Phenotypic Mutation 'donald' (pdf version)
List |< first << previous [record 70 of 132] next >> last >|
Alleledonald
Mutation Type nonsense
Chromosome10
Coordinate10,741,508 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Grm1
Gene Name glutamate receptor, metabotropic 1
Synonym(s) Grm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik
Chromosomal Location 10,686,059-11,082,356 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_016976, NM_001114333; MGI:1351338

Mapped No 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000037255] [ENSMUSP00000101189] [ENSMUSP00000101190]
SMART Domains Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: Y510*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 1.1e-94 PFAM
Pfam:Peripla_BP_6 151 340 1.4e-10 PFAM
Pfam:NCD3G 521 571 5.5e-16 PFAM
Pfam:7tm_3 604 837 2.4e-55 PFAM
low complexity region 969 975 N/A INTRINSIC
low complexity region 983 993 N/A INTRINSIC
low complexity region 1013 1033 N/A INTRINSIC
low complexity region 1071 1088 N/A INTRINSIC
low complexity region 1093 1109 N/A INTRINSIC
low complexity region 1126 1136 N/A INTRINSIC
GluR_Homer-bdg 1149 1199 6.85e-27 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: Y510*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: Y510*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 16964410
growth/size 16964410
life span-post-weaning/aging 16964410
skeleton phenotype 16964410
Penetrance  
Alleles Listed at MGI

All mutations/alleles(13) : Chemically induced (ENU)(2) Gene trapped(1) Spontaneous(5) Targeted(4) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Grm1 APN 10 10720039 missense probably benign 0.01
IGL02078:Grm1 APN 10 10689610 missense probably benign 0.02
IGL02156:Grm1 APN 10 10719976 missense probably damaging 0.99
IGL02476:Grm1 APN 10 10689453 missense probably benign 0.29
IGL02498:Grm1 APN 10 10719979 missense probably damaging 1.00
IGL02621:Grm1 APN 10 10689011 nonsense probably null
IGL03192:Grm1 APN 10 11079916 missense possibly damaging 0.66
IGL03342:Grm1 APN 10 11079971 missense probably benign 0.08
IGL02796:Grm1 UTSW 10 10689667 missense probably benign
R0294:Grm1 UTSW 10 11080399 missense probably damaging 1.00
R0525:Grm1 UTSW 10 10719209 splice site probably benign
R0554:Grm1 UTSW 10 10719923 missense probably benign 0.01
R1184:Grm1 UTSW 10 10720034 missense probably benign 0.40
R1319:Grm1 UTSW 10 10689398 missense probably benign 0.05
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1494:Grm1 UTSW 10 10689706 missense probably benign 0.04
R1589:Grm1 UTSW 10 10719967 missense probably benign 0.06
R1615:Grm1 UTSW 10 10741508 nonsense probably null
R1720:Grm1 UTSW 10 10746794 splice site probably null
R1738:Grm1 UTSW 10 10936419 missense probably damaging 1.00
R1763:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R1774:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R2041:Grm1 UTSW 10 10746603 missense probably damaging 0.98
R2092:Grm1 UTSW 10 10689225 missense probably benign 0.00
R2198:Grm1 UTSW 10 10782776 missense probably damaging 1.00
R2297:Grm1 UTSW 10 11080414 missense probably benign 0.03
R2333:Grm1 UTSW 10 10719346 missense probably damaging 0.98
R2333:Grm1 UTSW 10 10719619 missense probably benign 0.31
R2914:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3105:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3106:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3705:Grm1 UTSW 10 10782729 missense possibly damaging 0.95
R3931:Grm1 UTSW 10 10719878 missense probably benign 0.44
R4810:Grm1 UTSW 10 10782694 missense probably damaging 1.00
R4892:Grm1 UTSW 10 10719587 missense possibly damaging 0.81
R4938:Grm1 UTSW 10 10936513 missense probably damaging 1.00
R4947:Grm1 UTSW 10 10782633 missense probably damaging 1.00
R4966:Grm1 UTSW 10 10719665 nonsense probably null
R5152:Grm1 UTSW 10 11079875 missense probably benign 0.13
R5283:Grm1 UTSW 10 10733192 missense possibly damaging 0.70
R5317:Grm1 UTSW 10 10746699 missense possibly damaging 0.77
R5374:Grm1 UTSW 10 11080442 missense probably benign 0.14
R5428:Grm1 UTSW 10 10719563 missense probably damaging 1.00
R5604:Grm1 UTSW 10 10746735 missense probably damaging 1.00
R5894:Grm1 UTSW 10 11080255 missense probably damaging 1.00
R5896:Grm1 UTSW 10 11080550 utr 5 prime probably benign
R5899:Grm1 UTSW 10 10689348 missense probably benign
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6139:Grm1 UTSW 10 10746331 intron probably benign
R6144:Grm1 UTSW 10 11079896 missense probably benign 0.08
R6208:Grm1 UTSW 10 10719946 missense probably damaging 1.00
R6976:Grm1 UTSW 10 10689180 missense probably benign 0.00
X0002:Grm1 UTSW 10 10936513 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 038206-MU
Last Updated 2018-04-25 2:04 PM by Anne Murray
Record Created 2014-12-03 7:24 AM by Carlos Reyna
Record Posted 2015-06-17
Phenotypic Description
Figure 1. The donald phenotype.

