Phenotypic Mutation 'eatsy' (pdf version)
List |< first << previous [record 36 of 132] next >> last >|
Alleleeatsy
Mutation Type nonsense
Chromosome12
Coordinate84,382,295 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Entpd5
Gene Name ectonucleoside triphosphate diphosphohydrolase 5
Synonym(s) ER-UDPase, Cd39l4, NTPDase-5, Pcph, NTPDase5, mNTPase
Chromosomal Location 84,373,857-84,409,029 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to E-type nucleotidases (NTPases)/ecto-ATPase/apyrases. NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD5 contains 4 apyrase-conserved regions which is characteristic of NTPases. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele develop progressive hepatopathy, hepatocellular tumors, and spermatogenic arrest. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007647 (variant 1), NM_001026214 (variant 2), NM_001286049 (variant 3), NM_001286058 (variant 4); MGI:1321385

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021662] [ENSMUSP00000071939] [ENSMUSP00000105901] [ENSMUSP00000114011] [ENSMUSP00000112516] [ENSMUSP00000113106]
SMART Domains Protein: ENSMUSP00000021662
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000071939
Gene: ENSMUSG00000021236
AA Change: R346*

DomainStartEndE-ValueType
transmembrane domain 27 46 N/A INTRINSIC
Pfam:GDA1_CD39 65 451 1.9e-77 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000105901
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000114011
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000112516
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000113106
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
125-03 Response - increased
Body Weight - decreased 19176496
Body Weight (DSS) - decreased 19176496
Body Weight (Female) - decreased 19176496
DSS: sensitive day 10
DSS: sensitive day 7
FACS B1 cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS IgD MFI - decreased
growth/size
phagocytosis in PECs - decreased
TLR signaling defect: hypersensitivity to PAM3CSK4
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (other)(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Entpd5 APN 12 84387054 missense probably damaging 1.00
IGL01455:Entpd5 APN 12 84394677 missense probably benign 0.00
IGL02168:Entpd5 APN 12 84386978 critical splice donor site probably null
IGL02183:Entpd5 APN 12 84380380
IGL03104:Entpd5 APN 12 84384248 missense probably damaging 0.97
IGL03332:Entpd5 APN 12 84382228 splice site probably null
aventi UTSW 12 84382295 nonsense probably null
R0024:Entpd5 UTSW 12 84373733 missense probably benign 0.01
R0103:Entpd5 UTSW 12 84396943 nonsense probably null
R0103:Entpd5 UTSW 12 84396943 nonsense probably null
R0644:Entpd5 UTSW 12 84386141 missense probably benign 0.00
R1533:Entpd5 UTSW 12 84394660 missense probably damaging 1.00
R1536:Entpd5 UTSW 12 84382295 nonsense probably null
R1740:Entpd5 UTSW 12 84396771 missense probably benign 0.01
R1768:Entpd5 UTSW 12 84386211 missense probably benign
R2049:Entpd5 UTSW 12 84396858 missense probably benign 0.00
R5128:Entpd5 UTSW 12 84394690 missense probably benign 0.00
R6562:Entpd5 UTSW 12 84386200 missense probably damaging 1.00
R6907:Entpd5 UTSW 12 84377353 missense probably benign 0.23
X0057:Entpd5 UTSW 12 84384220 splice site probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
Repository
Last Updated 2018-09-24 9:21 AM by Anne Murray
Record Created 2014-12-09 2:41 PM by Jeff SoRelle
Record Posted 2016-10-28
Phenotypic Description

