Phenotypic Mutation 'wabasha' (pdf version)
List |< first << previous [record 2 of 2]
Allelewabasha
Mutation Type nonsense
Chromosome7
Coordinate126,763,512 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Mapk3
Gene Name mitogen-activated protein kinase 3
Synonym(s) p44erk1, p44mapk, Prkm3, p44 MAP kinase, Mtap2k, Erk1, Esrk1, Erk-1
Chromosomal Location 126,759,601-126,765,819 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are hyperactive with impaired T cell maturation and proliferation. Mice homozygous for a knock-out allele on a CD-1 background exhibit normal Mendelian ratios, growth, and no obvious abnormalities. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011952; MGI:1346859

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000101969] [ENSMUSP00000051619] [ENSMUSP00000088880]
SMART Domains Protein: ENSMUSP00000101969
Gene: ENSMUSG00000063065
AA Change: K221*

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000051619
Gene: ENSMUSG00000063065
AA Change: K221*

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Blast:S_TKc 335 372 1e-15 BLAST
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000088880
Gene: ENSMUSG00000063065
AA Change: K106*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 213 2.5e-24 PFAM
Pfam:Pkinase 1 216 2.2e-58 PFAM
Pfam:APH 17 108 7.6e-7 PFAM
Blast:S_TKc 220 257 4e-16 BLAST
Predicted Effect probably null
Predicted Effect probably null
Predicted Effect probably benign
Meta Mutation Damage Score 0.594 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
NALP3 inflammasome signaling defect
NLRP3 inflammasome: low response
Candidate Explorer Status CE: excellent candidate; human score: 1; ML prob: 0.456
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(11) : Gene trapped(6) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mapk3 APN 7 126764774 nonsense probably null
IGL02412:Mapk3 APN 7 126763038 nonsense probably null
R0078:Mapk3 UTSW 7 126759805 missense probably damaging 1.00
R0532:Mapk3 UTSW 7 126763386 intron probably benign
R1549:Mapk3 UTSW 7 126763512 nonsense probably null
R2913:Mapk3 UTSW 7 126760806 nonsense probably null
R5220:Mapk3 UTSW 7 126764236 missense probably benign
R5408:Mapk3 UTSW 7 126763835 missense probably damaging 1.00
R5729:Mapk3 UTSW 7 126764807 missense probably benign 0.01
R5929:Mapk3 UTSW 7 126759858 unclassified probably benign
R6307:Mapk3 UTSW 7 126764282 missense probably benign 0.03
R6359:Mapk3 UTSW 7 126760756 missense probably benign
R7356:Mapk3 UTSW 7 126760915 critical splice donor site probably null
R7380:Mapk3 UTSW 7 126764795 missense
R7384:Mapk3 UTSW 7 126764291 missense
X0017:Mapk3 UTSW 7 126764248 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
MMRRC Submission 038193-MU
Last Updated 2019-09-04 9:46 PM by Peter Jurek
Record Created 2015-01-12 3:27 PM by Hexin Shi
Record Posted 2015-05-13
Phenotypic Description

Figure 1. Wabasha mice exhibited decreased secretion of interleukin (IL)-1β in response to priming with LPS followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The wabasha phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1549, some of which showed decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced secretion of IL-1β in response to LPS and nigericin treatment using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 58 mutations (X-axis) identified in the G1 male of pedigree R1549. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 58 mutations. The diminished IL-1β secretion phenotype was linked by continuous variable mapping to a mutation in Mapk3:  an A to T transversion at base pair 126,763,512 (v38) on chromosome 7, or base pair 4,114 in the GenBank genomic region NC_000073 encoding Mapk3. Linkage was found with a recessive model of inheritance (P = 2.484 x 10-5), wherein 6 variant homozygotes departed phenotypically from 11 homozygous reference mice and 4 heterozygous mice (Figure 2). A substantial semidominant effect was observed, but the mutation is preponderantly recessive.  The mutation corresponds to residue 681 in the mRNA sequence NM_011952 within exon 4 of 9 total exons.

