Phenotypic Mutation 'ares'

• Allele: ares
• Mutation Type: nonsense
• Chromosome: 6
• Coordinate: 85,621,275 bp (GRCm38)
• Base Change: C ⇒ T (forward strand)
• Gene: Alms1
• Gene Name: ALMS1, centrosome and basal body associated
• Chromosomal Location: 85,587,531-85,702,753 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014] ; PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000071904] [ENSMUSP00000148796]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000071904; Gene: ENSMUSG00000063810; AA Change: Q1028*

Domain	Start	End	E-Value	Type
coiled coil region	10	39	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
low complexity region	98	119	N/A	INTRINSIC
Blast:MYSc	127	233	1e-21	BLAST
internal_repeat_3	408	511	2.48e-7	PROSPERO
internal_repeat_2	414	804	2.09e-12	PROSPERO
internal_repeat_1	438	834	4.54e-18	PROSPERO
internal_repeat_3	652	757	2.48e-7	PROSPERO
low complexity region	903	908	N/A	INTRINSIC
internal_repeat_1	916	1385	4.54e-18	PROSPERO
internal_repeat_2	1024	1390	2.09e-12	PROSPERO
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2760	2773	N/A	INTRINSIC
low complexity region	2950	2968	N/A	INTRINSIC
low complexity region	3013	3030	N/A	INTRINSIC
Pfam:ALMS_motif	3125	3247	1.8e-42	PFAM

• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9711
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 038173-MU
• Last Updated: 2022-04-12 3:40 PM by External Program
• Record Created: 2015-01-08 1:41 PM by Jeff SoRelle
• Record Posted: 2015-03-04
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Zhe Chen, Jeff SoRelle, Noelle Hutchins

Accession Number

NCBI RefSeq: NM_145223; MGI:1934606

Alleles Listed at MGI

All mutations/alleles(13) : Chemically induced (ENU)(2) Gene trapped(9) Spontaneous(1) Targeted(1)

Phenotypic Description

Figure 1. Ares mice exhibit increased body weight. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The ares phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1804, some of which showed increased body weights compared to their littermates (Figure 1). 

Nature of Mutation

Figure 2. Linkage mapping of the increased body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 78 mutations (X-axis) identified in the G1 male of pedigree R1804. Scaled phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 78 mutations. The increased body weight phenotype was linked to a mutation in Alms1: a C to T transition at base pair 85,621,275 (v38) on chromosome 6, or base pair 33,779 in the GenBank genomic region NC_000072 encoding Alms1. Linkage was found with a recessive model of inheritance (P = 1.971 x 10^-5), wherein 5 variant homozygotes departed phenotypically from 11 homozygous reference mice and 6 heterozygous mice (Figure 2). The mutation corresponds to residue 3,197 in the mRNA sequence NM_145223 within exon 8 of 23 total exons.

3182 GTTGGATCCACTGAACAGAAAACTCAAATACCA 1023 -V--G--S--T--E--Q--K--T--Q--I--P-

The mutated nucleotide is indicated in red, and converts glutamine 1028 of the ALMS1 protein to a stop codon.

Protein Prediction

Alms1 encodes Alström Syndrome 1 (ALMS1), which has a glutamine-rich segment (amino acids 2-80), a proline-rich segment (amino acids 90-113), a putative leucine zipper (amino acids), a large tandem repeat domain (TRD) comprised of 34 imperfect repeats of a 45-50-amino acid sequence (amino acids 440−1362), a histidine-rich region (amino acids 2582-2618), two putative nuclear localization signals, a serine-rich region, and an ALMS motif (amino acids 3124-3251) [Figure 3; (1-4)]. The functional significance of the domains of ALMS1 is unknown. Leucine zippers often function in protein-DNA or protein-protein interactions (3). The ALMS motif is also found in two other proteins, KIAA1731 and C10orf90, both of which are centriole proteins that are proposed to function in the formation and/or stability of cilia (1;2;4;5). The ares mutation results in coding of a premature stop codon after amino acid 1,028 within the TRD.

