Phenotypic Mutation 'eatsy'

• Allele: eatsy
• Mutation Type: nonsense
• Chromosome: 12
• Coordinate: 84,429,069 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Entpd5
• Gene Name: ectonucleoside triphosphate diphosphohydrolase 5
• Synonym(s): Pcph, NTPDase-5, mNTPase, ER-UDPase, NTPDase5, Cd39l4
• Chromosomal Location: 84,420,649-84,455,803 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to E-type nucleotidases (NTPases)/ecto-ATPase/apyrases. NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD5 contains 4 apyrase-conserved regions which is characteristic of NTPases. [provided by RefSeq, Jan 2009] ; PHENOTYPE: Mice homozygous for a null allele develop progressive hepatopathy, hepatocellular tumors, and spermatogenic arrest. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000021662] [ENSMUSP00000071939] [ENSMUSP00000105901] [ENSMUSP00000114011] [ENSMUSP00000112516] [ENSMUSP00000113106]
• AlphaFold: Q9WUZ9
• SMART Domains: Protein: ENSMUSP00000021662; Gene: ENSMUSG00000021236; AA Change: R321*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:GDA1_CD39	41	426	3.5e-76	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000071939; Gene: ENSMUSG00000021236; AA Change: R346*

Domain	Start	End	E-Value	Type
transmembrane domain	27	46	N/A	INTRINSIC
Pfam:GDA1_CD39	65	451	1.9e-77	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000105901; Gene: ENSMUSG00000021236; AA Change: R321*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:GDA1_CD39	41	426	3.5e-76	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000114011; Gene: ENSMUSG00000021236; AA Change: R321*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:GDA1_CD39	41	426	3.5e-76	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000112516; Gene: ENSMUSG00000021236; AA Change: R321*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:GDA1_CD39	41	426	3.5e-76	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000113106; Gene: ENSMUSG00000021236; AA Change: R321*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:GDA1_CD39	41	426	3.5e-76	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• Last Updated: 2022-04-12 3:40 PM by External Program
• Record Created: 2014-12-09 2:41 PM by Jeff SoRelle
• Record Posted: 2016-10-28
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Zhe Chen, Jeff SoRelle, William McAlpine, Jianhui Wang, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007647 (variant 1), NM_001026214 (variant 2), NM_001286049 (variant 3), NM_001286058 (variant 4); MGI:1321385

Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (other)(1) Targeted(5)

Phenotypic Description

Figure 1. Eatsy mice exhibited reduced body weights compared to wild-type controls. Log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Eatsy mice exhibited susceptibility to DSS-induced colitis at 7 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Eatsy mice exhibited susceptibility to DSS-induced colitis at 10 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Eatsy mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The eatsy phenotype was identified among G3 mice of the pedigree R1536, some of which showed reduced body weights compared to wild-type control littermates (Figure 1). Some mice showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 2) and 10 (Figure 3) days post-DSS treatment. Some mice also showed increased frequencies of B1 cells in the peripheral blood (Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R1536. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. All of the above phenotypes were linked to a mutation in Entpd5: a C to T transition at base pair 84,382,295  (v38) on chromosome 12, corresponding to base pair 26,735 in the GenBank genomic region NC_000078 encoding Entpd5. The strongest association was found with a recessive model of inheritance (P = 6.479 x 10^-5) to the body weight phenotype, wherein five variant homozygotes departed phenotypically from 15 homozygous reference mice and 18 heterozygous mice (Figure 5).

The mutation corresponds to residue 1,157 in the NM_007647 (variant 1) mRNA sequence in exon 11 of 14 total exons, residue 1,230 in the NM_001026214 (variant 2) mRNA sequence in exon 13 out of 16 total exons, residue 1,205 in the NM_001286049 (variant 3) mRNA sequence in exon 12 out of 15 total exons, and residue 1,132 in the NM_001286058 mRNA sequence in exon 11 out of 14 total exons. 

26720 CAGCCAGAAGAAGTCCGAGGAAGCGCCTTCTAC 341   -Q--P--E--E--V--R--G--S--A--F--Y- (isoform A; NP_031673) 316   -Q--P--E--E--V--R--G--S--A--F--Y- (isoform B; NP_001021385, NP_001272978, NP_001272987)

Genomic numbering corresponds to NC_000078. The mutated nucleotide is indicated in red. The mutation results in substitution of arginine 346 to a premature stop codon (R346*) in isoform A of the ENTPD5 protein, and substitution of arginine 316 to a premature stop codon in isoform B of the ENTPD5 protein.

The causative mutation in Entpd5 was confirmed by CRISPR/Cas9-mediated targeting of Entpd5 (Table 1).