 

666 ATCATGCTTAATTCCAAGGGCTACACCAAATCC

216 -I--M--L--N--S--K--G--Y--T--K--S-

 

Genomic numbering corresponds to NC_000077. The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine (K) 221 to a premature stop codon in the ERK1 (alternatively, p44) protein.

Protein Prediction

Figure 3. Domain structure of ERK1. The Wabasha mutation (red asterisk) results in substitution of Lys221 for a premature stop codon. Abbreviations: NTE, N-terminal extension; Gly, glycine-rich loop; ATP, ATP-binding site; Active, Active site; TXY, TXY motif.

Figure 4. Crystal structure of human ERK1. Cyan indicates the β-strands, pink indicates the α-helices, and green indicates the turn structures. The activation loop is dark gray and the L16 loop is indicated as blue. Figure was generated by UCSF Chimera and is based on PDB:2ZOQ and Kinoshita, T. et al. (2008).

ERK1 is a member of the mitogen-activated protein kinase (MAPK) family that also includes ERK2 (alternatively, p42), p38α/β/γ/δ, ERK5, and c-Jun N-terminal kinase (JNK)1-3 [Figure 3; (1)]. MAPKs are cytoplasmic serine/threonine kinases that transduce signals from the surface of the cell to the interior of the cell. ERK1 is 84% identical to ERK2 (2). Stimulation of the Ras-Raf-MEK signaling pathway results in parallel activation of ERK1 and ERK2 (3); however, the functions of ERK1 and ERK2 are not entirely redundant (4).

 

ERK1 has a small N-terminal lobe and larger C-terminal lobe connected by a hinge region [Figure 4; PDB:2ZOQ; (5)]. The small lobe is comprised of a 5-stranded antiparallel β-sheet (β1–β5) as well as an αC-helix (5;6). The small lobe contains a glycine (Gly)-rich (GxGxxG) ATP-binding loop (alternatively, the P-loop; amino acids 50-55 in mouse ERK1) that resides between the β1- and β2-strands. The Gly-rich loop positions the β- and γ-phosphates of ATP for catalysis, while the β1- and β2-strands protect the adenine component of ATP. C-terminal to the Gly-rich loop is a conserved valine residue (V57 in mouse ERK1) that forms a hydrophobic contact with the adenine of ATP. Within the β3-strand is an Ala-Xxx-Lys (AXK) sequence (amino acids 70-72 in mouse ERK1); the lysine within the AXK sequence (K72) couples the α- and β-phosphates of ATP to the αC-helix. Within the αC-helix, a conserved glutamate (E89 in mouse ERK1) forms a salt bridge with K72 within the AXK sequence. Formation of the salt bridge is essential for the formation of the activated “αC-in” conformation of ERK1 necessary for full kinase activity. The C-lobe of ERK1 is mostly α-helical with six conserved segments (αD-αI) (5;6). Four conserved β-strands (β6-β9) within the C-lobe contain catalytic residues that mediate the phosphoryl transfer from ATP to ERK1. ERK1 has a 17 amino acid insertion within the N-terminal extension and a 31 amino acid insertion within the kinase domain (kinase insert domain) that mediates signaling specificity and possibly differentiate it from ERK2.

 

All kinases have a K/D/D signature (K72/D167/D185 in mouse ERK1). The function of K72 was described, above. Asp167, within the catalytic loop, is essential for catalysis. Asp185 is the first residue of the activation segment (amino acids 185-215) and binds Mg2+ ions that subsequently coordinate the α-, β- and γ-phosphates of ATP. The activation segment is an essential regulatory element that mediates substrate binding and catalytic efficiency. Within the activation segment is the activation lip, which has both a threonine (T203) and a tyrosine (T205) phosphorylation site, designated as the TXY motif. The catalytic site of ERK1 resides in a cleft between the N- and C-lobes. In the catalytically inactive form, the lobes are in an open conformation, while in the active form, the lobes are in a closer, closed conformation. In the active state, the lobes are able to shift during the catalytic cycle to allow for ATP binding and subsequent ADP release (7). Upon binding of Mg2+ ions and the protein substrate, the closed form of the enzyme undergoes additional movements to bring ERK1 into a catalytically active state that allows for the phosphoryl transfer from ATP to the substrate.