Expression/Localization

Alms1 is ubiquitously expressed (2;6). ALMS1 expression shows tissue-specific variability, with highest expression in the testis (2;3). ALMS1 localizes to centrosomes and basal bodies of cell cilia including those in human fetal pancreas, skeletal muscle, liver, kidney, hippocampus, adipocytes, within the hair cells of the developing and functionally mature cochlea, and supporting cells in the organ of Corti (4;5;7-9). During mitosis, ALMS1 localizes to the centrosomal spindle poles and during late mitosis ALMS1 localizes to the contractile ring and the cleavage furrow (10). Alms1 mRNA is upregulated in response to serum starvation (i.e., growth arrest) (11) and downregulated during adipogenesis (12). Alms1 transcription is also regulated by regulatory factor X proteins, which regulate genes of the ciliogenic pathway (13).  

Background

Cilia regulate many physiological processes including sensory (photoreception/vision, mechanosensation/hearing, and chemosensation/olfaction), embryonic development, and male fertility (14-16). Motile cilia facilitate the movement of fluids along cell surfaces as well as sperm motility, while nonmotile (primary) cilia function in the reception and transduction of extracellular signals. Primary cilia have several functions including the intraflagellar transport of signaling proteins and receptors needed for mechanosensation of lumenal flow in kidney tubules, olfaction, photoreception, and signaling through the sonic hedgehog (Shh), Wnt, and platelet-derived growth factor receptor pathways (17). Most cells have a single nonmotile primary cilium that protrudes from the apical face of the cell and is connected to the microtubule complex through the basal body. Bidirectional intraflagellar (i.e., anterograde versus retrograde) transport between the basal body and the distal tip of the cilium mediates the transport of proteins along the primary cilium. Anterograde transport is mediated by kinesin II, while retrograde transport is mediated by dynein [reviewed in (18)].

Figure 4. Putative function of ALMS1. ALMS1 is proposed to be involved in intracellular trafficking of one or more uncharacterized receptors to the primary cilium membrane. ALMS1 may be involved in vesicle transport from the Golgi to the cilium and/or in intraflagellar transport. When ALMS1 is present, signals from the transported receptor regulate cellular homeostasis, neurogenesis, or organ function. In the absence of ALMS1, the receptor(s) are not transported within the cilia, resulting in defective signaling. In the absence of ALMS1 there is obesity, neurosensory deficit, and organ failure. Figure adapted from Girard, D., et al. 2011 .

ALMS1 has putative roles in cell cycle regulation, cell migration, apoptosis, extracellular matrix production, ciliary assembly and/or function, adipogenesis, cytoplasmic microtubular organization, endosomal transport, and regulation of the transport of proteins between the cytoplasm and the ciliary axoneme (4-8;10;12;19;20). However, the precise role of ALMS1 in these processes is unknown. ALMS1 is not required for the initial development of cilia, but is required to maintain the structural and functional integrity of the cilia and/or for postnatal biogenesis of the cilium [Figure 4; (9)]. The C-terminus of ALMS1 interacts with the cytoskeletal actin-binding proteins α-actinin 1 and α-actinin 4 and other components of the endosomal recycling pathway including Huntington-associated protein isoform A (HAP1A), Rab interacting lysosomal protein-like 1 (RILPL1), myosin Vb (MYO5B; see the record new_gray for information about MYO5A), ring finger protein 31 (RNF31), RAD50 interactor 1 (RINT1), and CBP interacting protein 3 (CIP3 or EXOSC8) (10). Two of the ALMS1-interacting proteins, MYO5B and α-actinin isoform 4, are subunits of the cytoskeleton-associated recycling or transport (CART) complex, which functions in the constitutive recycling of receptors (e.g., the transferrin receptor and the β2-adrenergic receptor) from the early endosomes to the plasma membrane (21). Collin et al. propose that ALMS1 may be a component of the CART complex to mediate movement of endosomes along actin filaments to the plasma membrane (10). ALMS1 is also proposed to function in normal axonal development and migration through the regulation of neuronal intraflagellar transport. ALMS1 has a putative function in maintaining intraflagellar transport in hypothalamic-coupled neurons to regulate hypothalamic satiety and hunger (22). ALMS1 is required for the proper anchoring of C-NAP1, a regulator of centrosome organization during mitosis, at the distal end of the centriole (1). Loss of ALMS1 expression results in reduced expression levels of C-NAP1 and subsequent increased centrosome splitting, a necessary process for anaphase chromosomal division, as well as subsequent defects in cilium stability or formation (1). Short interfering RNA (siRNA)-mediated knockdown of Alms1 in mouse inner medullary collectin duct (mIMCD3) cells resulted in mislocalization of acetylated tubulin in the cells (8). However, the transcriptional program that accompanies cilia biogenesis of kidney epithelial cells was not changed upon loss of Alms1 expression (8). In addition, siRNA-mediated Alms1 knockdown in cultured neonatal mouse cardiomyocytes led to increased cell cycle progression (i.e., an increased percentage of cardiomyocytes in G2/M phases) and proliferation (19).