The donald phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1615, some of which exhibited ataxia (Figure 1), kyphosis, and premature death.

 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. Among these, only one affected a gene (Grm1) with known neurological functions. The mutation in Grm1 was presumed to be causative because the donald neurological phenotype mimics other mutant alleles of Grm1 (see MGI for a list of Grm1 alleles). The Grm1 mutation in donald is a C to A transversion at base pair 10,741,508 (v38) on chromosome 10, or base pair 340,870 in the GenBank genomic region NC_000076 encoding Grm1. The mutation corresponds to residue 1,931 in the NM_016976 mRNA sequence in exon 6 of 9 total exons and residue 1,931 in the NM_001114333 mRNA sequence in exon 6 of 10 total exons.

 

340853 CTGAATATCGATGATTACAAAATCCAGATGAAC

505    -L--N--I--D--D--Y--K--I--Q--M--N-

 

Genomic numbering corresponds to NC_000076. The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 510 (Y510) for a premature stop codon (Y510*) in all isoforms of the metabotropic glutamate receptor 1 (mGluR1) protein.

Protein Prediction
Figure 2. Domain structure of mGluR1a. mGluR1a is a G protein-coupled receptor with a signal peptide (SP), a ligand-binding domain (LBD), a Cys-rich domain (CYS), seven transmembrane domains (TRANS), and a proline-rich region. The location of the donald mutation is shown with a red asterisk.
Figure 3. Crystal structure of the ligand-binding domain of rat mGluR1a. The two lobes, LB1 (N-terminal) and LB2 (C-terminal), are indicated. Figure was generated using UCSF Chimera and is based on PDB:1ISS and (3).

mGluR1 is a class 3/C G-protein-coupled receptor (GPCR). Class 3 GPCRs include class B GABA (GABAB) receptors, taste and pheromone receptors, and calcium-sensing receptor (CaR). Class 3 GPCRs have an N-terminal signal peptide (amino acids 1-20 in mGluR1), large extracellular ligand-biding domains (LBDs), a cysteine-rich domain (CRD), seven transmembrane domains, and a variable-length intracellular C-terminal tail (Figure 2).

 

The N-terminal LBD region of mGluR1 (amino acids 21-510) is essential for the recognition of glutamate as well as receptor agonists and competitive antagonists (1;2). The structure of the LBD of rat mGluR1 (m1-LBR) in both an active (open/closed) and resting (open/open) form have been solved [Figure 3; PDB: 1ISS; (3)]. Both the active and resting m1-LBR structures were a homodimer connected via a disulfide bond between Cys140 from each monomer. The role of mGluR dimerization is unknown, but is proposed to modulate the proper folding of the mGluRs, permitting the proper function of the receptor. The LBD forms two lobes [LB1 (N-terminal) and LB2 (C-terminal)] connected by three short loops and separated by a cavity where glutamate binds (3-5). The relative positions of LB1 and LB2 define the open and closed states of the receptor. Glutamate binding results in closing of the N-terminal lobes around the ligand. The conformational change between the open and closed forms is a rotation about an axis that passes across the three connecting loops (3;6). Within the dimer, the two LB1 domains rotate by about 70° (3)  In the open/closed active state, two molecules of glutamate bind each monomer through an interaction only with the LB1 interface. In the closed state, glutamate interacts with both LB1 and LB2; full mGluR1 activation requires glutamate binding to both subunits (7). Several residues are known to be involved in the interaction with glutamate, including Ser165 and Thr188. Arg178 is also proposed to facilitate an interaction with an acidic group of mGluR agonists (8).