 

ERK1 has three target binding sites on the surface of the protein: a D-site recruitment site (DRS; comprised of T160, T161, D319, D322, L116, L122, L158, H126, Y129), the F (alternatively, FXFP)-site recruitment site (FRS; comprised of Y234, L235, L238, Y264, M200, L201), and the Backside binding site (8). The DRS and FRS interact with the D-site and F-site on substrate proteins, respectively. ERK1 and ERK2 differ in the conformation of the β2–β3 turn in the Backside site: the β2–β3 turn of ERK1 is dislodged from the β4–β5 sheet consisting of the β4-strand and the β5-strand compared to that in ERK2.

 

Map3k undergoes alternative splicing to generate the ERK1c variant (9). ERK1c results from an insertion within intron 7 in human MAP3K that results in coding of a stop codon (9). ERK1c has 18 different C-terminal amino acids than ERK1 (9). Rat Map3k also undergoes alternative splicing to generate the ERK1b isoform (10). MEK1b (MEK1b results from alternative splicing of the gene encoding MEK1) and ERK1c are components of a noncanonical signaling pathway (11).  MEK1b/ERK1c signaling regulates mitotic Golgi fragmentation and mitosis progression. The mechanism of MEK1b activation is unknown (11).

 

The Wabasha mutation results in a substitution of lysine (K) 221 to a premature stop codon (*). Coding of a premature stop codon at 221 would result in the loss of the C-terminal residues of ERK1, including those that comprise the FRS. Expression and localization of ERK1Wabasha has not been examined.

Expression/Localization

ERK1 is ubiquitously expressed. ERK1 can localize to both the cytoplasm and the nucleus (12). In resting cells, cytoplasmic scaffold and anchoring proteins that associate with ERK1/2 keep the proteins in the cytoplasm [Table 1; (4)]. Some of the scaffolding and anchor proteins bind ERK1/2 in resting cells and are constitutively associated with ERK1/2 (e.g., MEK1/2) (4). Other proteins (e.g., KSR1/2) only associated with upon cellular stimulation. Upon growth factor stimulation, ERK1 binding to the scaffolds and anchors is reduced. Upon phosphorylation and dimerization of ERK1/2, ERK1/2 disassociates from MEK1 and ERK1/2 is able to translocate to the nucleus by both passive and active mechanisms (13). ERK1/2 is exported from the nucleus through a mechanism involving the receptor exportin-1 (14); unphosphorylated ERK1/2 can enter the nucleus through a direct interaction with nucleoporins (15;16). Interactions between ERK1/2 and cytoplasmic proteins prevent ERK1/2 interaction with nucleoporins and the subsequent entry into the nucleus.

 

Table 1. Select ERK1/2 scaffold and anchoring proteins

 

Protein

ERK1/2-related functions

References

Scaffolding proteins (binding to ERK1/2 is regulated by growth factor stimulation)

KSR1/2

Cell proliferation and oncogenic transformation

(17;18)

IQGAP1 (associates with ERK2)

Cell-cell adhesion, proliferation, differentiation, cytoskeletal architecture, transcription

(19)

MP1

Enhances ERK1-mediated activation of Elk1

(20)

MORG1

Stabilizes assembly of MP1, B-Raf, C-Raf, MEK1, MEK2, ERK1, ERK2 complex

(21)

β-Arrestin1/2

Desensitizes G-protein coupled receptors [e.g., angiotensin AT1A receptor and protease-activated receptor 2 (PAR2)] after stimulation; mediator of G-protein-independent signaling by functioning as a scaffold in Raf-MEK-ERK signaling

(22)

Sef

Inhibitor of fibroblast growth factor (FGF)-dependent MEK/ERK signaling; blocks ERK1/2 nuclear translocation by preventing the dissociation of MEK-ERK1/2