Homozygous or compound heterozygous mutations in ALMS1 that typically result in coding of a premature stop codon and coding of a truncated protein are linked to Alström syndrome (OMIM: #203800; (2;23)]. Alström syndrome has variable symptoms including childhood obesity due to an excess accumulation of subcutaneous adipose tissue, hyperinsulinemia, acanthosis nigricans (a marker of severe insulin resistance), type 2 diabetes mellitus, hypertriglyceridemia that can lead to acute pancreatitis, hypothyroidsism, growth hormone deficiency, sensorineural hearing loss, and progressive rod-cone dystrophy leading to blindness [(24); reviewed in (25;26)]. Approximately 70% of patients with Alström syndrome also have dilated cardiomyopathy during infancy or adolescence [(19); reviewed in (25)]. In addition, many patients have hepatic and urologic dysfunction as well as renal failure and systemic fibrosis with age [reviewed in (25)]. Patients exhibit hypogonadotropic hypogonadism leading to infertility and female patients have symptoms of polycystic ovary syndrome and hyperandrogenism (25;27). The symptoms of Alström syndrome lead to high morbidity and reduced life expectancy (25).

Several Alms1 mutant mouse models (fat aussie (foz), Alms1^L2131X, and Alms1^-/-) have been characterized.  The foz phenotype was linked to a spontaneous 11-base pair (bp 3918-3928) deletion within exon 8 of Alms1 resulting in a frame-shift and coding of a premature stop codon (28). The ENU-induced Alms1 mutation, Alms1^L2131X, resulted in premature truncation of the protein at amino acid 2,130 (8). The Alms1^-/- model is a gene-trapped Alms1 allele (6;29). All of the mouse models exhibited rapid weight gain due to an increase in body fat and increased eating at weaning so that by 8 weeks of age they were significantly heavier than wild-type mice (6;8;9;29;30). All of the mutant Alms1 alleles also resulted in hyperinsulinemia, increased cholesterol levels (total and HDL), moderate late-onset (after ~16 weeks) diabetes only in the male mice, steatosis of the liver, hyperplastic pancreatic islets, and hypogonadism leading to infertility in the male mice (6;8;28-30). The Alms1^-/- retina exhibited age-related degeneration and defective transport of rhodopsin (see the record for Bemr3), the major protein in rod photoreceptor outer segment discs; membrane-bound vesicles accumulated in the distal portion of the inner segments near the connecting cilium (8). Alms1 mutations also led to age-related cochlear degeneration and hearing loss. The Alms1^-/- mice exhibited misshapen stereociliary outer hair bundles and mislocalized kinocilia; the inner hair cells bundles in the Alms1^-/- mice were largely normal (5). Young female foz/foz mice were fertile, but litter sizes were smaller than those of wild-type or heterozygous mice (28). After the female mice became obese, they became infertile and the ovaries were devoid of corpora lutea, indicating an anovulatory state (28). The foz/foz mice also exhibited a reduction in neurons that displayed cilia marked with adenylyl cyclase 3, a signaling protein that regulates obesity, as well as a reduction in cilia that contained the appetite-regulating proteins, Mchr1 and Sstr3 (9). When fed a high-fat diet the foz/foz mice undergo transition of steatosis to severe fibrosing steatohepatitis that includes the majority of hepatocytes exhibiting severe ballooning degeneration, lobular inflammation, and pericellular and pericentral fibrosis (30). The transition after high-fat diet was associated with higher hepatic triglyceride levels compared to chow-fed foz/foz mice (30). Total GLUT4 content, insulin-stimulated GLUT4 translocation, and glucose uptake was reduced in the Alms1^-/- mice indicating that ALMS1 mediates glucose homeostasis through the GLUT4 trafficking pathway (29). The Alms1^-/- mice could respond to insulin by stimulating AKT phosphorylation indicating that the impaired GLUT4 translocation is downstream of AKT activation or is independent of AKT signaling.

