Phenotypic Mutation 'pale_fire' (pdf version)
Allelepale_fire
Mutation Type missense
Chromosome19
Coordinate46,311,626 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Nfkb2
Gene Name nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Synonym(s) NF kappaB2, p52
Chromosomal Location 46,304,737-46,312,090 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit gastric hyperplasia, enlarged lymph nodes, enhanced cytokine production by activated T cells, absence of Peyer's patches, increased susceptibility to Leishmania major, and early postnatal mortality. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_019408; MGI: 1099800

Mapped Yes 
Amino Acid Change Methionine changed to Leucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000072859] [ENSMUSP00000107512]
PDB Structure Crystal structure of the dimerization domains p52 homodimer [X-RAY DIFFRACTION]
Crystal structure of the dimerization domains p52 and RelB [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225
AA Change: M838L

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000073116)
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225
AA Change: M838L

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
(Using ENSMUST00000111881)
Meta Mutation Damage Score 0.0605 question?
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1a cells - increased
Candidate Explorer Status CE: not good candidate; Verification probability: 0.087; ML prob: 0.128; human score: -3
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(11) : Chemically induced (ENU)(2) Targeted(7) Transgenic(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
xander APN 19 splice acceptor site
IGL01466:Nfkb2 APN 19 46308016 missense probably damaging 0.96
IGL01791:Nfkb2 APN 19 46309839 unclassified probably benign
IGL01966:Nfkb2 APN 19 46309690 missense probably benign 0.04
IGL03296:Nfkb2 APN 19 46309928 missense probably damaging 1.00
Dolores UTSW 19 46308223 missense possibly damaging 0.86
haze UTSW 19 46307434 missense possibly damaging 0.93
humbert UTSW 19 46307441 missense possibly damaging 0.86
lolita UTSW 19 46307720 critical splice donor site probably null
Nabukov UTSW 19 46308439 missense probably damaging 0.99
Quilty UTSW 19 46308643 missense possibly damaging 0.64
R0270:Nfkb2 UTSW 19 46311626 missense possibly damaging 0.96
R0561:Nfkb2 UTSW 19 46309862 missense possibly damaging 0.93
R1944:Nfkb2 UTSW 19 46308052 missense probably damaging 1.00
R2217:Nfkb2 UTSW 19 46307724 splice site probably null
R2878:Nfkb2 UTSW 19 46307441 missense possibly damaging 0.86
R4493:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4494:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4495:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4731:Nfkb2 UTSW 19 46308964 missense possibly damaging 0.74
R4752:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4753:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4777:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4780:Nfkb2 UTSW 19 46309922 missense probably damaging 1.00
R4820:Nfkb2 UTSW 19 46308054 missense probably damaging 0.99
R4837:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4839:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5514:Nfkb2 UTSW 19 46311408 missense probably damaging 1.00
R5519:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5549:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5615:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5616:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5709:Nfkb2 UTSW 19 46310521 missense probably damaging 1.00
R6053:Nfkb2 UTSW 19 46311812 missense probably damaging 1.00
R6794:Nfkb2 UTSW 19 46307720 critical splice donor site probably null
R7539:Nfkb2 UTSW 19 46308223 missense possibly damaging 0.86
R7573:Nfkb2 UTSW 19 46308643 missense possibly damaging 0.64
R7963:Nfkb2 UTSW 19 46309919 missense possibly damaging 0.78
R8147:Nfkb2 UTSW 19 46307434 missense possibly damaging 0.93
R8153:Nfkb2 UTSW 19 46308016 missense probably damaging 0.96
R8241:Nfkb2 UTSW 19 46307615 missense probably benign 0.01
S24628:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
Z1177:Nfkb2 UTSW 19 46311590 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038204-MU
Last Updated 2019-09-04 9:46 PM by Diantha La Vine
Record Created 2015-01-10 2:16 PM by Bruce Beutler
Record Posted 2019-05-21
Phenotypic Description