(23)

MEKK1

Cytoplasmic MAP3 kinase that phosphorylates MEK1/2

(24)

Paxillin

Focal adhesion protein that binds tyrosine kinases including Src and focal adhesion kinase (FAK), subsequently regulating cell spreading and growth

(25;26)

Anchoring proteins

MEK1/2

 

 

PTP-SL (STEP-like protein-tyrosine phosphatase)

 

(27)

Tubulin

 

(28)

Actin

 

(29)

Calponin

 

Vimentin

 

(30)

PEA-15

 

(31)

Abbreviations: KSR, kinase suppressor of Ras; MP1, MEK partner 1; MORG1, mitogen-activated protein kinase organizer 1; Sef, similar expression to fgf genes; MEKK1, mitogen-activated protein kinase (MAPK) kinase kinase 1; MEK1/2, MAP kinase 1 and 2

Background

MAPK signaling cascades have three components: a MAPK kinase kinase (MAP3K), a MAPK kinase (MAP2K), and a MAPK [reviewed in (32)]. Components either upstream [i.e., MAP3K kinases (MAP4Ks)] or downstream [i.e., MAPK-activated protein kinases (MAPKAPKs)] of the MAPK confer MAPK signaling specificity. The activated MAPK phosphorylates several substrates including transcription factors and phosphatases. Four MAPK pathways have been characterized including the ERK1/2, p38α-δ, JNK1-3, and ERK5 pathways.

 

Figure 5. ERK1/2 participates in several signaling pathways. (A) EGFR-dependent Ras activation. (B) TCR signaling pathway. (C) BCR-associated signaling pathway. (D) CCR7-associated signaling. (E) TPL2 functions as an ERK1/2 MAP3K downstream of TLRs. See the text for details about the functions of ERK1/2 in each of these signaling pathways.

ERK1/2 functions in the Ras-Raf-MEK-ERK signaling pathway. The Ras-Raf-MEK-ERK pathway regulates several processes including cell cycle progression, cell migration, adhesion, survival, differentiation, metabolism, proliferation, and transcription. ERK1/2 activation can be stimulated by several ligands/stimuli including, but not limited to, bradykinin, epidermal growth factor (EGF), fibroblast growth factor (FGF), insulin, insulin-like growth factor-1 (IGFL1), nerve growth factor (NGF), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), cytokines, Fas (see the record for cherry), tumor necrosis factor (TNF; see the record for PanR1), osmotic stress, T cell receptor (TCR) activation, and B cell receptor (BCR) activation (33;34).

 

Ligand stimulation of transmembrane receptor tyrosine kinases (RTKs) including the EGF receptor (EGFR; see the record for Velvet), the insulin receptor (INSR), IGFL1 receptor (IGF1R), platelet-derived growth factor receptor (PDGFR), and the VEGF receptor (VEGFR) result in receptor dimerization, autophosphorylation, and receptor activation [Figure 4A; (35;36). Trans-phosphorylation of receptor tyrosines creates binding sites for Src homology 2 (SH2) domain- and phosphotyrosine-binding (PTB) domain-containing proteins that recruit complexes that propagate downstream signaling. These proteins include the adapters Grb2 (growth factor receptor-bound protein 2), Nck, Crk, and Shc (Src homologous and collagen), phosphatases PTP-1B and SHP-1, tyrosine kinases Src and Abl, PLC-γ (see the record for queen), and p120RasGAP. Shc recruits Grb2 and the guanine nucleotide exchange factor (GEF) SOS1/2 (Son of Sevenless homolog 1/2) to the phosphorylated receptor. SOS1/2 subsequently mediates the activation of Ras (H-Ras, K-Ras, and N-Ras)-GDP to form RAS-GTP. Ras-GTP activates the Raf kinase family (A-, B-, and C-Raf), which phosphorylates the dual-specificity kinase MEK1/2. MEK1/2 subsequently phosphorylates ERK1/2 at Tyr204/187 (human ERK1/2), then Thr202/185 (human ERK1/2), activating ERK1/2. ERK1/2 can be dephosphorylated by MAPK phosphatases (MKPs) including PTP-SL, STEP, and HePTP (tyrosine-specific) and well as protein phosphatase 2A and 2C (serine/threonine-specific) and 10 dual specificity MKPs (DUSPs).