Putative Mechanism

Centrosome and basal body dysfunction as a result of mutations in Alms1 are predicted to lead to the pathogenesis of obesity, insulin resistance, and type 2 diabetes.  Although the exact function of ALMS1 is unknown, it has been shown to be essential in weight regulation. Other ALMS1-related phenotypes have not been tested or observed in ares, but the weight gain phenotype indicates that the mutation results in loss-of-function.

Primers

PCR Primer
ares_pcr_F: AGCAGCCTATGTCAGATAGTCAG
ares_pcr_R: AGAGCCAGAGCCTACTGATTTC

Sequencing Primer
ares_seq_F: GCCTATGTCAGATAGTCAGCGAAC
ares_seq_R: CCAGAGCCTACTGATTTCAAAAATAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 6, + strand):

1   agcagcctat gtcagatagt cagcgaacta aaggtcacaa agaatcagat gttcctggac
61  caactgacca gaagactggc atagcaacag tgcattctac ttcccaatca tatataggga
121 ggcgcactgt ttcttaccag aaagagtttc cagatcttag tgaaaaggct ttgaaagttc
181 taggtgatgt tggatccact gaacagaaaa ctcaaatacc agtagtgtct tctgctctct
241 tacacaaaga ggggcctagt gcttaccagg aggatttgcc agatcttact gaagaacctt
301 tgcaaatttt aggtgtttct gaagaagttt cttctagctc ttatcagagg aagttaccag
361 atcatattga agtatttttg aaatcagtag gctctggctc t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Knorz, V. J., Spalluto, C., Lessard, M., Purvis, T. L., Adigun, F. F., Collin, G. B., Hanley, N. A., Wilson, D. I., and Hearn, T. (2010) Centriolar Association of ALMS1 and Likely Centrosomal Functions of the ALMS Motif-Containing Proteins C10orf90 and KIAA1731. Mol Biol Cell. 21, 3617-3629.

  2. Collin, G. B., Marshall, J. D., Ikeda, A., So, W. V., Russell-Eggitt, I., Maffei, P., Beck, S., Boerkoel, C. F., Sicolo, N., Martin, M., Nishina, P. M., and Naggert, J. K. (2002) Mutations in ALMS1 Cause Obesity, Type 2 Diabetes and Neurosensory Degeneration in Alstrom Syndrome. Nat Genet. 31, 74-78.

  3. Hearn, T., Renforth, G. L., Spalluto, C., Hanley, N. A., Piper, K., Brickwood, S., White, C., Connolly, V., Taylor, J. F., Russell-Eggitt, I., Bonneau, D., Walker, M., and Wilson, D. I. (2002) Mutation of ALMS1, a Large Gene with a Tandem Repeat Encoding 47 Amino Acids, Causes Alstrom Syndrome. Nat Genet. 31, 79-83.

  4. Hearn, T., Spalluto, C., Phillips, V. J., Renforth, G. L., Copin, N., Hanley, N. A., and Wilson, D. I. (2005) Subcellular Localization of ALMS1 Supports Involvement of Centrosome and Basal Body Dysfunction in the Pathogenesis of Obesity, Insulin Resistance, and Type 2 Diabetes. Diabetes. 54, 1581-1587.

  5. Jagger, D., Collin, G., Kelly, J., Towers, E., Nevill, G., Longo-Guess, C., Benson, J., Halsey, K., Dolan, D., Marshall, J., Naggert, J., and Forge, A. (2011) Alstrom Syndrome Protein ALMS1 Localizes to Basal Bodies of Cochlear Hair Cells and Regulates Cilium-Dependent Planar Cell Polarity. Hum Mol Genet. 20, 466-481.