Table 1. CRISPR Screen Data

Screen Name	P-value
DSS Day 7	2.036 x 10-12
DSS Day 10	7.607 x 10-10
Body weight	0.002524
FACS B1 cells	0.004333

Protein Prediction

Figure 6. Domain organization of the isoforms of ENTPD5. The location of the eatsy mutation is indicated in both isoforms. Abbreviations: SP, signal peptide; TM, transmembrane domain; ACR, apyrase conserved region.

Entpd5 encodes ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5; alternatively, ER-UDPase or CD39-like 4 [CD39L4]), a divalent cation-dependent glycoprotein. ENTPD5 is a member of the ecto-apyrase gene family of nucleoside triphosphatases (NTPases) that also consists of CD39, CD39-L1, CD39-L2, and CD39-L3. The ecto-apyrase family can be subdivided into two groups based on the structural domains of the proteins. CD39, CD39-L1, and CD39-L3 have one transmembrane domain at both the N- and C-termini, while CD39-L2 and ENTPD5 have hydrophobic portions at their N-termini indicating that they may be secreted (Figure 3) (1).

NTPases have four apyrase [nucleotide triphosphate diphosphohydrolase (NTPDase)]-conserved regions (ACRs) near the N-terminus. In mouse ENTPD5 isoform A, ACR I corresponds to amino acids 78-85, ACR II to amino acids 148-158, ACR III to amino acids 193-205, and ACR IV to amino acids 223-230 (2). In mouse ENTPD5 isoform B, ACR I corresponds to amino acids 53-60, ACR II to amino acids 123-133, ACR III to amino acids 168-179, and ACR IV to amino acids 198-205 (2). ACR I and ACR IV are important for nucleotide binding, and each contain a DXG motif that is involved in substrate recognition and binding. ENTPD5 also has one putative N-terminal transmembrane domain and a large extracellular C-terminal domain. ENTPD5 requires binding of divalent cations (Mg²⁺ or Ca²⁺) for its activity (3).

Entpd5 is alternatively spliced to generate four different mRNAs. One mRNA generates isoform A, while the other three mRNAs generate the same peptide, isoform B. Isoforms A and B differ at the N-terminus due to differences within the 5’ UTR; amino acids 1-25 of isoform A are unique from isoform B. Isoform B has a signal peptide at amino acids 1-24 that can be cleaved. Cleavage of the signal peptide facilitates release of a soluble form of the enzyme into the extracellular space.

The Entpd5 mutation in eatsy results in substitution of arginine 346 to a premature stop codon (R346*) in isoform A and substitution of arginine 316 to a premature stop codon (R316*) in isoform B of the ENTPD5 protein.

Expression/Localization

Entpd5 is ubiquitously expressed, and is highly expressed in the liver, kidney, prostate, testis, and colon (2). ENTPD5 localizes to the endoplasmic reticulum, and can also be secreted (1).

Background

Figure 7. ENTPD5 hydrolyzes UDP to UMP to promote protein N-glycosylation and folding in the endoplasmic reticulum. PI3K and PTEN lipid phosphatase control the level of cellular phosphatidylinositol (3,4,5)-trisphosphate, an activator of AKT kinases that promotes cell growth and survival. Activation of PI3K results in FOXO phosphorylation by AKT and loss of ENTPD5 transcriptional repression. This leads to increased ENTPD5 enzyme activity in the ER, promoting protein folding. ENTPD5, together with cytidine monophosphate kinase-1 and adenylate kinase-1, constitute an ATP hydrolysis cycle that converts ATP to AMP, resulting in a compensatory increase in aerobic glycolysis known as the Warburg effect. ENTPD5 activity promotes the import of UDP-glucose into the ER, where UGGT transfers glucose to an unfolded N-glycoprotein and produces UDP. Properly folded N-glycoproteins, such as growth factor receptors, exit the cycle, whereas unfolded proteins undergo further folding attempts or are degraded. Figure and legend adapted from Fang et al (2010) and Israelsen et al (2010) .

The levels of extracellular and intraorganellar nucleotides are regulated by ENTPDs. NTPases hydrolyze extracellular nucleoside tri- and/or diphosphates. Tri-, di-, and monophosphates (NTPs, NDPs, and NMPs, respectively) have several functions in the cell. They are the building blocks of DNA and RNA, but also function as energy sources, in neurotransmission, cardiac function, platelet aggregation, muscle contraction and relaxation, vascular tone, secretion of hormones, immune responses, cell growth, protein folding, and cell signaling [reviewed in (4)]. Nucleotides regulate intracellular signaling mostly through G-protein–coupled P2 cell membrane receptors (P2X_n, P2Y_n, and P2T) (5), which promote cell metabolism, adhesion, activation, development, proliferation, differentiation, and apoptosis (6). ATP and ADP are the main ligands of P2 receptors. Activation of P2X receptors results in Na⁺ and Ca²⁺ influx and K⁺ efflux across the cell membrane, which leads to depolarization of the plasma membrane and an increase in the concentration of intracellular Na⁺ and Ca²⁺. Membrane depolarization can in turn activate voltage-gated channels, causing firing of action potentials. P2Y receptors activate several secondary messenger transduction pathways including the activation of phospholipase C (PLC), inhibition and stimulation of adenylyl cyclase and direct modulation of ion channel function.