Figure 1. Pale_fire mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The pale_fire phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0270, some of which exhibited an increased frequency of B1a cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased frequency of peripheral B1a cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 110 mutations (X-axis) identified in the G1 male of pedigree R0270. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 110 mutations. The increased B1a cell frequency in the peripheral blood was linked by continuous variable mapping to a mutation in Nfkb2:  an A to T transversion at base pair 46,311,626 (v38) on chromosome 19, or base pair 8,015 in the GenBank genomic region NC_000085.  Linkage was found with a recessive model of inheritance (P = 2.53 x 10-4), wherein 10 variant homozygotes departed phenotypically from 15 homozygous reference mice and 20 heterozygous mice (Figure 2).  

 

The mutation corresponds to residue 2,821 in the mRNA sequence NM_019408 (variant 1) within exon 21 of 22 total exons, to residue 2,670 in the mRNA sequence NM_001177369 (variant 2) within exon 22 of 23 total exons, and residue 2,586 in the mRNA sequence NM_001177370 (variant 3) within exon 21 of 22 total exons.

 

8000 GAGGCCTTGTCTGACATGGGTCTCCATGAGGGA

833  -E--A--L--S--D--M--G--L--H--E--G-

 

Genomic numbering corresponds to NC_000085. The mutated nucleotide is indicated in red.  The mutation results in a methionine (M) to leucine (L) substitution at position 838 (M838L) in all isoforms of the NF-κB2 protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.956) (1).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. The NF-κB and IκB families. The nuclear-κB family consists of five members: REL (c-Rel), RelA (p65), RelB, p105/p50 (NF-κB1; see the record for Finlay), and p100/p52 (NF-κB2). They share a conserved N-terminal Rel-homology domain (RHD), which contains the dimerization, nuclear translocation, and DNA binding motifs. c-Rel, RelA, and RelB also have non-homologous C-terminal transactivation domains, and RelB contains an additional leucine zipper (shown in orange). These factors dimerized in various combinations to form NF-κB transcription factor complexes. The inhibitor of NF-κB (IκB) family contains the classical IκBs (IκBαIκBβ, and IκBε), the NF-κB precursors (p105 and p100), as well as B-cell lymphoma 3 (BCL-3), IκBζ, and IκBNS. These proteins are characterized by an ankyrin domain that contains five to seven ankyrin repeats and are able to bind to and inhibit the NF-κB RHDs. Exceptions are BCL-3 and IκBζ, which are able to bind p50 and p52 homodimers and induce transcription. Cleavage of p105 and p100 generates the p50 and p52 NF-κB, respectively. p105 also generates IκBγ (not shown).

 

Figure 4. Domain structure of the NF-κB2 p100 protein. The pale_fire mutation results in a methionine (M) to leucine (L) substitution at position 838 (M838L). This image is interactive. Other mutations are noted in red. Click on each allele fore more information.

The Nfkb2 gene encodes a roughly 100 kD 899 amino acid protein (p100), which is cleaved at amino acids 454-455 to produce an active 52-kD transcription factor (p52) that is a member of the NF-κB family of transcription factors [Figure 3; reviewed in (2)]. The members of the NF-κB family (i.e., NF-κB1 (p50 and its precursor p105; see the record for Finlay), RelA (also known as p65), c-Rel, and RelB) are characterized by the presence of an N-terminal Rel homology domain (RHD) that is responsible for homo- and heterodimerization as well as for sequence-specific DNA binding. Unlike RelA, c-Rel, and RelB, p52 and p50 do not contain a C-terminal transcription activation domain (TAD).  p52 is able to heterodimerize with most other NF-κB proteins, but preferentially binds to RelB, as does the p100 precursor (3-5). p52 homodimers likely repress transcription by competing with other NF-κB dimers for binding sites in the promoters of NF-κB activated genes. Both the p100 and p105 proteins contain multiple C-terminal ankyrin repeats (seven in p100), a common feature shared by IκB family members (Figure 4).  Between the RHD and the ankyrin repeats is a glycine-rich region (GRR) that is essential for determining the site of p100 cleavage into the p52 subunit.  p100 also contains a C-terminal death domain (DD) at amino acids 764-851 that associates with the S9 subunit of the 19 S protease (6). Death domains are conserved regions that are usually involved in homotypic protein interactions, and are composed of a bundle of six α-helices.