Figure 1. Eatsy mice exhibited reduced body weights compared to wild-type controls. Log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Eatsy mice exhibited susceptibility to DSS-induced colitis at 7 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Eatsy mice exhibited susceptibility to DSS-induced colitis at 10 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Eatsy mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The eatsy phenotype was identified among G3 mice of the pedigree R1536, some of which showed reduced body weights compared to wild-type control littermates (Figure 1). Some mice showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 2) and 10 (Figure 3) days post-DSS treatment. Some mice also showed increased frequencies of B1 cells in the peripheral blood (Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R1536. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. All of the above phenotypes were linked to a mutation in Entpd5: a C to T transition at base pair 84,382,295  (v38) on chromosome 12, corresponding to base pair 26,735 in the GenBank genomic region NC_000078 encoding Entpd5. The strongest association was found with a recessive model of inheritance (P = 6.479 x 10-5) to the body weight phenotype, wherein five variant homozygotes departed phenotypically from 15 homozygous reference mice and 18 heterozygous mice (Figure 5).

 

The mutation corresponds to residue 1,157 in the NM_007647 (variant 1) mRNA sequence in exon 11 of 14 total exons, residue 1,230 in the NM_001026214 (variant 2) mRNA sequence in exon 13 out of 16 total exons, residue 1,205 in the NM_001286049 (variant 3) mRNA sequence in exon 12 out of 15 total exons, and residue 1,132 in the NM_001286058 mRNA sequence in exon 11 out of 14 total exons. 


 

26720 CAGCCAGAAGAAGTCCGAGGAAGCGCCTTCTAC

341   -Q--P--E--E--V--R--G--S--A--F--Y- (isoform A; NP_031673)

316   -Q--P--E--E--V--R--G--S--A--F--Y- (isoform B; NP_001021385, NP_001272978, NP_001272987)

 

Genomic numbering corresponds to NC_000078. The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 346 to a premature stop codon (R346*) in isoform A of the ENTPD5 protein, and substitution of arginine 316 to a premature stop codon in isoform B of the ENTPD5 protein.

 

The causative mutation in Entpd5 was confirmed by CRISPR/Cas9-mediated targeting of Entpd5 (Table 1).

 

Table 1. CRISPR Screen Data

Screen Name P-value
DSS Day 7 2.036 x 10-12
DSS Day 10 7.607 x 10-10
Body weight 0.002524
FACS B1 cells 0.004333
Protein Prediction
Figure 6. Domain organization of the isoforms of ENTPD5. The location of the eatsy mutation is indicated in both isoforms. Abbreviations: SP, signal peptide; TM, transmembrane domain; ACR, apyrase conserved region.

Entpd5 encodes ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5; alternatively, ER-UDPase or CD39-like 4 [CD39L4]), a divalent cation-dependent glycoprotein. ENTPD5 is a member of the ecto-apyrase gene family of nucleoside triphosphatases (NTPases) that also consists of CD39, CD39-L1, CD39-L2, and CD39-L3. The ecto-apyrase family can be subdivided into two groups based on the structural domains of the proteins. CD39, CD39-L1, and CD39-L3 have one transmembrane domain at both the N- and C-termini, while CD39-L2 and ENTPD5 have hydrophobic portions at their N-termini indicating that they may be secreted (Figure 3) (1).

 

NTPases have four apyrase [nucleotide triphosphate diphosphohydrolase (NTPDase)]-conserved regions (ACRs) near the N-terminus. In mouse ENTPD5 isoform A, ACR I corresponds to amino acids 78-85, ACR II to amino acids 148-158, ACR III to amino acids 193-205, and ACR IV to amino acids 223-230 (2). In mouse ENTPD5 isoform B, ACR I corresponds to amino acids 53-60, ACR II to amino acids 123-133, ACR III to amino acids 168-179, and ACR IV to amino acids 198-205 (2). ACR I and ACR IV are important for nucleotide binding, and each contain a DXG motif that is involved in substrate recognition and binding. ENTPD5 also has one putative N-terminal transmembrane domain and a large extracellular C-terminal domain. ENTPD5 requires binding of divalent cations (Mg2+ or Ca2+) for its activity (3).

