Phenotypic Mutation 'sisal' (pdf version)
List |< first << previous [record 46 of 74] next >> last >|
Allelesisal
Mutation Type critical splice donor site (1 bp from exon)
Chromosome16
Coordinate10,513,288 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Ciita
Gene Name class II transactivator
Synonym(s) C2ta, Gm9475
Chromosomal Location 10,480,059-10,528,418 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the NOD-like receptor protein family. This protein acts as a transcriptional coactivator and component of the enhanceosome complex to stimulate transcription of MHC class II genes in the adaptive immune response. This protein may also regulate the transcription of MHC class I genes. Mutations in the human gene have been linked to a rare immunodeficiency, bare lymphocyte syndrome, and homozygous knockout mice exhibit many features of this disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are immunologically abnormal with extremely little MHC class II expression, greatly reduced serum IgG, and impaired T-dependent antigen responses. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001243760, NM_007575, NM_001243761, NM_001302618, NM_001302619; MGI:108445

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000023147] [ENSMUSP00000139108] [ENSMUSP00000154946] [ENSMUSP00000155517] [ENSMUSP00000155002]
SMART Domains Protein: ENSMUSP00000023147
Gene: ENSMUSG00000022504

DomainStartEndE-ValueType
low complexity region 216 230 N/A INTRINSIC
Pfam:NACHT 362 533 1.8e-44 PFAM
low complexity region 847 861 N/A INTRINSIC
LRR 931 961 8.53e0 SMART
LRR 962 989 7.37e-4 SMART
LRR 991 1018 1.25e-6 SMART
LRR 1019 1046 2.36e-2 SMART
Predicted Effect probably null
Predicted Effect probably null
Predicted Effect probably null
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4+ T cells - decreased 10452977 8624807
FACS CD4+ T cells in CD3+ T cells - decreased 10452977 8624807
FACS CD44+ CD4 MFI - increased
FACS CD8+ T cells in CD3+ T cells - increased 10452977 9164958
FACS naive CD4 T cells in CD4 T cells - decreased
post-MCMV FACS CD4:CD8 - decreased
post-MCMV FACS CD8+ T cells in CD3+ T cells - increased 10452977 9164958
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
TLR signaling defect: hypersensitivity to R848
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All mutations/alleles(9) : Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Ciita APN 16 10510727 missense probably damaging 0.99
IGL01830:Ciita APN 16 10521051 missense probably damaging 1.00
IGL02557:Ciita APN 16 10512015 missense probably damaging 1.00
IGL02634:Ciita APN 16 10508713 missense probably damaging 1.00
IGL03057:Ciita APN 16 10520959 splice site probably benign
IGL03403:Ciita APN 16 10503872 missense probably damaging 1.00
R0001:Ciita UTSW 16 10514433 splice site probably benign
R0138:Ciita UTSW 16 10512270 missense probably damaging 1.00
R0583:Ciita UTSW 16 10523804 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R2017:Ciita UTSW 16 10511676 missense probably damaging 1.00
R2072:Ciita UTSW 16 10518353 missense probably benign 0.16
R2410:Ciita UTSW 16 10510704 missense probably damaging 0.99
R4779:Ciita UTSW 16 10511366 missense probably damaging 1.00
R5151:Ciita UTSW 16 10523730 missense probably damaging 1.00
R5233:Ciita UTSW 16 10509401 missense possibly damaging 0.95
R5363:Ciita UTSW 16 10512167 missense probably damaging 1.00
R5431:Ciita UTSW 16 10523792 missense probably damaging 1.00
R5821:Ciita UTSW 16 10511805 missense possibly damaging 0.77
R6085:Ciita UTSW 16 10512165 missense probably benign 0.08
R6088:Ciita UTSW 16 10511931 missense probably damaging 1.00
R6241:Ciita UTSW 16 10511903 missense probably damaging 1.00
R6354:Ciita UTSW 16 10523746 missense probably damaging 1.00
R6502:Ciita UTSW 16 10511910 missense probably damaging 1.00
R6553:Ciita UTSW 16 10511745 missense probably benign 0.00
R6585:Ciita UTSW 16 10511745 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038195-MU
Last Updated 2017-05-12 11:29 AM by Anne Murray
Record Created 2014-12-12 7:18 PM by Jin Huk Choi
Record Posted 2015-05-15
Phenotypic Description