 

The Ras-Raf-MEK-ERK pathway is also downstream of the T cell receptor (Figure 4B). TCR activation recruits the tyrosine kinases Lck (see the record for iconoclast) and Fyn to the receptor complex where they phosphorylate immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 (see the record for murdock) and Syk (see the record for poppy), which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. Syk phosphorylates LAT and SLP-76 (37;38). Once phosphorylated, these two adaptors serve as docking sites and organize a number of effector molecules into the correct spatiotemporal manner to allow the activation of multiple signaling pathways. LAT binds to the adaptor proteins Grb2, Shc, and Grb2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1. SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1). This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways. Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of Ras. See the murdock record for a comprehensive discussion on TCR signaling.

 

Multiple downstream signaling pathways are activated by BCR stimulation and lead to a multitude of cellular responses (Figure 4C). Following aggregation and localization of BCR molecules, the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn; see the record for Lemon) and Syk. Activated Syk phosphorylates a number of downstream targets including BLNK, PLC-γ2 and protein kinase C β (PKCβ; see the record for Untied). BCR stimulation also activates PI3K. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-γ2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of PIP2 to IP3 and DAG. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades including JNK, p38 and ERK1/2. Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies. See the sothe record for a comprehensive discussion on BCR signaling.

 

In the case of G-protein coupled receptors (GPCRs) [e.g., bradykinin receptor and chemokine receptors (e.g., CCR7, see the record for lanzhou; Figure 4D], the receptor couples with a heterotrimeric G protein to mediate its downstream effects. In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated.  Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit.  GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and one that may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. Ligand-induced phosphorylation of the GPCR by G protein coupled receptor kinases (GRKs) leads to sequestration of the receptor from the cell surface thereby downregulating signaling. In the case of CCR7, binding of the chemokines CCL19/CCL21 to CCR7 activates the G-protein Gαi and the subsequent activation of Jak3 (see the record for mount_tai), PI3 kinase, and phospholipase C β2/β3, which trigger rapid calcium-flux and other downstream signaling molecules such as Src kinases and focal adhesion kinase (FAK), JNK, p38 MAPK, ERK1/2, and PI3K/Akt (39).

 

MEKK1, Mos, and TPL2 (alternatively, MAP3K8 or COT; see the record for Sluggish) can also function as ERK1/2 MAP3Ks in a cell type- or stimulation-specific manner (33;40). MEKK1 has been shown to interact with TRAF proteins and is implicated in TRAF-dependent signaling pathways (41). In B cells, CD40 (see the record for bluebonnet and walla) activation results in proliferation, differentiation, isotype switching, cytokine secretion, and germinal center formation (42). Upon CD40 activation, TRAF2, TRAF6, TRAF3 (see the record for hulk), cIAP1/2, UBC13, MEKK1 (mitogen-activated protein kinase (MAPK) kinase kinase), TAK1, and IKKγ are recruited to the cytoplasmic domain of CD40 (43). These proteins subsequently form two multiprotein complexes: one is composed of TRAF2, MEKK1, TRAF3, cIAP, UBC13 and IKKγ, while the other is composed of TRAF6, TAK1, TRAF3, cIAP, UBC13, and IKKγ (43;44). The TRAF2, UBC13, IKKγ complex activates the MEKK1 and MAPK cascades upon cIAP1/2-mediated degradation of TRAF3 (43). The degradation of TRAF3 upon K48-linked ubiquitination by cIAP1/2 facilitates the release of the MEKK1 signaling complex (containing IKKγ and UBC13) into the cytoplasm and the subsequent activation of MEKK1 and its downstream targets MAPKK4 and MAPKK7 (43;44).  TPL2 has been shown to activate the MEK/ERK pathway downstream of most TLRs [Figure 4E; (45;46)], although this can vary depending on cell type and stimulus (46;47).  Under basal conditions, TPL2 binds to NF-κB1 p105 (see the record for puff) and the A20 binding inhibitor of NF-κB activation (ABIN)-2, where it exists in a stable but inactive state (45;48-50). Upon TLR stimulation, both p105 and TPL2 are phosphorylated by the IKK complex, resulting in degradation of p105 and the release and activation of TPL2 (51).  Activated TPL2 phosphorylates MEK1/2 (MAP kinase 1 and 2), which then activates ERK1/2 (45;49).