 

The mGluR1 LBD is separated from the transmembrane region by a cysteine (Cys)-rich region (amino acids 521-570). The Cys-rich region is essential for proper folding and trafficking of mGluRs and is proposed to be a flexible spacer that allows for the displacement of the glutamate binding pocket towards the transmembrane domains (9-12). Several cysteines within the N-terminal tail and the Cys-rich region form intramolecular disulfide bonds including Cys67-Cys109, Cys289-Cys291, Cys378-Cys394, Cys432-Cys439, Cys657-Cys746. 

 

The second intracellular (i2) loop and the membrane-proximal C-terminal region mediate the interaction with either Gs or Gq; the role of G proteins in the Gi/o family is unclear [(13-17); reviewed in (18)]. Mutation of Lys690 within the i2 region switches mGluR1 coupling to different members of the Gi protein family. Amino acids within the third intracellular (i3) loop are also essential for the activation of Gs or Gq.

 

Grm1 generates multiple mGluR1 isoforms due to alternative splicing (Table 1). The mGluR1 variants differ in the nature and size of their respective C-termini. mGluR1a is the longest isoform, while the other variants have shorter C-terminal tails; the first 886 amino acids of each isoform is identical to each other (19).

 

Table 1. Characteristics of the mGluR1 isoforms

Isoform symbol

Alternative designation

Size (amino acids)

Molecular description and features

Source

Expression/Localization

References

mGluR1a

mGluR1α

1199

Longest isoform with a 361 aa intracellular C-terminal domain

Human, rat, mouse

Cerebellum (granule cells, Purkinje cells, and basket cells), cerebral cortex, thalamus, subthalamic nucleus, olfactory bulb, amygdala, hippocampus, substantia nigra, caudate nucleus, and putamen

(19-23)

mGluR1b

mGluR1β1

906

Insertion of an 85-bp exon 9; exon codes for an in-frame stop codon, thus generating a substitution of the last 318 amino acids of mGlu1a with 20 different residues; contains a 68 aa intracellular domain

Human, rat, mouse

Cerebellum, olfactory bulb

(24)

mGluR1c

---

897

Alternatively spliced exon inserted after the seventh transmembrane domain; may derive from a recombination event; differs from mGluR1b in that the 21 C-terminal amino acids of mGluR1b are replaced by 11 aa; contains a 59 aa C-terminal domain

Rat only?

Cerebellum; less expression than mGluR1a and mGluR1b

(25)

mGluR1d

mGluR1γ

908

Alternative splice acceptor site in exon 10 and subsequent frameshit inserts a stop codon 22 amino acids downstream from splice site; contains a 70 aa C-terminus

Human, rat

Cerebellum (granule cells) and kidney

(26-28)

mGluR1f

mGluR1β2

906

Insertion of the same 85-bp exon (exon 9) that generates mGlu1β1, plus the usage of an alternative splice acceptor in exon 10 that is located 35 bp downstream from the 5′-end of the exon; contains a 68 aa C-terminus

Rat only?

Cerebellum

(29)

mGluR1g

---

887

Skipping of the splice donor site in exon 8; in-frame stop codon 1 bp downstream of the skipped splice site; may derive from partially processed pre-mRNA; C-terminus consists of 1 aa after the residue 886

Human, rat

Cerebellar granule cells

(19)

mGluR1h

---

897

Predicted C-terminal splice variant of 10 additional amino acids; encoded by two previously unidentified exons (exon IXa and exon IXb)

Human only?