Figure 1. Sisal mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sisal mice exhibit decreased frequencies of peripheral naïve CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine naïve CD4+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Sisal mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Sisal mice exhibit increased CD44+ CD4+ mean fluorescence intensity (MFI). Flow cytometric analysis of peripheral blood was utilized to determine CD44+ CD4+ MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Sisal mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Homozygous sisal mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Homozygous sisal mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The sisal phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1468, some of which showed reduced frequencies of CD4+ T cells (Figure 1) including naïve CD4+ T cells in CD4+ T cells (Figure 2) and CD4+ T cells in CD3+ T cells (Figure 3) as well as increased CD44+ CD4+ mean fluorescence intensity (MFI; Figure 4) and increased frequencies CD8+ T cells in CD3+ T cells (Figure 5), all in the peripheral blood. Some mice also exhibited diminished T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 6) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 7).

Nature of Mutation

Figure 8. Linkage mapping of the diminished T-dependent antibody response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 113 mutations (X-axis) identified in the G1 male of pedigree R1468. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 113 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ciita: a G to A transition at base pair 10,513,288 (v38) on chromosome 16, or base pair 33,274 in the GenBank genomic region NC_000082 within the donor splice site of intron 11. The strongest association was found with a recessive model of linkage to the normalized T-dependent antibody response to rSFV-β-gal, wherein 4 variant homozygotes departed phenotypically from 4 homozygous reference mice and 11 heterozygous mice with a P value of 1.339 x 10-7 (Figure 8). A substantial semidominant effect was observed in some of the assays, but the mutation is preponderantly recessive. The effect of the mutation at the cDNA and protein level has not examined, but the mutation is predicted to result in an in-frame skipping of the 159-nucleotide exon 11 (out of 19 total exons).

 

            <--exon 10      <--exon 11 intron 11-->      exon 12-->           <--exon 19

32327 ……GTCACCAGTTTCAG……GTGCAGACCCAGAG gtgaggaggcaagggg…… GCTGAGAAACCCC……ATCAGTCTGAGATGA
830   ……-V--T--S--F--R……-V--Q--T--Q--R                    --L--R--N--P-……-I--S--L--R--*-

            correct         deleted                                 correct

 

Genomic numbering corresponds to NC_000082. The donor splice site of intron 11, which is destroyed by the sisal mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 9. Domain structure of CIITA. The sisal mutation within the donor splice site of intron 11 is indicated. Abbreviations: AD, activation domain; ATD, acetyltransferase domain; PST, proline-serine-threonine domain; GBD, GTP-binding domain; LRR, leucine rich repeat.

Ciita encodes major histocompatibility complex class II (MHCII) transactivator (CIITA), a member of the NACHT-leucine-rich repeat (NACHT-LRR; alternatively CATERPILLER) family [Figure 9; reviewed in (1)]. CIITA has an N-terminal acidic activation domain (AD; amino acids 26-137), an acetyltransferase domain (ATD; amino acids 94-132), a proline-serine-threonine (PST) region (amino acids 163-322), a central GTP-binding domain (GBD; amino acids 445-452) within a NACHT domain (amino acids 362-533), and a C-terminal LRR region (amino acids 931-1046) (2).