 

ERK1/2 Substrates

ERK1/2 has broad substrate specificity and can phosphorylate several (175 substrates as of 2012) cytoplasmic and nuclear substrates that contain a Pro-Xxx-Ser/Thr-Pro sequence [Table 2; (26); reviewed in (32;52)]. Several ERK1/2 substrates have a D-docking site [(R/K)2–3-X2–6A-X-ΦB; Φ, hydrophobic residue], an F-docking site (FXFP or FXF), both sites, or neither site (53). For example, the D-docking site is found in several ERK1/2 targets including Elk1, PDE4E, MSK1, and RSK1-3 (53;54), while the F-site is found Elk1, c-Fos, KSR, and c-Raf (53).

 

Table 2. Select ERK1/2 substrates. See Lu et al. (52) for a comprehensive list of ERK substrates.

 

Target

Brief Description

Function

References

Nuclear substrates

Ets

Transcription factors

Promote transcription

 

c-Fos

(55)

c-Jun

(56)

STAT1 (see the record for domino), p53 (see the record for lentil [Trp53bp1])

 

Elk1

Induces expression of immediate early genes (e.g., c-Fos and c-Myc) that promote cell survival, cell division, and cell motility

(57)

PARP1

Enzyme that modifies proteins by poly ADP-ribosylation

Activated by direct interaction with ERK1/2, not phosphorylation; retains ERK1/2 in the nucleus

(58)

Cytoplasmic substrates

RSK family (RSK1–4, Mitogen- and stress-activated kinase 1 (MSK1), and MSK2)

MAPKAPKs in the Raf-MEK-ERK signaling cascade; RSK targets include CREB, serum response factor (SRF), estrogen receptor-α, nuclear factor-κB (NF-κB), nuclear factor of activated T cells 3 (NFAT3), TIF1A, S6, eukaryotic initiation factor 4B (eIF4B), Bcl-2-associated death promoter (Bad) and death-associated protein kinase (DAPK), and p27KIP

Cell growth, motility, proliferation, survival

(59)

PDE4, PLCγ (see the record for queen), SOS1, LAT

Signaling proteins

 

 

Bad and Caspase 9

Apoptotic proteins

Cell survival

(26;52)

S6K, Syk (see the record for poppy), FAK

Phosphatases

 

 

Cytoskeletal proteins

Palladin

Actin-binding protein activated in response to growth factor stimulation

Cell division, morphology, and motility

(60)

Myosin light chain kinase (MLCK)

 

Cell motility

(61)

Nuclear pore complex

Nucleoporins (Nup50, Nup153, and Nup214)

Proteins of the nuclear pore complex

Repressed nuclear accumulation of proteins that can be translocated

(62)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Human conditions associated with ERK1/2-associated signaling

The MAPK cascade activity is upregulated in several human cancers. For example, mutations in KRAS (63), NRAS (63), RAF (64;65), and BRAF (64;65) are linked to pancreatic, colorectal, melanoma, thyroid, and ovarian cancers. In addition to human cancers, Ras-Raf-MEK-ERK signaling is disrupted in several pathological conditions including cardiac hypertrophy, inflammation, diabetes, and brain injury (66).