Melanoma cell lines and melanocytes

(30)

mGluR1E55

mGluR1δ

321

Insertion between exons 3 and 4 of a 110-bp exon (designated as exon E55), which contains an in-frame stop codon; contains only the extracellular domain; may be secreted

Mouse only?

Adult cerebellum and heart; function unknown

(31)

 

The long C-terminal tail of mGluR1a contains motifs essential for targeting of mGluR1a in Purkinje cell (PC) spines, for inositol 1,4,5-trisphosphate (IP3) receptor-mediated Ca2+ release from the smooth endoplasmic reticulum in PCs, long-term depression induction, CF synapse elimination, and delay eye blink conditioning (32). A PSD-95/discs-large/ZO-1 (PDZ) domain binding sequence (SSSTL; amino acids 1195-1199) mediates interactions with several scaffolding and cytoskeletal proteins (33). A proline-rich domain (PPSPFR; amino acids 1152-1157) interacts with Homer proteins to mediate subsequent interactions with signaling proteins including IP3 (34;35) as well as to mediate receptor trafficking (36;37). Two calmodulin binding sites have also been identified in the C-terminal tail of mGluR1a (38). Several serine/threonine residues within the CaM-binding sites are phosphorylated by protein kinase C (PKC; see the record for Untied), which suppresses the interaction between mGluR1a and CaM (39-41). Siah1A (seven in absentia homolog 1A), an E3 ubiquitin ligase, binds the C-terminal tail of mGluR1a, resulting in its degradation (42). The shorter C-terminal tail in the mGluR1b, mGluR1c, and mGluR1d variants causes reduced agonist potency and slower agonist-stimulated second messenger responses compared with mGluR1a (17;25;26;43;44).

 

mGluR1 has several N-linked glycosylation consensus sequences [AsnXxx(Thr/Ser); Xxx is any amino acid] within the N-terminal domain and the extracellular loops. Mouse mGluR1 is predicted to be N-linked glycosylated at Asn98, Asn223, Asn397, Asn515, and Asn747. mGluR1 N-linked glycosylation is essential for efficient agonist-stimulated phosphoinositide hydrolysis and receptor dimerization (45).

 

The mutation in donald results in substitution of tyrosine 510 (Y510) for a premature stop codon (Y510*) in all mGluR1 isoforms. Y510 is within the LBD of mGluR1; Y510 is not predicted to be involved in glutamate binding.

Expression/Localization

mGluR1 is expressed in all CA3 lamina of the hippocampus (46-48). mGluR1 is localized mainly to the postsynapse including the periphery of the postsynaptic densities (49), but mGluR1 can also be presynaptic. The mGluR1 isoforms exhibit tissue-specific expression patterns including differential expression in the cerebellum, hippocampus, olfactory bulbs, and kidneys (Table 1) (28).

 

A coat component of caveolae, caveolin-1, binds mGluR1 (50). Association between caveolin-1 and mGluR1 regulates the rate of constitutive receptor internalization and subsequent level of mGluR1 expression at the cell surface as well as mGluR1-associated ERK/MAPK activation and calcium signaling (50;51).

Background
Figure 4. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, the GPCR undergoes conformational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.
Figure 5. Glutamate-stimulated signaling through mGluR7 and mGluR1a. Upon presynaptic depolarization, Ca2+ enters the presynapse through voltage-gated Ca2+ channels (VGCCs) and induces glutamate release and CaM activation. Upon G-protein activation, PKC is recruited to mGluR7 through binding to PICK1. Activation of mGluR7 results in inhibition of adenylate cyclase activity (i.e., the formation of cAMP and ATP), the attenuation of N-type VGCCs, the activation of K+ channels, and the subsequent decrease in neurotransmitter (glutamate and GABA) release. See the record for shaky for more details on the signaling pathways activated downstream of mGluR7. Upon stimulation by glutamate, mGluR1s in the post-synaptic membrane couple to multiple signaling pathways through different G proteins. Several second messenger systems are activated upon mGluR1 activation including PKB, PLCγ, PI3K/AKT/mTOR, IP3/DAG, NFκB and CaM. The C-terminus of mGluR1 interacts with Homer proteins, which facilitate the association of mGluR1 with IP3 receptors in the endoplasmic reticulum. Activation of these signaling pathways result in cell survival (PKC/PLD), proliferation (PKC/ERK1/2), learning, memory, and long-term potentiation (CaM), synaptic remodeling and plasticity (cAMP, PI3K/AKT/mTOR). See the text for more details on the signaling pathways activated downstream of mGluR1a.