 

Activation domains are common to transcription factors (e.g., TFIID and TFIIH) and mediate interactions with the basal transcriptional machinery (3-5). The AD of CIITA mediates binding of CIITA to general transcription factors (e.g., RFX-ANK and NF-YC) and CREB-binding protein (CBP) (6-8). The AD and the ATD domain partially overlap (9). The acetyltransferase activity of CIITA is mediated by the ATD and is required for CIITA-mediated transactivation (9), but the transactivator function of CIITA also requires the PST, GBD, and LRR domains. PST regions are often found in transcription factors with either AD or DNA-binding properties (10;11). The function of the PST domain in CIITA is unknown (12). The PST region of CIITA has two proteolytic signal sites (amino acids 132-301), termed degrons, that targets CIITA for proteasome-mediated degradation by functioning as an E3 ubiquitin ligase recognition site (13;14). Within the PST domain and overlapping the degron site, CIITA has an ATPase-binding domain (amino acids 132-301) that can bind the P19 ATPase Sug1 (15) and the 19S ATPase S6a (16). The 19S ATPase Sug1 is essential for MHCII expression as well as the recruitment and stabilization of CIITA at the MHCII promoter (17). The 19S ATPase S6a regulates the transcription of Ciita by regulating histone modification at the pIV promoter (16). Loss of the ATPase-binding domain results in an increased CIITA half-life, but decreases MHCII surface expression (15). The NACHT domain consists of a phosphate- (GXXXXGKS), a magnesium- (DXXG), and a guanine- (SKXD) binding motif essential for CIITA activity (12). The NACHT corresponds to the site of interaction of several DNA binding transactivators (6). The NACHT domain regulates shuttling of CIITA between the nucleus and cytoplasm (18;19). Mutation or deletion of the NACHT domain results in an increased rate of nuclear export of CIITA (19). No GTPase activity has been associated with the GBD within the NACHT (18). The LRR region has four LRRs and associates with the NACHT domain to mediate CIITA self-association, nuclear import and export of CIITA, transcriptosome formation, and MHCII transcription (20-24;24). A complex comprised of both Zinc finger X-linked duplicated family member C (ZXDC) and ZXDA interacts with CIITA through the LRR region to mediate MHCII gene transcription (25;26)

 

CIITA has three nuclear localization sequences required for the nuclear translocation of CIITA and for its activity (27). Two are near the N-terminus (amino acids 144-161) and one is at the C-terminus (19). The transactivation, nuclear localization, oligomerization, and DNA-binding transactivators interaction activities of CIITA are regulated by several posttranslational modifications including phosphorylation, ubiquitination, acetylation, and deacetylation (28). CIITA exhibits intrinsic kinase activity and is able to both auto- and trans-phosphorylate (29). CIITA can be phosphorylated by PKA, PKC, GSK3, CK1, ERK1/2, and CKII at various sites throughout the AT, PST, and LRR domains (28). CIITA has two kinase domains: one between amino acids 1-428, which contains sites of autophosphorylation, and another between amino acids 700-1130 (29).

 

The sisal mutation is predicted to result in deletion of exon 11, which encodes amino acids 836-888 which precedes the LRR region.

Expression/Localization

CIITA is constitutively expressed in antigen presenting cells (APCs; i.e., mature and immature dendritic cells, B cells, and macrophages). CIITA is expressed in CD4+ T cells under T helper 1 (Th1), but not Th2 conditions (30;31). CIITA is also expressed in thymic epithelial cells (TECs), skin, heart, skeletal muscle, kidney, salivary gland, and liver (32). Interferon (IFN)-γ induces Ciita expression in several cell types including astrocytes, fibroblasts, and aortic smooth muscle cells (33-37). TGF-β, IL-1, IL-4 and IL-10 suppress CIITA expression (38-41). CIITA is localized to both the cytoplasm and nuclei (42). IFN-γ increases the translocation of CIITA into the nucleus.