 

Entpd5 is alternatively spliced to generate four different mRNAs. One mRNA generates isoform A, while the other three mRNAs generate the same peptide, isoform B. Isoforms A and B differ at the N-terminus due to differences within the 5’ UTR; amino acids 1-25 of isoform A are unique from isoform B. Isoform B has a signal peptide at amino acids 1-24 that can be cleaved. Cleavage of the signal peptide facilitates release of a soluble form of the enzyme into the extracellular space.

 

The Entpd5 mutation in eatsy results in substitution of arginine 346 to a premature stop codon (R346*) in isoform A and substitution of arginine 316 to a premature stop codon (R316*) in isoform B of the ENTPD5 protein.

Expression/Localization

Entpd5 is ubiquitously expressed, and is highly expressed in the liver, kidney, prostate, testis, and colon (2). ENTPD5 localizes to the endoplasmic reticulum, and can also be secreted (1).

Background
Figure 7. ENTPD5 hydrolyzes UDP to UMP to promote protein N-glycosylation and folding in the endoplasmic reticulum. PI3K and PTEN lipid phosphatase control the level of cellular phosphatidylinositol (3,4,5)-trisphosphate, an activator of AKT kinases that promotes cell growth and survival. Activation of PI3K results in FOXO phosphorylation by AKT and loss of ENTPD5 transcriptional repression. This leads to increased ENTPD5 enzyme activity in the ER, promoting protein folding. ENTPD5, together with cytidine monophosphate kinase-1 and adenylate kinase-1, constitute an ATP hydrolysis cycle that converts ATP to AMP, resulting in a compensatory increase in aerobic glycolysis known as the Warburg effect. ENTPD5 activity promotes the import of UDP-glucose into the ER, where UGGT transfers glucose to an unfolded N-glycoprotein and produces UDP. Properly folded N-glycoproteins, such as growth factor receptors, exit the cycle, whereas unfolded proteins undergo further folding attempts or are degraded. Figure and legend adapted from Fang et al (2010) and Israelsen et al (2010).

The levels of extracellular and intraorganellar nucleotides are regulated by ENTPDs. NTPases hydrolyze extracellular nucleoside tri- and/or diphosphates. Tri-, di-, and monophosphates (NTPs, NDPs, and NMPs, respectively) have several functions in the cell. They are the building blocks of DNA and RNA, but also function as energy sources, in neurotransmission, cardiac function, platelet aggregation, muscle contraction and relaxation, vascular tone, secretion of hormones, immune responses, cell growth, protein folding, and cell signaling [reviewed in (4)]. Nucleotides regulate intracellular signaling mostly through G-protein–coupled P2 cell membrane receptors (P2Xn, P2Yn, and P2T) (5), which promote cell metabolism, adhesion, activation, development, proliferation, differentiation, and apoptosis (6). ATP and ADP are the main ligands of P2 receptors. Activation of P2X receptors results in Na+ and Ca2+ influx and K+ efflux across the cell membrane, which leads to depolarization of the plasma membrane and an increase in the concentration of intracellular Na+ and Ca2+. Membrane depolarization can in turn activate voltage-gated channels, causing firing of action potentials. P2Y receptors activate several secondary messenger transduction pathways including the activation of phospholipase C (PLC), inhibition and stimulation of adenylyl cyclase and direct modulation of ion channel function.

 

ENTPD5 putatively promotes protein glycosylation with UDP-sugars in rat hepatocytes. In the endoplasmic reticulum, proteins bind and are monoglycosylated by UDP-glucose:glycoprotein glucosyltransferase, subsequently promoting binding to ER chaperones calnexin or calreticulin and protein folding (Figure 7). The folded protein is released by hydrolysis of the bound glucose. Several rounds of glycosylation/deglycosylation may be necessary to fold complex proteins. Each round of glycosylation/deglycosylation generates a molecule of UDP. ENTPD5 hydrolyzes purine nucleoside diphosphates UDP and GDP to UMP and GMP, respectively. The UMP is transported from the ER lumen to the cytoplasm in exchange for nucleotide sugars, preventing end product inhibition and promoting reactant importation.