Glutamate is the major excitatory amino acid in the mammalian brain, mediating an estimated 50% of all synaptic transmission in the central nervous system [reviewed in (52)]. Glutamate is synthesized, stored, released from the presynaptic terminal, and acts through both ligand-gated ion channels (ionotropic glutamate receptors; see the record for swagger) and G-protein coupled receptors (mGluRs) on postsynaptic neurons [reviewed in (53)]. Activation of these receptors accounts for basal excitatory synaptic transmission and synaptic plasticity, such as long-term potentiation (LTP) and long-term depression (LTD) that are thought to underlie learning and memory. Glutamatergic synaptic transmission is implicated in nearly all aspects of normal brain function, including learning, memory, movement, cognition, and development. However, at elevated concentrations that excessively stimulate the same receptors, glutamate acts as a neurotoxin capable of causing extensive neuronal damage and death in the development and progression of several neurological disorders. Thus, the brain maintains very low intrasynaptic concentrations of glutamate by the action of glutamate transporters present in the plasma membrane of both glial cells and neurons.

 

The mGluRs transduce signals through increased ion flux and second messenger signaling pathways. The mGluRs are subdivided into three groups, designated group I, II, and III, according to agonist selectivity, coupling to different effector systems, and sequence homology. Group I includes mGluR1 and mGluR5; group II includes mGluR2 and mGluR3; and group III consists of mGluR4, mGluR6, mGluR7, and mGluR8. Group I mGluRs function in inositol phospholipid metabolism leading to increased levels of intracellular calcium, the activation of ryanodine-sensitive calcium stores (54;55), and alteration in the activity of voltage-gated channels (56-58). Both group II and III are negatively coupled to adenylate cyclase activity, leading to reduced production of cyclic AMP (cAMP) and often resulting in reduced transmitter release (59).

 

mGluR1-associated signaling is essential for proper cerebellar function including the regulation of excitatory synaptic transmission, neuron excitability, synaptic plasticity, the induction of long-term potentiation (60-62), long-term depression of synaptic transmission in the hippocampus (63), and induction of long-term depression at the parallel fiber-Purkinje cell synapses in the cerebellum (64-67). mGluR1 also regulates the proliferation, differentiation, and survival of neural stem/progenitor cells [reviewed in (68)]. At the presynapse, mGluR1 regulates glutatamate release (69).

 

As a GPCR, mGluR1 couples with a heterotrimeric G protein to mediate its downstream effects. G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [reviewed in (70)Figure 4].  In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated.  Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit. GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. 

 

mGluR1 promotes phospholipase C (PLC; see the record for queen)/inositol-1,4,5-trisphosphate (IP3)/Ca2+ activation through the coupling to Gq/11 proteins upon ligand binding (Figure 5). Upon mGluR1 activation, PLC-mediated phosphatidylinositol-4,5-bisphosphate (PIP2) hydrolysis produces IP3 and diacylglycerol (DAG) (16;25;71). DAG is responsible for activating PKC and possibly the TRP calcium influx channels, while IP3 modulates calcium responses within the cell by binding to receptors on intracellular membranes to allow the mobilization of intracellular calcium (55). mGluR1-mediated changes in calcium levels can regulate neurotransmission, gene transcription, and apoptosis. mGluR1-stimulated release of intracellular calcium can also promote the activation of CaM, which acts as a second messenger to transduce calcium-related signals. Binding of calcium to CaM results in the activation of calcium/CaM-dependent kinases (CaMK) and the subsequent signaling regulates learning and memory as well as long-term potentiation (72). mGluR1-associated signaling also results in the PLC- and Ca2+/CaM-mediated phosphorylation of focal adhesion kinase (FAK) (73). FAK phosphorylation may mediate glutamate-associated effects on cytoskeleton dynamics. mGluR1-associated signaling results in induction of ERK1/2 phosphorylation independent of Ca2+ and phosphatidylinositol 3-kinase (PI3K) activity (74;75). In the spinal cord, mGluR1-mediated activation of ERK1/2 results in nociceptive sensitization, a feature of chronic pain (76;76). During inflammation in the spinal cord, mGluR1 is involved in functional plasticity through the activation of ERKs (76).

