34212247 missense probably damaging 1.00
R4230:Dst UTSW 1 34195828 missense probably benign 0.04
R4242:Dst UTSW 1 34006216 missense possibly damaging 0.88
R4273:Dst UTSW 1 34192340 missense possibly damaging 0.72
R4366:Dst UTSW 1 34251878 missense probably damaging 1.00
R4370:Dst UTSW 1 34251728 frame shift probably null
R4379:Dst UTSW 1 34163235 missense probably damaging 1.00
R4379:Dst UTSW 1 34227975 missense probably benign 0.07
R4380:Dst UTSW 1 34163235 missense probably damaging 1.00
R4381:Dst UTSW 1 34163235 missense probably damaging 1.00
R4423:Dst UTSW 1 34188393 missense possibly damaging 0.76
R4427:Dst UTSW 1 34181460 missense probably benign 0.19
R4456:Dst UTSW 1 34190719 missense probably benign 0.06
R4469:Dst UTSW 1 34191842 missense probably benign 0.02
R4502:Dst UTSW 1 34247691 missense probably damaging 0.99
R4503:Dst UTSW 1 34262253 critical splice donor site probably null
R4545:Dst UTSW 1 34188738 missense probably damaging 0.99
R4610:Dst UTSW 1 34169856 missense probably damaging 1.00
R4633:Dst UTSW 1 34170434 missense probably damaging 1.00
R4675:Dst UTSW 1 34275703 missense possibly damaging 0.94
R4687:Dst UTSW 1 34201123 missense probably damaging 1.00
R4739:Dst UTSW 1 34191147 missense probably benign 0.01
R4751:Dst UTSW 1 34191884 missense probably benign 0.21
R4754:Dst UTSW 1 34212309 missense probably damaging 1.00
R4771:Dst UTSW 1 34249484 missense probably damaging 1.00
R4819:Dst UTSW 1 33968835 missense probably benign 0.03
R4830:Dst UTSW 1 34198505 splice site probably null
R4839:Dst UTSW 1 34190862 missense probably damaging 0.96
R4845:Dst UTSW 1 34193127 missense probably benign 0.02
R4904:Dst UTSW 1 34169798 missense probably damaging 0.99
R4932:Dst UTSW 1 34228683 missense possibly damaging 0.47
R4934:Dst UTSW 1 34208588 missense probably damaging 1.00
R4952:Dst UTSW 1 34271422 missense probably damaging 1.00
R4961:Dst UTSW 1 33968823 missense possibly damaging 0.53
R4976:Dst UTSW 1 34195969 nonsense probably null
R4980:Dst UTSW 1 34256288 missense probably damaging 1.00
R5011:Dst UTSW 1 34250647 missense probably damaging 1.00
R5013:Dst UTSW 1 34250647 missense probably damaging 1.00
R5059:Dst UTSW 1 34163346 missense possibly damaging 0.70
R5074:Dst UTSW 1 34295263 missense probably damaging 1.00
R5114:Dst UTSW 1 34202559 missense probably damaging 0.98
R5119:Dst UTSW 1 34195969 nonsense probably null
R5182:Dst UTSW 1 34179086 missense probably benign
R5236:Dst UTSW 1 34164417 missense probably damaging 1.00
R5240:Dst UTSW 1 34208558 nonsense probably null
R5254:Dst UTSW 1 34177931 nonsense probably null
R5275:Dst UTSW 1 34180148 missense probably benign 0.13
R5281:Dst UTSW 1 34257782 missense probably benign 0.29
R5299:Dst UTSW 1 34135092 missense probably damaging 1.00
R5316:Dst UTSW 1 34223848 missense probably damaging 0.97
R5319:Dst UTSW 1 34225977 missense possibly damaging 0.95
R5425:Dst UTSW 1 34179750 missense probably benign 0.00
R5443:Dst UTSW 1 34228539 missense probably damaging 1.00
R5522:Dst UTSW 1 34257873 missense possibly damaging 0.46
R5537:Dst UTSW 1 34189878 missense probably benign 0.25
R5548:Dst UTSW 1 34189328 missense probably benign
R5557:Dst UTSW 1 34282586 missense probably damaging 1.00
R5597:Dst UTSW 1 34192713 missense probably benign 0.07
R5623:Dst UTSW 1 34190133 missense possibly damaging 0.56
