Phenotypic Mutation 'troy' (pdf version)
List |< first << previous [record 92 of 132] next >> last >|
Alleletroy
Mutation Type nonsense
Chromosome7
Coordinate109,020,954 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Tub
Gene Name tubby bipartite transcription factor
Synonym(s) rd5, tub
Chromosomal Location 108,950,338-109,034,460 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021885; MGI:2651573

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000033341] [ENSMUSP00000113580] [ENSMUSP00000146894]
PDB Structure
C-TERMINAL DOMAIN OF MOUSE BRAIN TUBBY PROTEIN [X-RAY DIFFRACTION]
C-Terminal Domain Of Mouse Brain Tubby Protein bound to Phosphatidylinositol 4,5-bis-phosphate [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028
AA Change: R60*

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028
AA Change: R14*

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 145 174 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
Pfam:Tub 211 453 2.4e-121 PFAM
Predicted Effect probably null
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
adipose tissue
Body Weight - increased 10629044
Body Weight (DSS Female) - increased 10629044
Body Weight (DSS Male) - increased 10629044
Body Weight (DSS) - increased 10629044
Body Weight (Female) - increased 10629044
growth/size
Penetrance  
Alleles Listed at MGI

All mutations/alleles(5) : Spontaneous(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Tub APN 7 109021036 splice site probably benign
IGL02715:Tub APN 7 109029310 missense probably benign
grasso UTSW 7 109029650 missense probably damaging 1.00
R0152:Tub UTSW 7 109020927 missense probably damaging 1.00
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0317:Tub UTSW 7 109020927 missense probably damaging 1.00
R1382:Tub UTSW 7 109030153 missense probably damaging 1.00
R1395:Tub UTSW 7 109020954 nonsense probably null
R1588:Tub UTSW 7 109029681 missense probably damaging 1.00
R1975:Tub UTSW 7 109027835 missense possibly damaging 0.74
R2047:Tub UTSW 7 109026732 missense probably benign 0.30
R2121:Tub UTSW 7 109026737 missense probably damaging 1.00
R2414:Tub UTSW 7 109027033 missense probably damaging 1.00
R3694:Tub UTSW 7 109027832 missense probably benign
R3695:Tub UTSW 7 109027832 missense probably benign
R4914:Tub UTSW 7 109020954 nonsense probably null
R5139:Tub UTSW 7 109011102 start codon destroyed probably null 0.53
R5347:Tub UTSW 7 109026771 missense possibly damaging 0.67
R5557:Tub UTSW 7 109025718 missense probably damaging 0.99
R6000:Tub UTSW 7 109029650 missense probably damaging 1.00
R6245:Tub UTSW 7 109027058 missense probably damaging 1.00
R6888:Tub UTSW 7 109029298 missense probably null 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 038197-MU
Last Updated 2017-06-16 6:15 PM by Bruce Beutler
Record Created 2015-01-08 11:57 PM by Jeff SoRelle
Record Posted 2015-05-18
Phenotypic Description

Figure 1. Troy mice exhibit increased body weights compared to wild-type mice. Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The troy phenotype was identified in N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1395, some of which showed increased body weights compared to wild-type controls (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the increased body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 66 mutations (X-axis) identified in the G1 male of pedigree R1395. Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 66 mutations. The increased body weight phenotype was linked to a mutation in Tub: a C to T transition at base pair 109,020,954 (v38) on chromosome 7, or base pair 10,075 in the GenBank genomic region NC_000073 encoding Tub. Linkage was found with a recessive model of inheritance (P = 1.826 x 10-5), wherein 8 variant homozygotes departed phenotypically from 14 homozygous reference mice and 16 heterozygous mice.

 

The mutation corresponds to residue 399 in the mRNA sequence NM_021885 within exon 3 of 12 total exons.

 

384 CGGCCCCGGAGTCGGCGAGCCCGGCAGTCAGAG

55  -R--P--R--S--R--R--A--R--Q--S--E-

 

The mutated nucleotide is indicated in red and converts arginine (R) 60 of the Tub protein to a premature stop codon (R60*).