 

Homer1 binding to mGluR1 recruits Shank, a scaffold protein that facilitates an interaction between mGluR1 and NMDARs, subsequently leading to calcium influx (33). Homer1 also couples mGluR1 to PI3K to initiate signaling that will promote cell survival, metabolism, proliferation, and cancer progression (77). The PI3K-Akt-mTOR signaling pathway is activated in mGluR1-dependent long-term depression in the CA1 area of the hippocampus (78). mGluR1-mediated activation of Akt1/2 is both neuroprotective and pro-proliferative in some neuronal cell types (77;79;80); activation of mGluR1 can also be a pro-apoptotic signal in some neural subsets (81). As a pro-survival factor, Akt1 phosphorylates BAD (Bcl2-associated death protein), leading to dissociation of BAD from the Bcl-2/Bcl-XL complex (82). Akt1-mediated phosphorylation of proteins within the mTORC1 complex leads to increased mRNA translation that stimulates cell growth.

 

In CA3 pyramidal cells, mGluR1-induced excitatory postsynaptic currents is G protein-independent, requiring the activation of tyrosine kinases of the Src family (83). Src tyrosine kinases activate downstream messengers including ERK1/2 (83). G protein-independent signaling regulates long-term potentiation (83).

 

mGluR1a receptor activation can also mediate cyclic AMP (cAMP) accumulation (16;84;85); the mGluR1b, mGluR1c, and mGlu1d splice variants did not promote cAMP accumulation (17;26;86).

 

mGluRs have roles in epilepsy, neurotoxicity, and neurodegenerative diseases including Huntington’s Disease and Alzheimer’s disease (87;88). Mutations in GRM1 have been linked to autosomal recessive spinocerebellar ataxia (OMIM: #614831) (89;90). Patients with spinocerebellar ataxia exhibit developmental delay, stance and gait ataxia, dysarthria, dysmetria and tremors, and intellectual deficit.

 

mGluR1 has additional functions outside of the central nervous system. In the kidney, mGluR1 regulates podocyte foot process morphology and signaling in the podocyte. Grm1crv4/crv4 mice, harboring a spontaneous splicing mutation within intron 4, exhibit albuminuria, podocyte foot process effacement, and reduced levels of proteins that regulate the maintenance of podocyte cell structure including nephrin, podocin, and ZO-1 (28). mGluR1 expression is also required for melanoma development and growth (91). Conditional expression of mGluR1 in melanocytes resulted in the formation of pigmented lesions on the ears and tails 29 weeks after transgene activation (91).

Putative Mechanism

Grm1-deficient (Grm1-/-) and Grm1 mutant mice have normal anatomy of the hippocampus, excitatory synaptic transmission from parallel fibers to Purkinje cells and from climbing fibers to Purkinje cells, and short-term potentiation in the CA1 region of the hippocampus (92;93). However, the Grm1 mutant mice exhibit ataxia by postnatal day (P) 14, action tremors, loss or ability to right themselves, spatial learning deficits, impaired long-term depression, and reduced long-term potentiation (22;67;92-96). Similar to Grm1 mutant mice, donald mice exhibit ataxia, indicating loss of function in mGluR1donald.

Primers PCR Primer
donald(F):5'- TGCAGTTCTAGCTAAACATAAGGGCAG -3'
donald(R):5'- GGTCTCAGCTTTGTAAGACTTCCCATC -3'

Sequencing Primer
donald_seq(F):5'- GCTAAACATAAGGGCAGTCTTC -3'
donald_seq(R):5'- ACTTGTTCAAAGGGTACTACCTGG -3'
References
  52. Rousseaux, C. G. (2008) A Review of Glutamate Receptors I: Current Understanding of their Biology. J Toxicol Pathol. 21, 25-51.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna Jamie Russell Jeff SoRelle
List |< first << previous [record 70 of 132] next >> last >|