  6. Collin, G. B., Cyr, E., Bronson, R., Marshall, J. D., Gifford, E. J., Hicks, W., Murray, S. A., Zheng, Q. Y., Smith, R. S., Nishina, P. M., and Naggert, J. K. (2005) Alms1-Disrupted Mice Recapitulate Human Alstrom Syndrome. Hum Mol Genet. 14, 2323-2333.

  7. Andersen, J. S., Wilkinson, C. J., Mayor, T., Mortensen, P., Nigg, E. A., and Mann, M. (2003) Proteomic Characterization of the Human Centrosome by Protein Correlation Profiling. Nature. 426, 570-574.

  8. Li, G., Vega, R., Nelms, K., Gekakis, N., Goodnow, C., McNamara, P., Wu, H., Hong, N. A., and Glynne, R. (2007) A Role for Alstrom Syndrome Protein, alms1, in Kidney Ciliogenesis and Cellular Quiescence. PLoS Genet. 3, e8.

  9. Heydet, D., Chen, L. X., Larter, C. Z., Inglis, C., Silverman, M. A., Farrell, G. C., and Leroux, M. R. (2013) A Truncating Mutation of Alms1 Reduces the Number of Hypothalamic Neuronal Cilia in Obese Mice. Dev Neurobiol. 73, 1-13.

  10. Collin, G. B., Marshall, J. D., King, B. L., Milan, G., Maffei, P., Jagger, D. J., and Naggert, J. K. (2012) The Alstrom Syndrome Protein, ALMS1, Interacts with Alpha-Actinin and Components of the Endosome Recycling Pathway. PLoS One. 7, e37925.

  11. Yabuta, N., Onda, H., Watanabe, M., Yoshioka, N., Nagamori, I., Funatsu, T., Toji, S., Tamai, K., and Nojima, H. (2006) Isolation and Characterization of the TIGA Genes, Whose Transcripts are Induced by Growth Arrest. Nucleic Acids Res. 34, 4878-4892.

  12. Romano, S., Milan, G., Veronese, C., Collin, G. B., Marshall, J. D., Centobene, C., Favaretto, F., Dal Pra, C., Scarda, A., Leandri, S., Naggert, J. K., Maffei, P., and Vettor, R. (2008) Regulation of Alstrom Syndrome Gene Expression during Adipogenesis and its Relationship with Fat Cell Insulin Sensitivity. Int J Mol Med. 21, 731-736.

  13. Purvis, T. L., Hearn, T., Spalluto, C., Knorz, V. J., Hanley, K. P., Sanchez-Elsner, T., Hanley, N. A., and Wilson, D. I. (2010) Transcriptional Regulation of the Alstrom Syndrome Gene ALMS1 by Members of the RFX Family and Sp1. Gene. 460, 20-29.

  14. Berbari, N. F., O'Connor, A. K., Haycraft, C. J., and Yoder, B. K. (2009) The Primary Cilium as a Complex Signaling Center. Curr Biol. 19, R526-35.

  15. Gerdes, J. M., Davis, E. E., and Katsanis, N. (2009) The Vertebrate Primary Cilium in Development, Homeostasis, and Disease. Cell. 137, 32-45.

  16. Goetz, S. C., and Anderson, K. V. (2010) The Primary Cilium: A Signalling Centre during Vertebrate Development. Nat Rev Genet. 11, 331-344.

  17. Singla, V., and Reiter, J. F. (2006) The Primary Cilium as the Cell's Antenna: Signaling at a Sensory Organelle. Science. 313, 629-633.

  18. Rosenbaum, J. L., and Witman, G. B. (2002) Intraflagellar Transport. Nat Rev Mol Cell Biol. 3, 813-825.

  19. Shenje, L. T., Andersen, P., Halushka, M. K., Lui, C., Fernandez, L., Collin, G. B., Amat-Alarcon, N., Meschino, W., Cutz, E., Chang, K., Yonescu, R., Batista, D. A., Chen, Y., Chelko, S., Crosson, J. E., Scheel, J., Vricella, L., Craig, B. D., Marosy, B. A., Mohr, D. W., Hetrick, K. N., Romm, J. M., Scott, A. F., Valle, D., Naggert, J. K., Kwon, C., Doheny, K. F., and Judge, D. P. (2014) Mutations in Alstrom Protein Impair Terminal Differentiation of Cardiomyocytes. Nat Commun. 5, 3416.