 

The pale_fire mutation results in a methionine (M) to leucine (L) substitution at position 838 (M838L) within the DD.

 

Please see the record xander for more information about Nfkb2.

Putative Mechanism

The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression. The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52 through IKK-1 and NIK, and results in the activation of p52/RelB heterodimers (2;4;5;7), and appears to be mostly restricted to a subset of tumor necrosis factor (TNF) receptors including lymphotoxin-β receptor (LTβR), B cell activating receptor (BAFFR), CD40, receptor activator of NF-κB (RANK) and TNF-related weak inducer of apoptosis (TWEAK) (8-12). These receptors are involved in secondary lymphoid organogenesis (SLO), B cell differentiation, survival and homeostasis, osteoclastogenesis, and angiogenesis (7). Mice homozygous for targeted null mutations of Nfkb2 exhibit absence of Peyer's patches (PPs) and reduced lymph nodes, increased susceptibility to certain pathogens, impaired B cell maturation, aberrant T cell function, and early postnatal mortality [reviewed by (13)]. They also exhibit disruption of splenic architecture that includes an absence of the splenic follicular marginal zone and marked depletion of B cell follicular areas or germinal centers (14-16).

 

Although Nfkb2 function is required for conventional B cell maturation, the analysis of xander mice and pale­­­_fire mice demonstrates that Nfkb2 is not required for peritoneal B cells. Instead, xander and pale_fire animals display increased numbers of B1 cells, a phenotype that is similar to that seen in alymphoplasia (aly) mice with a point mutation in NIK (17). The increased numbers of B1 cells in the peritoneum is suggested to arise from a migration defect in aly/aly peritoneal B cells caused by a defect in SLO chemokine receptor signaling (18). It is possible that NIK activation of NF-κB2 in response to chemokine receptor signaling plays a role in peritoneal B cell migration. 

Primers PCR Primer
pale_fire_pcr_F: GTTGAGAAGCCTGGTGGACACATAC
pale_fire_pcr_R: ACATTGGGGTTGCTGTACCGTAAG

Sequencing Primer
pale_fire_seq_F: CGGCAGTCTCCTTCGTAG
pale_fire_seq_R: ATTTGACCCACCGAGATGTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 654 nucleotides is amplified (chromosome 19, + strand):


1   gttgagaagc ctggtggaca catacaggaa gaccccgtct cccagcggca gtctccttcg
61  tagttacaag gtgaggcagc ctgtaccctg ccctgaagcc tgaaaccttg gcctctcaga
121 gttccctccc ccaccaagac tctctaaccc cacaccctaa gcatcactca gacctcctgt
181 cgccttttct cggcagctgg ctggtgggga cttggtgggt ctattggagg ccttgtctga
241 catgggtctc catgagggag tcaggctgct gaaaggtcct gagacccgcg acaagctgcc
301 cagcacaggt aaggacaacc accttggaag gtgtgtctgg gctgagggga gaaggcatga
361 ggcttgactc tcccctgttc cctagcagag gtgaaagaag acagtgccta tgggagccag
421 tcagtggagc aggaggcaga gaagctgtgt ccaccccctg agcctccagg agggctctgc
481 cacgggcacc cccagcctca ggtgcactga atggccccgg tcaacttcca cccagatccc
541 tctgtacagc atccctgtct aatcgaaatc ttatttaaac ctcaagccca catctcggtg
601 ggtcaaataa aggggaagac ccctccccaa cttacggtac agcaacccca atgt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsBruce Beutler