R5630:Dst UTSW 1 34188785 frame shift probably null
R5660:Dst UTSW 1 34282493 missense probably damaging 1.00
R5730:Dst UTSW 1 34117526 unclassified probably null
R5762:Dst UTSW 1 34179357 missense probably damaging 0.99
R5810:Dst UTSW 1 34183040 intron probably benign
R5816:Dst UTSW 1 34179234 missense probably benign
R5846:Dst UTSW 1 34195861 nonsense probably null
R5874:Dst UTSW 1 34179589 missense probably damaging 0.98
R5899:Dst UTSW 1 34295289 missense probably damaging 1.00
R5923:Dst UTSW 1 34181759 missense probably benign 0.00
R5936:Dst UTSW 1 34307458 missense probably damaging 1.00
R5946:Dst UTSW 1 34174192 missense probably benign 0.01
R5950:Dst UTSW 1 34262060 missense probably damaging 1.00
R5958:Dst UTSW 1 34186050 missense probably damaging 0.97
R5973:Dst UTSW 1 34156857 missense probably damaging 1.00
R5979:Dst UTSW 1 34160372 intron probably benign
R5980:Dst UTSW 1 34182891 missense probably benign 0.34
R5984:Dst UTSW 1 34172263 missense probably benign 0.05
R6000:Dst UTSW 1 34212223 missense possibly damaging 0.92
R6014:Dst UTSW 1 34264834 missense probably damaging 1.00
R6042:Dst UTSW 1 34188972 missense probably damaging 1.00
R6064:Dst UTSW 1 34194051 missense probably damaging 1.00
R6126:Dst UTSW 1 34228183 missense probably damaging 1.00
R6157:Dst UTSW 1 34211172 missense probably damaging 1.00
R6162:Dst UTSW 1 34006237 missense probably damaging 0.99
R6185:Dst UTSW 1 34173080 missense probably damaging 0.99
R6226:Dst UTSW 1 34270874 missense probably damaging 1.00
R6227:Dst UTSW 1 34194540 missense probably benign 0.41
R6232:Dst UTSW 1 34188172 missense probably damaging 1.00
R6259:Dst UTSW 1 34182396 missense probably benign 0.26
R6267:Dst UTSW 1 34228672 missense probably damaging 1.00
R6273:Dst UTSW 1 34275266 missense probably damaging 1.00
R6284:Dst UTSW 1 34229085 missense probably damaging 1.00
R6347:Dst UTSW 1 34179684 unclassified probably null
R6365:Dst UTSW 1 34191927 missense probably damaging 1.00
R6385:Dst UTSW 1 34307468 missense possibly damaging 0.85
R6389:Dst UTSW 1 34193184 missense probably damaging 0.99
R6395:Dst UTSW 1 34182690 missense probably benign 0.17
R6416:Dst UTSW 1 34116128 missense probably damaging 1.00
R6467:Dst UTSW 1 34295196 missense probably damaging 1.00
R6470:Dst UTSW 1 34295237 missense probably damaging 1.00
R6477:Dst UTSW 1 34208728 intron probably null
R6485:Dst UTSW 1 34294529 missense probably damaging 1.00
R6491:Dst UTSW 1 34193012 missense probably benign 0.10
R6525:Dst UTSW 1 34163135 missense probably damaging 1.00
R6533:Dst UTSW 1 34303509 missense probably benign 0.08
R6595:Dst UTSW 1 34250680 missense probably damaging 1.00
R6622:Dst UTSW 1 34179251 missense probably benign 0.22
R6646:Dst UTSW 1 34268807 missense possibly damaging 0.80
R6648:Dst UTSW 1 34262041 missense possibly damaging 0.84
R6700:Dst UTSW 1 34256323 missense probably damaging 1.00
R6743:Dst UTSW 1 34270890 missense probably damaging 1.00
R6761:Dst UTSW 1 34214550 missense probably damaging 1.00
R6766:Dst UTSW 1 34294483 missense probably damaging 1.00
R6768:Dst UTSW 1 34181712 missense probably damaging 0.98
R6810:Dst UTSW 1 34212298 missense probably damaging 1.00
R6815:Dst UTSW 1 34228369 missense possibly damaging 0.67
R6820:Dst UTSW 1 34211256 missense probably damaging 1.00
R6822:Dst UTSW 1 34275674 missense probably damaging 0.99