ENTPD5 putatively promotes protein glycosylation with UDP-sugars in rat hepatocytes. In the endoplasmic reticulum, proteins bind and are monoglycosylated by UDP-glucose:glycoprotein glucosyltransferase, subsequently promoting binding to ER chaperones calnexin or calreticulin and protein folding (Figure 7). The folded protein is released by hydrolysis of the bound glucose. Several rounds of glycosylation/deglycosylation may be necessary to fold complex proteins. Each round of glycosylation/deglycosylation generates a molecule of UDP. ENTPD5 hydrolyzes purine nucleoside diphosphates UDP and GDP to UMP and GMP, respectively. The UMP is transported from the ER lumen to the cytoplasm in exchange for nucleotide sugars, preventing end product inhibition and promoting reactant importation.

Phosphatidylinositol 3-kinases (PI3Ks) and the phosphatase PTEN balance cell growth and survival signals. Upon activation of receptor tyrosine kinases, PI3K phosphorylates phosphatidylinositol 4,5-bisphosphate (PIP2) to generate phosphatidylinositol 3,4,5-trisphosphate (PIP3) that recruits and activates serine/threonine kinase AKT. AKT activates many downstream cell growth and survival targets, including the rapamycin-sensitive mTOR complex 1 (mTORC1). PTEN dephosphorylates PIP3 back to PIP2, antagonizing the signal generated by PI3K. ENTPD5 is upregulated in cell lines and tumor samples with active AKT (7). ENTPD5 functions with cytidine monophosphate kinase-1 (CMPK1) and adenylate kinase 1 (AK1) to form an ATP hydrolysis cycle to convert ATP to AMP, leading to an increase in aerobic glycolysis (i.e., Warburg effect) (7).

ENTPD5 is identical to PCPH, a proto-oncogene that is dysregulated in some human cancers, including lung cancer (8), glioblastoma multiforme (9), prostate cancer (10;11). Overexpression of normal ENTPD5/PCPH proto-oncogene and the ENTPD5/mt-PCPH oncogene both promote malignant transformation  (12). mt-PCPH has a single base pair deletion in the open reading frame resulting in a frameshift and coding of a premature stop codon (12). The transforming effects are shared by PCPH and mt-PCPH, but the effects resulting from mt-PCPH are much greater compared to PCPH (12). In lung cancer, knockdown of ENTPD5 resulted in reduced lung cancer cell growth, increased apoptosis, and reduced invasion as well as increased caspase expression compared to normal tissue (8). Knockdown of Entpd5 in vitro resulted in induction of ER stress markers, BiP and CHOP as well as increased expression of the spliced form of Xbp1 (13).

Entpd5-deficient (Entpd5^-/-) mice were born at the expected Mendelian ratio, and appeared normal at birth. However, the Entpd5^-/- mice grew more slowly and displayed stunted growth at one year of age. In the serum, the Entpd5^-/- mice had increased levels of alanine aminotransferase (ALT), alkaline phosphatase, and bilirubin with concomitant reduced levels of albumin, glucose, cholesterol, and triglycerides. Entpd5^-/- mice exhibited hepatopathy characterized by hepatocyte degeneration by 14 to 22 weeks of age, degenerative lesions, hepatocellular neoplasia (i.e., hepatocellular carcinoma, hepatocellular adenoma, or both), centrilobular hepatocyte hypertorophy by 14 to 20 weeks of age, and oval cell proliferation by 45 to 62 weeks of age. Male Entpd5^-/- mice also exhibited a failure to produce semen (4). The increased hepatocellular turnover in the Entpd5^-/- mice is proposed to be due to loss of NDP degradation in the ER or in the extracellular space. In addition loss of ENTPD5 in the ER could lead to inhibition of UDP inhibition-mediated protein glycosylation. In addition, the increased rate of hepatocyte turnover may be due to loss of extracellular nucleotide signaling.

Putative Mechanism

The reduced body size/weight of the eatsy mice mimics that of Entpd5^-/- mice, indicating that ENTPD5^eatsy exhibits loss of function.