 

Ciita expression is regulated by the use of four promoters (pI, pII, pIII, and pIV) that each precede alternative first exons spliced to shared downstream exons [(43;44); reviewed in (6). The pI, pIII, and pIV promoters are highly conserved between the mouse and human genes and generate a 132 kDa, 124 kDa, and a 121 kDa isoform, respectively. The pII-associated isoform is expressed at low levels in humans and is absent in mice (44). The promoters regulate Ciita expression in a cell type-specific manner (44;45). For example, the pI promoter is utilized in myeloid cells (i.e., conventional dendritic cells and macrophages), while the pIII promoter is utilized in lymphoid cells (i.e., B cells, T cells, and plasmacytoid dendritic cells) (38;44;46-49). Abnormal constitutive expression of MHCII proteins in some melanoma cells is due to constitutive activation of the pIII promoter (50). The pIV promoter is essential for Ciita expression in cortical TECs (cTECs) and medullary TECs (mTECs) (51). Ciita-pIV is induced by interferon (IFN)-γ in most cell types including non-bone marrow-derived cells including fibroblasts and astrocytes (38;44). Both Ciita-I and Ciita-IV transcripts are induced by IFN-γ in macrophages at early time points (44;46;52;53). At later time points, Ciita-IV expression diminishes, and Ciita-I remains elevated (38;52). IFN-γ induces Janus kinas 1 (JAK1) and JAK2/STAT1 activation and STAT1-mediated binding to the IFN-γ activation sequence (GAS) element in pIV (54). STAT1 regulates IRF-1 expression, which then activates the CIITA promoter (55;56). PKCδ is also essential for maximum IFN-γ inducible CIITA gene expression in macrophages and to maintain CIITA expression in B cells by promoting the recruitment of STAT1 and histone acetyltransferases to the Ciita promoter (57;58). PKCα also regulates IFN-γ inducible expression of the CIITA gene (38;59).

Background
Figure 10. CIITA functions as a transcriptional coactivator of MHCII transcription. A MHC-II promoter is represented schematically with the W, X, X2, and Y sequences indicated. RFX, X2BP, and NF-Y bind to these sequences and assemble into a stable higher order nucleoprotein complex. CIITA is tethered to the enhanceosome via multiple protein–protein interactions with the W, X, X2, and Y-binding factors. The octamer site found in the MHC-II promoter (OCT) is not required for recruitment of CIITA. CIITA is proposed to activate transcription (arrow) via its amino-terminal activation domains (AD), which contact the RNA polymerase II basal transcription machinery. See the text for more details.

MHCII proteins induce and regulate adaptive immune responses as well as maintain self-tolerance.  MHCII proteins are displayed at the surface of antigen presenting cells (i.e., dendritic cells, B cells, and cells of the monocyte/macrophage lineage) where they present peptides to the T cell receptor (TCR) on CD4+ T cells, subsequently triggering the maturation, activation, and proliferation of the T cells. MHCII+ cTECs mediate positive selection, which promotes the survival of T cells that have a TCR that can recognize self-MHC molecules [reviewed in (60)]. In addition, MHCII+ thymic dendritic cells and/or mTECs regulate the elimination of autoreactive T cells by negative selection [reviewed in (60)]. CIITA is a coactivator that regulates the transcription of all MHCII genes including the classical MHCII proteins human leukocyte antigen (HLA)-DR, HLA-DP, and HLA-DQ as well as MHCII accessory proteins HLA-DM, HLA-DO, and the invariant chain (Ii) [Figure 10; (61-63); reviewed in (1;64)]. Each of the promoters of the CIITA-regulated genes contain W/S, X, X2, and Y boxes, which are conserved regulatory elements that bind DNA-binding transcription factors. The X, X2, and Y boxes bind regulatory factor X (RFX; consisting of the RFX5, RFX-ANK, and RFX-AP subunits), CREB, and nuclear transcription factor-Y (NF-Y; consisting of A, B, and C subunits), respectively. CIITA does not bind DNA, but directly or indirectly interacts with NF-Y, CREB, and RFX to form a transcriptionally active complex termed the enhanceosome (65;66). Within the enhanceosome, CIITA coordinates the assembly of either activating [p300, CBP, and p300/CBP-associating factor (PCAF), and CARM1 (67)] or repressive [HDAC1, HDAC2, and HDAC4 (68)] histone modifying enzymes (69). CIITA can also interact with chromatin remodeling factors including BRG1 (70) and coactivators including SRC-1 (67). CIITA also increases constitutive MHC class I gene expression and beta-2-microglobulin (β2m) through effects at site α in addition to X- and Y-like sequences in the promoters (71-74). The role of CIITA is MHCI expression and regulation is unknown.