R6831:Dst UTSW 1 34190684 missense probably benign 0.03
R6874:Dst UTSW 1 34289651 missense probably benign 0.29
R6945:Dst UTSW 1 34190490 missense probably damaging 1.00
R6985:Dst UTSW 1 34190853 missense probably benign 0.08
R6995:Dst UTSW 1 34166234 missense probably damaging 1.00
R7038:Dst UTSW 1 34182798 nonsense probably null
R7043:Dst UTSW 1 34257911 missense probably damaging 0.99
R7070:Dst UTSW 1 34275302 missense probably damaging 1.00
R7097:Dst UTSW 1 34169260 missense probably damaging 1.00
R7139:Dst UTSW 1 34299807 missense probably damaging 0.97
R7144:Dst UTSW 1 34152243 missense probably damaging 1.00
R7145:Dst UTSW 1 34189882 missense probably benign
R7158:Dst UTSW 1 34274285 missense probably benign
R7207:Dst UTSW 1 34163337 missense probably damaging 0.98
R7320:Dst UTSW 1 34191094 missense probably benign
R7324:Dst UTSW 1 34006224 missense possibly damaging 0.93
R7327:Dst UTSW 1 34201405 missense probably damaging 1.00
R7340:Dst UTSW 1 34190729 missense probably benign 0.01
R7358:Dst UTSW 1 34191673 missense probably benign
R7373:Dst UTSW 1 34188391 missense probably benign 0.02
R7376:Dst UTSW 1 34192689 missense probably benign
R7453:Dst UTSW 1 34191358 missense possibly damaging 0.95
R7467:Dst UTSW 1 34191155 missense probably benign 0.00
R7471:Dst UTSW 1 34194570 missense possibly damaging 0.49
R7472:Dst UTSW 1 34218497 missense probably benign 0.02
R7485:Dst UTSW 1 34274189 missense probably benign 0.31
R7504:Dst UTSW 1 34201017 missense probably damaging 1.00
R7516:Dst UTSW 1 34170479 missense probably benign 0.10
R7524:Dst UTSW 1 34291893 missense possibly damaging 0.94
R7528:Dst UTSW 1 34294522 missense probably damaging 1.00
R7560:Dst UTSW 1 34182451 missense possibly damaging 0.92
R7582:Dst UTSW 1 34169883 missense probably damaging 1.00
R7585:Dst UTSW 1 34114015 missense possibly damaging 0.50
R7594:Dst UTSW 1 34213013 missense probably damaging 1.00
R7600:Dst UTSW 1 34266930 missense probably damaging 1.00
R7619:Dst UTSW 1 34199428 missense probably benign 0.02
R7623:Dst UTSW 1 34170436 missense probably damaging 0.99
R7649:Dst UTSW 1 34167697 missense probably benign 0.13
R7654:Dst UTSW 1 34228977 missense probably damaging 1.00
R7654:Dst UTSW 1 34228978 missense probably damaging 1.00
R7661:Dst UTSW 1 34256353 critical splice donor site probably null
R7667:Dst UTSW 1 34179035 missense possibly damaging 0.82
R7677:Dst UTSW 1 34169322 critical splice donor site probably null
R7698:Dst UTSW 1 34190387 missense probably benign 0.02
R7765:Dst UTSW 1 34275694 missense probably damaging 0.97
R7772:Dst UTSW 1 34181388 missense possibly damaging 0.90
R7779:Dst UTSW 1 34194597 missense probably damaging 0.99
R7791:Dst UTSW 1 34154592 missense probably damaging 0.99
R7821:Dst UTSW 1 34275362 critical splice donor site probably null
RF014:Dst UTSW 1 34247679 missense probably benign 0.00
X0026:Dst UTSW 1 34213055 missense probably damaging 0.97
X0028:Dst UTSW 1 34192199 missense probably damaging 1.00
X0063:Dst UTSW 1 34195895 missense probably damaging 1.00
X0066:Dst UTSW 1 34275703 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, gDNA
MMRRC Submission 038167-MU
Last Updated 2019-09-04 9:47 PM by Anne Murray
Record Created 2014-11-21 4:37 PM by Jeff SoRelle
Record Posted 2015-03-03
Phenotypic Description