Putative Mechanism

Mapk3-deficient (Mapk3-/-) mice are viable and fertile (67;68).  However, thymocyte maturation beyond the double positive (CD4+CD8+) development stage and CD3high thymocytes were reduced in the Mapk3-/- mice (68). Thymocytes from the Mapk3-/- mice exhibited reduced proliferation in response to antibody-induced TCR activation in the presence of phorbol myristate acetate (68). Mapk3-/- mice exhibited normal immune responses to ovalbumin indicating normal peripheral T cell function; however, the Mapk3-/- mice were susceptible to experimental autoimmune encephalomyelitis (EAE) (67). Nekrasova et al. observed normal numbers and distribution of peripheral CD4+ and CD8+ T cells, B cells, and macrophages in the Mapk3-/- mice (67). Pages et al. (68) and Nekrasova et al. (67) propose that ERK2 compensates for the loss of ERK1 function. 

 

Figure 5. Toll-like receptor 4 (TLR4) signaling pathways. Once TLR4 homodimers recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions. TLR4 signals through the MyD88-dependent pathway from the cell membrane to produce proinflammatory cytokines and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway to produce IFN. When bound to vesicular stomatitis virus glycoprotein G (VSV-G), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM.

The Wabasha mice exhibited reduced IL-1β in response to priming with LPS followed by nigericin treatment; however, no other overt phenotypes were observed. IL-1β secretion in response to LPS is induced by TLR4 signaling. Stimulation of TLR4 by LPS activates two branches of signaling, one defined by early NF-κB activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as interferon responsive factor (IRF)-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by Trif) [Figure 5; (69-71)]. Upon activation, the MyD88-dependent pathway proceeds by recruitment of MyD88 to the receptor, where it functions as an adapter to recruit IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6 (72;73). The ensuing signaling pathway culminates in the activation of NF-κB-dependent transcription. Briefly, IRAK-1 and TRAF6 dissociate from the receptor complex, and freed TRAF6 interacts with TAK1, activating it to phosphorylate the IκB kinase (IKK) complex. The IKK complex phosphorylates IκB, targeting it for degradation and relieving its inhibition of NF-κB which translocates to the nucleus and activates expression of target genes including interleukin (IL)-6, IL-1, TNF, IL-12p40 and type I interferon, cytokines required for the inflammatory response. The MyD88-independent pathway was evidenced by the intact (but slightly delayed) LPS-dependent activation of NF-κB, JNK and MAP kinases in MyD88-deficient macrophages (70). This pathway relies on the adapter Trif, and its hallmark is the production of type I IFN. Trif signals to TRAF3 and TBK1, both of which are required for IRF-3 activation and subsequent IFN induction downstream of TLR4 (74;75). The Wabasha phenotype points to a defect in TLR4 signaling, namely in IL-1 expression. The Wabasha phenotype may indicate that in Ras-dependent signaling pathways, ERK2 compensates for loss of ERK1Wabasha function.

Primers PCR Primer
wabasha_pcr_F: TAGCAAGAGCAGCCTTGGAACG
wabasha_pcr_R: TTTGGGACAGGCACCATATCCAAC

Sequencing Primer
wabasha_seq_F: CTTGGAACGTGGCAAGC
wabasha_seq_R: AGCCGAGGAAAACTCTACTCTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 402 nucleotides is amplified (chromosome 7, + strand):


1   tagcaagagc agccttggaa cgtggcaagc aagaacaaaa cagtcagggc aggggcactt
61  cctaggccgg ggaagccttg ggcaatgtag ttcagtggcc tgggtttgat tccagatctg
121 tgattttggc ctggcccgga ttgctgaccc tgagcacgac cacactggct ttctgacgga
181 gtatgtggcc acacgctggt accgagcccc agagatcatg cttaattcca aggtaggaga
241 gtttcccatg tctgcgaggg agtcctagag ccatctcagg gcctaggcac aatcccgctg
301 acccttgggc cttagcaaga tgtagagagt agagttttcc tcggctctgt cctctgccct
361 ttgctgtgtt agatctaagt tggatatggt gcctgtccca aa


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsBruce Beutler, Hexin Shi, Ying Wang, Zhao Zhang, Doan Dao, Lei Sun
List |< first << previous [record 2 of 2]