 

The transcription pre-initiation complex involves the association of a TFIID complex with core promoters and subsequent recruitment of the remaining general transcription factors, RNA polymerase II, and elongation factors. The TFIID complex is comprised of TATA binding protein (TBP) and several transcription associated factors (TAFs). CIITA can also function as a general transcription factor within a TFIID-like complex (75;76). CIITA recruits and interacts with TBP, TAF6, TAF7, and TAF9. CIITA can also interact with PTEFb and TFIIB, components of the pre-initiation complex (75;76). As a member of the TFIID-like complex, CIITA is directly involved in IFN-induced expression MHCI and MHCII (29). The acetyltransferase activity of CIITA is inhibited by TAF7, preventing transcription initiation until the pre-initiation complex is fully assembled (77). CIITA autophosphorylation prevents TAF7 binding (29). CIITA also phosphorylates TAF7, histone H2B, and the TFIIF component RAP74 (29). CIITA-mediated phosphorylation of TAF7 is proposed to regulate TAF7 binding to BRD4, PTEFb, and TFIIH. Phosphorylation of histone H2B has been shown to regulate transcription during cell cycle progression and stress response (78). CIITA-mediated phosphorylation of RAP74 is proposed to coordinate the functions of the members of the pre-initiation complex (79).

 

CIITA suppresses the expression of other immunology-associated genes including those that encode interleukin 4 (IL-4), IL-10 (80), cyclin D1 (Ccnd1), c-Myc, N-Myc, E-cathepsin E (Ctse) (81), MMP-9 (Mmp9) (82), the semaphoring receptor plexin A1 in mature mouse dendritic cells (83), Fas ligand (Fasl; see the record for riogrande), collagen α2 (I) (Col1a1), thymidine kinase (Tk1), and myogenin (Myog) (84-87). Cyclin D1, c-Myc, and n-Myc are required for cell proliferation and cell differentiation. IL-4 and IL-10 are cytokines expressed by Th2 cells. CIITA is proposed to suppress IL-4 expression in Th1 cells by competing with NF-AT for binding to CBP (8;30;88). Other studies found that CIITA is not differentially regulated during Th1 and Th2 differentiation in mouse and human T cells (89) and that CIITA did not repress IL-4 expression in Th2, but causes a Th2 bias during CD4+ T cell activation (89). Otten et al. found that CIITA and MHCII expression is upregulated during human CD4+ T cell activation, but not in mouse CD4+ T cells (89). CIITA represses the Col1a1, Mmp9, Tk1, and Ccnd1 promoters by sequestering CBP (42;82;90). CIITA regulates Fasl expression through a competition between CIITA and NF-AT for binding to CBP (31;86). Ciita-deficient (Ciita-/-) mice have elevated FasL expression on developing Th1 cells and on LPS-stimulated B cells (31). CIITA negatively regulates Ctse expression by inhibiting the histone acetyltransferase p300 necessary for Ctse promoter activity (81). CIITA represses the expression of Myog in myoblasts, inhibiting the activity of myogenin in myotubes and subsequently regulating IFN-γ-induced inhibition of myogenesis through the downregulation of muscle-specific genes (e.g., Myog and MyoD) needed for differentiation (87).