Protein Prediction
Figure 3. Domain structure of Tub. Tub only has one predicted domain, the tubby domain (TUB). The location of the troy mutation is indicated.

Tub encodes Tub, a member of the Tub family of proteins that also includes the tubby-like proteins (TULP) TULP1, TULP2, and TULP3 (Figure 3). The N-termini of the Tub family of proteins are variable, but resemble activation domains from known transcription factors (1). The N-terminus of Tub is able to activate GLUT4 reporter constructs, but the putative targets of Tub are unknown. The N-terminus directs the localization of Tub to the nucleus (2). Tub has four nuclear localization signal (NLS) consensus sequences: K39KKR, P56RSRRAR, P123RKEKKG, and K302RKK (where K is lysine, R is arginine, E is glutamic acid, G is glycine, A is alanine, P is proline, and S is serine) (1). In addition, the N-terminus of Tub has a motif similar to that in TULP3 which binds to the core subunits of the ciliary intraflagellar transport complex-A (IFT-A) (3). Five minimal phagocytic determinants (K/R(X)(1-2)KKK) at the N-terminus of Tub bind MerTK (4).

Figure 4. Crystal structure of the mouse Tub C-terminus. Amino acids 243-505 are shown. Figure was generated by UCSF Chimera and is based on PDB: 1I7E. The image is interactive; click to rotate.

The C-terminal tubby domain (amino acids 257-499) of Tub is highly conserved between mouse and human as well as between the members of the Tub protein family (5;6). The C-terminus of mouse Tub (amino acids 243-505) has been crystallized (Figure 4; PDB:1I7E) (1). A central hydrophobic helix at the C-terminus traverses the interior of a closed 12-stranded ∼18 Å β-barrel (1). The β-barrel has an alternating up-down nearest-neighbor topology (1). There is a three-stranded β-sheet (designated as 9A, 9B, and 9C) between strands 9 and 10 of the barrel (1). Also, four helices (designated as H4, H6A, H6B, and H8) were in the corresponding loop regions between strands of the main barrel (1). A helix, helix H10, caps the top of the β-barrel and helix H12 traverses the inside of the barrel (1). The K302RKK putative NLS is at the base of β-strand 3 (1). The C-terminus binds to the plasma membrane through an association between the C-terminus and phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) (2). β-strands 4, 5, and 6 and helix 6A form a pocket that associates with l-α-glycerophospho-d-myo-inositol 4,5-bisphosphate (GPMI-P2), an analog of the head group from PtdIns(4,5)P2 (2). Lys330 coordinates the interaction between the 4- and 5-phosphates, while Arg332 stabilizes the 4-phosphate. Arg363 coordinates with the inositol ring at the 3-position. Asn310 associates with the oxygen atoms at the 4- and 5-phosphoester positions (2). The 54 C-terminal amino acids of Tub interact with apoptotic cells during MerTK-dependent apoptosis (4).

 

In hypothalamic nuclei, the insulin receptor directly induces Tub tyrosine phosphorylation. Leptin-associated signaling (see the record for Potbelly and Business­_class) also induces Tub phosphorylation through the kinase JAK2 (7). The phosphorylation of Tub is regulated by nutritional status: phosphorylation is decreased during fasting and increased after refeeding (7).

 

The troy mutation results in a premature stop codon at amino acid 60 near the N-terminus of Tub. Arg60 is within one of the putative NLS sequences in Tub. Expression and localization of Tubtroy has not been examined.