Primers

PCR Primer
eatsy_pcr_F: TCTACTGGGAAAGAACTGGGAAGCC
eatsy_pcr_R: TCAGATTGCCCTGCTGTTTCAGAG

Sequencing Primer
eatsy_seq_F: TGGGAAGCCACTGCAAC
eatsy_seq_R: ACTGCTGCTCAGAGGCTAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 461 nucleotides is amplified (chromosome 12, - strand):

1   tcagattgcc ctgctgtttc agagctccgc ccccaccttg ctgtgagggt acctcagcca
61  tagctaaccc gctcccacca ctgctgctca gaggctaaga gtcagcctcc ttgctttctc
121 gatcttctct ctgtggctcc agcagcttgc cgctgagagt gattgttgcc ccatccttag
181 tctcatgtga tgtatactct tgccctgaca ggggagatgg gctttgaacc ctgctatgcg
241 gaagtgctga gggtagtaca ggggaaactt caccagccag aagaagtccg aggaagcgcc
301 ttctacgctt tctcttacta ctacgatcga gccgctgaca cacacttgat cggtgagttc
361 atgcctacgg tcagccatgg aggaagagaa cgggactaag ctcaggaaga gaaggaaagg
421 ctgtgttggt tgcagtggct tcccagttct ttcccagtag a

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Mulero, J. J., Yeung, G., Nelken, S. T., and Ford, J. E. (1999) CD39-L4 is a Secreted Human Apyrase, Specific for the Hydrolysis of Nucleoside Diphosphates. J Biol Chem. 274, 20064-20067.

  2. Chadwick, B. P., and Frischauf, A. M. (1998) The CD39-Like Gene Family: Identification of Three New Human Members (CD39L2, CD39L3, and CD39L4), their Murine Homologues, and a Member of the Gene Family from Drosophila Melanogaster. Genomics. 50, 357-367.

  3. Murphy-Piedmonte, D. M., Crawford, P. A., and Kirley, T. L. (2005) Bacterial Expression, Folding, Purification and Characterization of Soluble NTPDase5 (CD39L4) Ecto-Nucleotidase. Biochim Biophys Acta. 1747, 251-259.

  4. Read, R., Hansen, G., Kramer, J., Finch, R., Li, L., and Vogel, P. (2009) Ectonucleoside Triphosphate Diphosphohydrolase Type 5 (Entpd5)-Deficient Mice Develop Progressive Hepatopathy, Hepatocellular Tumors, and Spermatogenic Arrest. Vet Pathol. 46, 491-504.

  5. Di Virgilio, F., Chiozzi, P., Ferrari, D., Falzoni, S., Sanz, J. M., Morelli, A., Torboli, M., Bolognesi, G., and Baricordi, O. R. (2001) Nucleotide Receptors: An Emerging Family of Regulatory Molecules in Blood Cells. Blood. 97, 587-600.

  6. Robson, S. C., Sevigny, J., and Zimmermann, H. (2006) The E-NTPDase Family of Ectonucleotidases: Structure Function Relationships and Pathophysiological Significance. Purinergic Signal. 2, 409-430.

  7. Fang, M., Shen, Z., Huang, S., Zhao, L., Chen, S., Mak, T. W., and Wang, X. (2010) The ER UDPase ENTPD5 Promotes Protein N-Glycosylation, the Warburg Effect, and Proliferation in the PTEN Pathway. Cell. 143, 711-724.

  8. Xue, Y., Wu, L., Liu, Y., Ma, Y., Zhang, L., Ma, X., Yang, Y., and Chen, J. (2015) ENTPD5 Induces Apoptosis in Lung Cancer Cells Via Regulating Caspase 3 Expression. PLoS One. 10, e0120046.

  9. Zadran, S., Amighi, A., Otiniano, E., Wong, K., and Zadran, H. (2012) ENTPD5-Mediated Modulation of ATP Results in Altered Metabolism and Decreased Survival in Gliomablastoma Multiforme. Tumour Biol. 33, 2411-2421.

  10. Villar, J., Arenas, M. I., MacCarthy, C. M., Blanquez, M. J., Tirado, O. M., and Notario, V. (2007) PCPH/ENTPD5 Expression Enhances the Invasiveness of Human Prostate Cancer Cells by a Protein Kinase C Delta-Dependent Mechanism. Cancer Res. 67, 10859-10868.

  11. Villar, J., Quadri, H. S., Song, I., Tomita, Y., Tirado, O. M., and Notario, V. (2009) PCPH/ENTPD5 Expression Confers to Prostate Cancer Cells Resistance Against Cisplatin-Induced Apoptosis through Protein Kinase Calpha-Mediated Bcl-2 Stabilization. Cancer Res. 69, 102-110.

  12. MacCarthy, C. M., and Notario, V. (2013) The ENTPD5/mt-PCPH Oncoprotein is a Catalytically Inactive Member of the Ectonucleoside Triphosphate Diphosphohydrolase Family. Int J Oncol. 43, 1244-1252.

  13. Shen, Z., Huang, S., Fang, M., and Wang, X. (2011) ENTPD5, an Endoplasmic Reticulum UDPase, Alleviates ER Stress Induced by Protein Overloading in AKT-Activated Cancer Cells. Cold Spring Harb Symp Quant Biol. 76, 217-223.