Figure 1. Gobble mice have an abnormal gait.

Figure 2. Gobble mice exhibit reduced body weights. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gobble phenotype was identified among N-Nitroso-N-ethylurea (ENU)-induced G3 mutants of pedigree R1395, some of which had an ataxic gait (Figure 1). The mice had reduced body weights compared to wild-type mice (Figure 2) and one was noted to make a constant clucking sound.

Nature of Mutation

Figure 3. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 66 mutations (X-axis) identified in the G1 male of pedigree R1395.  Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. The neurological and body weight phenotypes were linked to a mutation in Dst: a T to C transition at base pair 34,165,155 (v38) on chromosome 1, or base pair 256,949 in the GenBank genomic region NC_000067 within the donor splice site of intron 19 in the longest isoform (i.e., DST-b1; NM_134448). The strongest association was found with a recessive model of linkage to the body weight, wherein two variant homozygotes departed phenotypically from 15 homozygous reference mice and 21 heterozygous mice with a P value of 5.369 x 10-5 (Figure 3). The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in an in-frame skipping of the 96-base pair exon 19 (out of 98 total exons). Exon 19 encodes amino acids 778-809 in the DST-b1 protein.

 

               <--exon 18        <--exon 19 intron 19-->           exon 20-->                 <--exon 98
256211 ……CGCTTGACCATCGAG ……TCTGCCTATTTCGAG gtacgtcggtagagtcaca…… TTTTTCAATGATGCC…… ……AAGTCTTCGAAGAGATAG
773    ……-R--L--T--I--E- ……-S--A--Y--F--E-                       -F--F--N--D--A-…… ……-K--S--S--K--R--*-

            correct           deleted                                          correct

 

Genomic numbering corresponds to NC_000067. The donor splice site of intron 19, which is destroyed by the gobble mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

 

Alternatively, a cryptic splice site in exon 19 may be used that would result in a 43-nucleotide deletion in exon 19. Use of a cryptic site would lead to a frame-shift beginning after amino acid 794 of the coded protein and premature termination after the inclusion of 12 aberrant amino acids.

 

              <--exon 18          <--exon 19-->           intron 19-->          exon 20-->
256211 ……CGCTTGACCATCGAG GCGTACAGAGCGGCC……TCTGCCTATTTCGAG gtacgtcggtagagtcaca…… TTTTTCAATGATGCCAAAGAAGCCACTGATTACCTAA
773    ……-R--L--T--I--E- -A--Y--R--A--A-……-S--A--Y--F--E-                       --F--S--M--M--P--K--K--P--L--N--T--*

             correct         correct          deleted                                          aberrant

 

Genomic numbering corresponds to NC_000067. The donor splice site of intron 19, which is destroyed by the gobble mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 4. Dst encodes several DST isoforms. The DST-b1, -a1, and e isoforms are shown. Alternative splicing of the first 5' exons yields three dystonin-a/b isoforms (e.g., DST-a1, DST-a2, and DST-a3 and DST-b1, DST-b2, and DST-b3, respectively). Dystonin-a/b1 contain a unique N-terminal region followed by CH1 and CH2 domains in tandem. Dystonin-a/b2 (not shown) contain a highly conserved N-terminal transmembrane (TM) domain followed by a CH1 and CH2 domain in tandem. Dystonin-a/b3 (not shown) harbor a conserved myristoylation motif (myr) followed by a single CH2 domain. The spectrin domain contains several plectin and spectrin repeats. See the text for more details. The gobble mutation is within intron 19 and is predicted to affect the DST-a and DST-b isoforms only; mutation is shown in the DST-b1 isoform only. Image is interactive; click to view other Dst mutations. Abbreviations: SPEC, spectrin repeat domain; EF, EF hands; CH1/2, calponin homology domains; IFBD, intermediate filament-binding domain, PRD, plakin-repeat domain.