Expression/Localization

In the mouse, Tub is expressed in the central and peripheral nervous systems in differentiating neurons at embryonic day (E) 9.5 (8). At E13.5, Tub is expressed in most neuronal structures including the roof of the midbrain, the roof of the telencephalic vesicles and the striatum as well as in the olfactory neuronal structures, neural retina, and the spiral ganglion of the inner ear apparatus (8). In the adult mouse, Tub is highly expressed in the brain, eye, and testis; expression was not detect in the kidney, liver, lung, or spleen (1;5;6;8;9). Tub is moderately expressed in the large intestine, skeletal muscle, and heart and expressed at low levels in adipose, small intestine, lung, ovary, thymus, and liver (8;9). Within the brain, Tub is expressed primarily in the hippocampus, hypothalamus, and cortex; Tub is weakly expressed throughout the rest of the brain (5;8). Within the hypothalamus, Tub is highly expressed in the paraventricular, ventromedial, and arcuate nuclei (5;7).

 

Tub localizes to the plasma membrane, but translocates to the nucleus in neural cells upon activation of the G-protein, Gαq, as well as after insulin, leptin, and acetylcholine exposure (2;7). Gαq releases Tub from the plasma membrane by phospholipase C–β (PLC-β)–mediated hydrolysis of PtdIns(4,5)P2, and Tub subsequently translocates to the nucleus (2).

Background
Figure 5. Putative functions of Tub. Tubby functions downstream of G protein-coupled receptors. Tubby transports to the plasma membrane upon Gαq activation and binds PIP2. PLCβ mediates the release of Tubby from the plasma membrane. Tubby subsequently translocates to nucleus and IP3 is released. In the nucleus, Tubby binds to DNA to regulate transcription. Gα11 proteins induce Tubby translocation in a similar manner to Gαq. Tubby is also a substrate of the insulin receptor and is a putative substrate of the insulin receptor kinase, Abl, and JAK2 kinases. JAK2 also mediates leptin receptor signaling.

Tub has several putative functions (Figure 5). Tub is a downstream effector of G-protein coupled receptors (GPCRs) that signal through the Gq (Gαq and Gα11) subclass of Gα proteins (e.g., the serotonin receptor 5HT2c) (2). Receptor-mediated activation of Gαq releases Tub from the plasma membrane through the action of PLCβ. Once Tub translocates to the nucleus, the second messenger inositol 1,4,5-triphosphate (IP3) is released. The translocation of Tub to the nucleus upon 5HT2c activation points to a putative function as a transcription factor (1). Leptin- or insulin-induced Tub translocation to the nucleus results in altered expression of Pomc, Trh, Mch, and orexin mRNAs (7). Tub is proposed to bind double-stranded DNA through its C-terminus (10); however the transcriptional targets of Tub are unknown. Tub binds strongly with double-stranded DNA, but poorly with single-stranded DNA (1).

 

Tub has been identified as an adaptor protein downstream of the insulin receptor that links the insulin receptor to SH2-containing proteins such as Abl, lymphocyte-specific protein-tyrosine kinase (Lck; see the record for iconoclast), and PLCγ (see the record for queen) (11). Tub is a substrate of JAK2, a protein involved in leptin receptor signaling (see the record for Business_class). Tub has also been identified as a ligand for MerTK and mediates MerTK-dependent phagocytosis (4). Phagocytosis ligands mediate the selection of extracellular cargos and initiate engulfment. MerTK is a phagocytic receptor that functions in retinal homeostasis and prevention of autoimmunity (12;13). Tub induces MerTK autophosphorylation and subsequent activation. MerTK activation promotes non-muscle myosin II redistribution in retinal pigment epithelium (RPE) cells and colocalization with phagocytosed cargos (4). Tub forms heterodimers or heteroligmers with Tulp1 to synergistically facilitate RPE phagocytosis (14). Tub is also essential for MerTK-mediated microglial phagocytosis, indicating a putative function for Tub in CNS homeostasis and innate immune balance (15). Tub also functions in an endocytic pathway to regulate fat storage (16;17).

 

Tub regulates trafficking of select GPCRs in the neuronal and sensory cilia including rhodopsin (see the record for Bemr3) in the rod cell photoreceptor as well as melanin-concentrating hormone receptor 1 (MCHR1) and somatostatin receptor subtype 3 (SSTR3) in the brain. Olfactory cilia and the localization of olfactory GPCRs are not regulated by Tub (18). Tub is not necessary for ciliogenesis and/or maintenance or for general protein trafficking to the cilia (18). The association of Tub with membrane phosphoinositides is proposed to facilitate Tub-mediated trafficking of ciliary GPCRs [reviewed in (19)].