 

CIITA also functions as a regulator of adult skeletal homeostasis independent of its role in MHCII expression through the stimulation of resorptive activity and of bone marrow osteoclast differentiation from bone marrow monocyte lineages (91). Mice that were selectively deficient in CIITA-pIV (pIV-/-) exhibited CIITA-pI overexpression in the monocytic lineage in the bone marrow due to increased usage of the pI promoter, but not in bone marrow-derived dendritic cells or in splenic monocytes of B cells from the bone marrow or spleen (91). The pIV-/- mice and transgenic mice that overexpressed CIITA-IV (CIITA-Tg) exhibited trabecular bone defects and reduced trabecular number and bone volume indicating that both CIITA-I and CIITA-IV regulate osteoclast differentiation and bone resorption (91). CIITA expression and the subsequent increased T cell proliferation and survival contribute to the bone wasting effect of estrogen deficiency. Surgically-induced menopause (i.e., ovariectomy) leads to estrogen deficiency, resulting in IFN-γ induced CIITA expression and subsequent increased macrophage antigen presentation, increased T cell activation, longer survival of active T cells, increased T cell TNF production, and TNF-induced bone loss (92;93). Th1 cells exhibit increased IFN-γ secretion, leading to increased IL-12 and IL-18 secretion by macrophages and increased CIITA expression.

 

Mutations in CIITA cause complementation group A bare lymphocyte syndrome (BLS), type II [OMIM: #209920; (94;95)]. BLS has four complementation groups that all exhibit intact MHCII structural genes, but defective transcriptional activation of MHCII genes. Within the first year of life, BLS patients exhibit frequent bacterial, viral, protozoan, and fungal infections as well as gastrointestinal tract and respiratory system infections. BLS patients rarely survive beyond the age of 10. In BLS, antigen presentation is defective resulting in reduced T cell and antibody responses with a concomitant reduction of CD4+ T cells due to reduced or no expression of MHCII and MHCI molecules (96;97). Mutations within the promoter III region of CIITA cause a susceptibility to autoimmune diseases including rheumatoid arthritis (OMIM: #180300), multiple sclerosis, and myocardial infarction (98).

Putative Mechanism

Ciita-deficient (Ciita-/-) mice exhibit normal numbers of B cells, reduced numbers of CD4+ thymocytes, and increased numbers of CD8+ T cells compared to wild-type mice (63;99).  When gated in CD3+ cells, the CD4 and CD8 profiles showed a significant number of cells in the mature CD4+CD8- thymocyte position, although the amount was less than that in wild-type mice (99). Ciita-/- mice had comparable populations of CD11c+, CD11b+, and CD8α dendritic cells as those in wild-type mice (80). Ciita-/- mice exhibited similar levels of splenic myeloid (CD11c+CD11b+) and lymphoid (CD11c+CD11b) dendritic cells to wild-type mice. (80) However, splenic dendritic cells from the Ciita-/- mice had fewer CD11c+CD11bB220+ cells than wild-type mice (80). The level of serum IgM was slightly increased, while the level of serum IgG was drastically reduced in the Ciita-/- mice compared to wild-type mice (63).The display of MHCII proteins on Ciita-/- B220+ IgM+ B cells and macrophages was reduced (99). MHCI proteins were expressed at normal levels in the Ciita-/- mice (80;99). T cells from Ciita-/- mice proliferated normally after activation with ConA or anti-CD3 antibody, indicating that the TCR-mediated responses were normal in the Ciita-/- mice  (62). Ciita-/- dendritic cells stimulated with LPS or CpG expressed increased IL-10 levels, but normal levels of TNF-α and IL-12 relative to control (80). The Ciita-/- mice exhibited a diminished T-dependent antibody response to keyhole limpet hemocyanin (KLH) (62). The diminished frequency of CD4+ thymocytes, increased frequency of CD8+ T cells, and the diminished T-dependent antibody response phenotypes observed in the sisal mice mimics that of Ciita-/- mice indicating diminished CIITA function.

Primers PCR Primer
sisal(F):5'- CAGGGCCTCCTTGAGTGATACAATG -3'
sisal(R):5'- TCCCACCAGTTAGTAGGTGCAGAAG -3'

Sequencing Primer
sisal_seq(F):5'- TACAATGGCATTATGGGAGTCC -3'
sisal_seq(R):5'- CTTCAGCCGTGAAGAGACTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Apiruck Watthanasurorot, Bruce Beutler
List |< first << previous [record 46 of 74] next >> last >|