Dst encodes dystonin (DST) [alternatively, bullous pemphigoid antigen 1 (Bpag1)] (1). DST is a member of the plakin family that also includes envoplakin, periplakin, desmoplakin, plectin, epiplakin and microtubule–actin cross-linking factor (MACF) [(1); reviewed in (2)]. Each of the plakin family of proteins, with the exception of epiplakin, has an N-terminal plakin domain as well as different combinations of structural domains including an actin-binding domain (ABD), a spectrin-repeat (SR)-containing rod domain, and a microtubule-binding domain (MTBD) (3). The plakin domain in DST is comprised of two pairs of SRs separated by a putative Src-homology-3 (SH3) domain; the plakin domain also contains a nuclear localization signal (4;5). The epithelial isoform of DST (DST-e) has the plakin domain, rod domain, and a C-terminal intermediate filament-binding domain/plakin-repeat domain (IFBD/PRD2) only (6). The SRs within the rod domain are three-helix bundles that comprise a coiled-coil. SRs often serve a structural role by functioning as a spacer domain between the termini of proteins (7). In the costamere of muscle fibers, the SRs of DST confer flexibility to the protein (8). Several structural and signaling proteins interact with DST through the SR domain (9). For example, the SR domain of the neuronal isoform of DST (DST-a1) binds dynactin p150Glued to mediate proper retrograde axonal transport (10). The MTBD domain in DST-a1 mediates the ability of DST to coalign with microtubules throughout the cytoplasm (11). The GAR/GAS2 domain binds to and stabilizes microtubules, while the GSR region bundles microtubules (12). An SxIP motif at the C-terminus of DST-a/b forms a complex with end-binding protein 1 (EB1), a component of the microtubule plus end complex (13). DST-b1 differs from DST-a1 in that DST-b1 has a putative IFBD/PRD2 following the plakin domain

 

Dst encodes tissue-specific DST isoforms, including neuronal DST-a, muscle isoforms (DST-b), and the epithelial DST-e [Figure 4; (1;14-16); reviewed in (2)]. Alternative splicing of 5’ exons in Dst results in three tissue-specific isoforms in muscle (i.e., DST-b1/2/3) and neurons (i.e., DST-a1/2/3) [(11;14;17); reviewed in (2)]. The DST-a1 and DST-b1 isoforms share similar domains including the ABD, plakin, and rod domains as well as the EF hand calcium-binding motifs (8) and a growth arrest specific protein 2 (GAS2) related (GAR) domain that contains a MTBD and a Gly-Ser-Arg (GSR) repeat region (6;14). Each DST isoform has different domains upstream of the ABD (1;18). The unique N-terminal domains found in the DST-a isoforms facilitates cell-specific localization and function (17;19-21).  DST-a2/b2 have an N-terminal transmembrane domain upstream of tandem calponin-homology (CH)1/CH2 domains (11). The transmembrane domain of the DST-a2 isoform directs the isoform to the membranes of the perinuclear region [reviewed in (2)]. CH domains fold into four linked α-helices (22). The CH1 domain alone can colocalize with stress fibers, but not as efficiently as the CH1 and CH2 domains together; however, the CH2 domain alone does not associate with actin stress fibers [reviewed in (2)]. The DST-a1/b1 isoforms lack N-terminal transmembrane domains, but have CH1 and CH2 domains [reviewed in (2)]. The DST-a3/b3 isoforms do not have a transmembrane domain or a CH1 domain, but have a myristoylation motif followed by one CH2 domain [reviewed in (2)]. DST-3a can also be palmitoylated at its N-terminus. The myristoylation and/or palmitoylation promotes membrane binding (17).

 

The gobble mutation is predicted to affect all of the DST isoforms. The affect of the mutation on DSTgobble expression is unknown.

Expression/Localization

The expression of the DST isoforms is tissue-specific, although lower levels of each isoform can be amplified from nondominant tissues (14).

 

In the adult brain, DST-a1 and DST-a2 transcripts can be detected, but only small amounts of DST-a3 transcripts. DST-3a is the major isoform in the lung, while DST-a2 and DST-a3 are the major isoforms in the kidney and testis. All of the DST-a isoforms were expressed in the liver, spleen, and ovary (17). DST-a1 localizes to the cytoplasm and at the plasma membrane, while DST-a2 localized with actin stress fibers and actin filaments at the nuclear and perinuclear membranes [(5;11;17); reviewed in (2)]. The localization of DST-a3 is unknown.DST-a is expressed as early as embryonic day (E) 9.5 in the developing spinal cord and brain (14;23). During embryogenesis, DST-a is highly expressed in the ventral horn. At E17.5, the levels of DST-a are reduced in the embryonic motor neurons compared to levels in the dorsal root ganglion, but DST-a levels persist in postnatal motor neurons (24). At postnatal day (P)10, DST-a is expressed in the cortex, dentate gyrus, and hippocampal regions (CA1-CA3), in the thalamic nuclei, and in the granular and Purkinje cell layers of the cerebellum (23;25). In the adult, DST-a is expressed in the soma, axons, and preterminal branches of the peripheral and central nervous system (25;26).  Dst-a is expressed in various cranial nerves including I (optic), II (olfactory), V (trigeminal), VII (facial), VIII (vestibulocochlear), IX (glossopharyngeal), and X (Vagus) [reviewed in (2)].