 

Tub mutant mouse models have been characterized including the tubby strain and a Tub knockout (Tub-/-) strain. The tubby strain has a spontaneous G to T transversion in the donor splice site of exon 11 in Tub, resulting in a frame-shift and coding of 25 aberrant amino acids at the C-terminus of Tub (5;20). Homozygous tubby mice and Tub-/- mice have late-onset weight gain starting at 8-12 weeks of age (at ~19 weeks of age the weight of Tub mutant mice is approximately double of wild-type mice). The tubby mice also have a gradual increase in their plasma insulin levels and food intake, but do not develop overt diabetes.  The tubby mice have reduced energy expenditure (21;22). Triglyceride levels in the tubby mice were elevated approximately 1.5-fold compared to wild-type mice (23). In addition, the levels of high-density lipoprotein (HDL) cholesterol were mildly elevated in the male tubby mice compared to wild-type mice; female tubby mice did not exhibit a significant change in HDL levels (23). The tubby mice become infertile after becoming significantly obese; sperm cell motile function was normal in tubby (24). The tubby mice have a low respiratory exchange ratio (i.e., respiratory quotient) that is accompanied by altered metabolism in the liver (i.e., higher excretion of ketone bodies and accumulation of glycogen) and a failure to induce glucose-6-phosphate dehydrogenase, an enzyme in the pentose phosphate pathway that supplies NAPDH for de novo fatty acid synthesis and glutathione reduction (22). The tubby mice have altered expression of pro-opiomelanocortin and neuropeptide Y, factors involved in energy regulation and metabolism (25), and the thyroid hormone receptor, essential for growth and metabolism regulation, is a putative target of Tub-mediated transcription regulation (26). The tubby mice also exhibit progressive retinal and cochlear degeneration due to apoptosis of retinal (i.e., photoreceptor cells) and cochlear neurosensory cells (i.e., organ of Corti and ganglian cells in the basal end of the cochlea), respectively (24;27-30). At P17-21, there is extracellular accumulation of rhodopsin vesicles in the interphotoreceptor space surrounding the photoreceptor inner segments in the tubby retina (30). In addition, the light/dark compartmentalization of arrestin and transducin, two phototransduction proteins, was disrupted in the tubby mice (30). Tubby mice raised in darkness exhibited less photoreceptor loss than those raised in bright cyclic light, indicating that phototransduction regulates photoreceptor cell death in the tubby mice (30).

 

TUB is a candidate gene for influencing body weight in humans (31). In addition, mutations in TUB have been linked to body composition and eating behavior in middle-aged women (32). Homozygous mutations in TUB have been linked to retinal dystrophy, night blindness, decreased visual acuity, and early-onset obesity (33).

Putative Mechanism

The link between the putative functions of Tub and the phenotypes exhibited by the tubby mice has not been determined; however a putative role of Tub (and the TULP proteins) in regulation of ciliary neurosensory functions by regulating the localization of ciliary proteins has been proposed (34). The high expression of Tub in the hypothalamus indicates that Tub may function in neuroendocrine control of satiety and metabolism. The obesity phenotype of the troy mice mimics that observed in the tubby mice indicates a loss of function of Tub. Other Tub-associated phenotypes (e.g., retinal degeneration, hearing loss, and elevated insulin levels) have not been examined in troy.

Primers PCR Primer
troy(F):5'- GCTGACAGCTAGTCAGAAGATGCC -3'
troy(R):5'- ACAGGATGAATCCCTAAGCTCCGC -3'

Sequencing Primer
troy_seq(F):5'- GATGCCAATAACATGAGTCCTG -3'
troy_seq(R):5'- CTAAGCTCCGCCCACTC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Zhe Chen
List |< first << previous [record 92 of 132] next >> last >|