  20. Zulato, E., Favaretto, F., Veronese, C., Campanaro, S., Marshall, J. D., Romano, S., Cabrelle, A., Collin, G. B., Zavan, B., Belloni, A. S., Rampazzo, E., Naggert, J. K., Abatangelo, G., Sicolo, N., Maffei, P., Milan, G., and Vettor, R. (2011) ALMS1-Deficient Fibroblasts Over-Express Extra-Cellular Matrix Components, Display Cell Cycle Delay and are Resistant to Apoptosis. PLoS One. 6, e19081.

  21. Yan, Q., Sun, W., Kujala, P., Lotfi, Y., Vida, T. A., and Bean, A. J. (2005) CART: An Hrs/actinin-4/BERP/myosin V Protein Complex Required for Efficient Receptor Recycling. Mol Biol Cell. 16, 2470-2482.

  22. Mok, C. A., Heon, E., and Zhen, M. (2010) Ciliary Dysfunction and Obesity. Clin Genet. 77, 18-27.

  23. Joy, T., Cao, H., Black, G., Malik, R., Charlton-Menys, V., Hegele, R. A., and Durrington, P. N. (2007) Alstrom Syndrome (OMIM 203800): A Case Report and Literature Review. Orphanet J Rare Dis. 2, 49.

  24. Marshall, J. D., Bronson, R. T., Collin, G. B., Nordstrom, A. D., Maffei, P., Paisey, R. B., Carey, C., Macdermott, S., Russell-Eggitt, I., Shea, S. E., Davis, J., Beck, S., Shatirishvili, G., Mihai, C. M., Hoeltzenbein, M., Pozzan, G. B., Hopkinson, I., Sicolo, N., Naggert, J. K., and Nishina, P. M. (2005) New Alstrom Syndrome Phenotypes Based on the Evaluation of 182 Cases. Arch Intern Med. 165, 675-683.

  25. Marshall, J. D., Beck, S., Maffei, P., and Naggert, J. K. (2007) Alstrom Syndrome. Eur J Hum Genet. 15, 1193-1202.

  26. Girard, D., and Petrovsky, N. (2011) Alstrom Syndrome: Insights into the Pathogenesis of Metabolic Disorders. Nat Rev Endocrinol. 7, 77-88.

  27. Dunaif, A. (1997) Insulin Resistance and the Polycystic Ovary Syndrome: Mechanism and Implications for Pathogenesis. Endocr Rev. 18, 774-800.

  28. Arsov, T., Silva, D. G., O'Bryan, M. K., Sainsbury, A., Lee, N. J., Kennedy, C., Manji, S. S., Nelms, K., Liu, C., Vinuesa, C. G., de Kretser, D. M., Goodnow, C. C., and Petrovsky, N. (2006) Fat Aussie--a New Alstrom Syndrome Mouse Showing a Critical Role for ALMS1 in Obesity, Diabetes, and Spermatogenesis. Mol Endocrinol. 20, 1610-1622.

  29. Favaretto, F., Milan, G., Collin, G. B., Marshall, J. D., Stasi, F., Maffei, P., Vettor, R., and Naggert, J. K. (2014) GLUT4 Defects in Adipose Tissue are Early Signs of Metabolic Alterations in Alms1GT/GT, a Mouse Model for Obesity and Insulin Resistance. PLoS One. 9, e109540.

  30. Arsov, T., Larter, C. Z., Nolan, C. J., Petrovsky, N., Goodnow, C. C., Teoh, N. C., Yeh, M. M., and Farrell, G. C. (2006) Adaptive Failure to High-Fat Diet Characterizes Steatohepatitis in Alms1 Mutant Mice. Biochem Biophys Res Commun. 342, 1152-1159.