 

DST-b is expressed in heart and skeletal muscle (14). DST-b localizes to Z-discs, intercalated discs, and sarcolemma (27).

 

DST-e is expressed in the epidermis and mucosal epithelia of the digestive tract (14;25;26). DST-e has slight expression in the testis, ovary, and lung (17). Within epithelial cells, DST-e localizes to hemidesmosomes (5).

Background
Figure 5. Putative Dystonin-a functions in the cell. Dystonin-a1 interacts wtih actin microfilaments, microtubules, dynactin p150Glued. Dystonin-a2 localizes to the intranuclear space and nuclear envelope where it associates with the outer nuclear envelope protein nesprin-3α. Dystonin-a1 maintains ER membrane organization through interactions with cytoskeletal filaments, with the Golgi, and actin microfilaments. Dystonin-a3 localizes to the cell membrane and interacts with cytoskeletal filaments.  Figure adapted from Ferrier, A., et al. 2014.

Interactions within the cytoskeletal network are essential for cell motility, growth cone guidance, cellular division, chromosomal separation, and wound healing [reviewed in (2)]. Proteins in the plakin family are scaffold proteins that link intermediate filaments to desmosomes and hemidesmosomes to regulate cytoskeletal dynamics, cell migration, differentiation, and stress responses (17;28;29). The individual functions of the DST isoforms are discussed, below.

 

DST-a

The DST-a isoforms bind actin filaments, intermediate filaments, and microtubules to maintain cytoskeletal integrity [Figure 5; (26;30;31)]. DST-a is essential for the development and survival of neurons in mice and humans (23;32;33). DST-a1 and DST-a3, which localize to the plasma membrane are proposed to function in the invagination process of immature vesicles and the subsequent trafficking and fusion of the vesicles with endosomes [reviewed in (2)]. The localization of DST-a2 to the perinuclear region of the cell as well as its association with the actin cytoskeleton indicates that DST-a2 may regulate nucleus, endoplasmic reticulum (ER), and/or Golgi integrity (11). In addition, DST-a2 may regulate the development and transport of membrane compartments in the secretory pathway through an interaction with clathrin and microtubule-association protein 1B (MAP1B) (19). Silencing of DST-a2 in immortalized neuronal cells disrupts ER homeostasis (20). In Dst mutant mice (Dst27 and DstTg4), organelle integrity is lost leading to ER-mediated apoptosis of sensory neurons (20). In addition, the ER was dilated and ER stress proteins were activated (20). DST-a2 is required to maintain the structural integrity of the Golgi through an association with microtubules near the centrosome and the dynamics of the secretory pathway (19). Loss of DST-a2 expression resulted in defective anterograde transport and secretion along with dilation of the Golgi (19). DST-a2 and MAP1B also maintain the perinuclear acetylation of α-tubulin, a modification that is required for Golgi organization (19). Homozygous mutations in DST that cause loss of DST-a1/2/3 expression have been documented to cause hereditary sensory and autonomic neuropathy type 6 (HSAN6) (32;34). Patients with HSAN6 exhibit limb contractures and dysautonomia and the condition is ultimately fatal (34). A mutation within the MTBD of the DST-a/b isoforms leads to sensory autonomic neuropathy with dysautonomia, severe psychomotor retardation, and early death (32). A translocation disrupting the DST-a and DST-b isoforms can also cause encephalopathy, motor and mental retardation, and visual impairment (35).
 

DST-B

DST-b associates with microfilaments, intermediate filaments and microtubules in the muscle (14). DST-b is proposed to function in the maintenance of muscle cell architecture by crosslinking actin with desmin filaments (36). DST-b is not required for myogenic differentiation (37).The cytoarchitecture of the skeletal muscle in Dst knockout (Dst-/-) mice is disorganized; terminally differentiated myotubes contained myofibrils that were imcompletely assembled (36). In addition, there was an abnormal distribution of mitochondria in the skeletal muscle of the Dst-/- mice (36). Loss of DST-b function may contribute to the muscle weakness observed in Dst-/- mice (36).