 

Phosphatidylinositol 3-kinases (PI3Ks) and the phosphatase PTEN balance cell growth and survival signals. Upon activation of receptor tyrosine kinases, PI3K phosphorylates phosphatidylinositol 4,5-bisphosphate (PIP2) to generate phosphatidylinositol 3,4,5-trisphosphate (PIP3) that recruits and activates serine/threonine kinase AKT. AKT activates many downstream cell growth and survival targets, including the rapamycin-sensitive mTOR complex 1 (mTORC1). PTEN dephosphorylates PIP3 back to PIP2, antagonizing the signal generated by PI3K. ENTPD5 is upregulated in cell lines and tumor samples with active AKT (7). ENTPD5 functions with cytidine monophosphate kinase-1 (CMPK1) and adenylate kinase 1 (AK1) to form an ATP hydrolysis cycle to convert ATP to AMP, leading to an increase in aerobic glycolysis (i.e., Warburg effect) (7).

 

ENTPD5 is identical to PCPH, a proto-oncogene that is dysregulated in some human cancers, including lung cancer (8), glioblastoma multiforme (9), prostate cancer (10;11). Overexpression of normal ENTPD5/PCPH proto-oncogene and the ENTPD5/mt-PCPH oncogene both promote malignant transformation  (12). mt-PCPH has a single base pair deletion in the open reading frame resulting in a frameshift and coding of a premature stop codon (12). The transforming effects are shared by PCPH and mt-PCPH, but the effects resulting from mt-PCPH are much greater compared to PCPH (12). In lung cancer, knockdown of ENTPD5 resulted in reduced lung cancer cell growth, increased apoptosis, and reduced invasion as well as increased caspase expression compared to normal tissue (8). Knockdown of Entpd5 in vitro resulted in induction of ER stress markers, BiP and CHOP as well as increased expression of the spliced form of Xbp1 (13).

 

Entpd5-deficient (Entpd5-/-) mice were born at the expected Mendelian ratio, and appeared normal at birth. However, the Entpd5-/- mice grew more slowly and displayed stunted growth at one year of age. In the serum, the Entpd5-/- mice had increased levels of alanine aminotransferase (ALT), alkaline phosphatase, and bilirubin with concomitant reduced levels of albumin, glucose, cholesterol, and triglycerides. Entpd5-/- mice exhibited hepatopathy characterized by hepatocyte degeneration by 14 to 22 weeks of age, degenerative lesions, hepatocellular neoplasia (i.e., hepatocellular carcinoma, hepatocellular adenoma, or both), centrilobular hepatocyte hypertorophy by 14 to 20 weeks of age, and oval cell proliferation by 45 to 62 weeks of age. Male Entpd5-/- mice also exhibited a failure to produce semen (4). The increased hepatocellular turnover in the Entpd5-/- mice is proposed to be due to loss of NDP degradation in the ER or in the extracellular space. In addition loss of ENTPD5 in the ER could lead to inhibition of UDP inhibition-mediated protein glycosylation. In addition, the increased rate of hepatocyte turnover may be due to loss of extracellular nucleotide signaling.

Putative Mechanism

The reduced body size/weight of the eatsy mice mimics that of Entpd5-/- mice, indicating that ENTPD5eatsy exhibits loss of function.

Primers PCR Primer
eatsy(F):5'- TCTACTGGGAAAGAACTGGGAAGCC -3'
eatsy(R):5'- TCAGATTGCCCTGCTGTTTCAGAG -3'

Sequencing Primer
eatsy_seq(F):5'- TGGGAAGCCACTGCAAC -3'
eatsy_seq(R):5'- ACTGCTGCTCAGAGGCTAAG -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsZhe Chen, Jeff SoRelle, William McAlpine, Jianhui Wang, and Bruce Beutler
List |< first << previous [record 36 of 132] next >> last >|