 

DST-e
DST-e localizes to hemidesmosomes and binds keratin intermediate filaments in keratinocytes in the epidermis, functioning as an intracellular bridge and maintaining cellular integrity (14;38;39). DST-e also functions in hemidesmosome maturation and the suppression of focal adhesion dynamics (40). DST-e loss-of-function mutations result in defects in keratinocyte morphology, adhesion, and migration (40). The observed change in keratinocyte migration was found to be due to alterations in surface β4 integrin and active β1 integrin stability at adhesion sites. DST-e is as an autoantigen in bullous pemphigoid, an autoimmune subepidermal blistering disease (38;41;42). Mutations affecting the DST-e isoform lead to epidermolysis bullosa simplex with fragility of basal keratinocytes and skin blistering (41;43). Dst-/- mice with a targeted mutation in the 5’ end of the coding region have more fragile skin than wild-type mice and exhibit microscopic skin lesions (18).

Putative Mechanism

Several Dst mouse models have been characterized and all exhibit variability in phentoypic severity and survival. It is unclear whether phenotypic differences were due to the genetic backgrounds of the mutant mice or due to the impact of the mutation on the expression pattern of the DST-a isoforms. Collectively, the phenotype of mice with mutations in Dst is referred to as dystonia musculorum (dt) and is characterized by sensory neuron degeneration, ataxia, tremor, muscle weakness, low body weights, and reduced numbers of motor neurons at approximately 2 weeks after birth (44-48). The neuronal phenotype in the Dstdt mice progresses quickly with mice exhibiting uncoordinated limb movement, and writhing and twisting of the trunk as well as hyperflexion and pronation of foot paws (44;45). Dt affects the function of cranial nerves V, VII, IX, and X; the function of cranial nerves I, II, and VIII are maintained leading to intact hearing and vision (23;24). Skeletal muscle in the dt  mice were weak and the cytoarchitecture disorganized (36). Dt mutant mice exhibit lethality at approximately P14-21. Increased expression of DST-a2 in the neural tissues of the DstTg4/Tg4 mouse model reduced the severity of the disease including a progressive weight gain between P16 and P52 and increased the life span of the mice to a mean of P55 due to improved microtubule and organelle integrity within proprioceptive sensory neurons and subsequent delayed apoptosis of the sensory neurons (34).

 

The dt phenotype is due to degeneration in large and medium-sized proprioceptive primary sensory afferents of the dorsal root ganglion and cranial nerves (31;46). The microtubule network is disorganized and the cytoplasmic organelles accumulate within axonal swellings; axonal swelling were observed in sensory nerve fibers as early as E15.5 (49). In the DstJ/DstJ model, γ-aminobutyric acid (GABA) synthesis was diminished in striatum and substantia nigra with a concomitant decrease of glutamate, aspartate, and GABA in the cerebellar vermis (50). In the Dst27J mouse model, orthograde and retrograde axonal transport of acetylcholinesterase was affected in the sciatic nerves and the number of alpha motor neurons and motor axons of the L1 spinal cord are reduced (51).

 

The phenotype observed in the gobble mice indicates a loss-of-function for DST-a/bgobble. Skin lesions were not observed in gobble, indicating that expression of DST-e may be functional.

Primers PCR Primer
gobble_pcr_F: TCCTTAATGCACACAGAGCGCC
gobble_pcr_R: TTTCCCCTCTAGGATGAGACAGCAG

Sequencing Primer
gobble_seq_F: AGGCCAGGAATTGCACCTTC
gobble_seq_R: TAGGATGAGACAGCAGCACTTAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 486 nucleotides is amplified (chromosome 1, + strand):


1   tccttaatgc acacagagcg ccccctcctg ggaggccagg aattgcacct tctacataaa
61  caggtttcac aattcatgaa ttagatgtgc tttctacagt attttttctt tatgaaagat
121 aaatacgctg cattaaataa gaagccctca aatagatgag tgttttaaat attattatat
181 attaaatgta ataattccaa tgatctgccc agctttcact gtgtctcctc cctcaggcgt
241 acagagcggc catgcagaca cagtggagct ggatcctaca gctgtgccag tgcgtggagc
301 agcacattca ggagaactct gcctatttcg aggtacgtcg gtagagtcac agcgtgaaca
361 cacagcattg ctgtttgggc cgaggtgcag aactaccaca aagaaacaat gtgcagagca
421 cacggggagt aagccagtac gttcttttca ggacctaagt gctgctgtct catcctagag
481 gggaaa


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, William McAlpine, Zhe Chen, Noelle Hutchins