Phenotypic Mutation 'Park5'

• Allele: Park5
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 59,548,476 bp (GRCm38)
• Base Change: T ⇒ A (forward strand)
• Gene: Nlrp3
• Gene Name: NLR family, pyrin domain containing 3
• Synonym(s): Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
• Chromosomal Location: 59,541,568-59,566,956 bp (+)
• MGI Phenotype: Strain: 3686871; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008] ; PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Asparagine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000078440] [ENSMUSP00000098707] [ENSMUSP00000114231]
• AlphaFold: Q8R4B8
• SMART Domains: Protein: ENSMUSP00000078440; Gene: ENSMUSG00000032691; AA Change: I293N

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
  (Using ENSMUST00000079476)
• SMART Domains: Protein: ENSMUSP00000098707; Gene: ENSMUSG00000032691; AA Change: I293N

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
  (Using ENSMUST00000101148)
• SMART Domains: Protein: ENSMUSP00000114231; Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
Pfam:FISNA	135	173	1.6e-12	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9140
• Is this an essential gene?: Probably nonessential (E-score: 0.081)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Sperm
• MMRRC Submission: 038253-MU
• Last Updated: 2019-09-04 9:46 PM by Diantha La Vine
• Record Created: 2015-01-12 3:33 PM by Hexin Shi
• Record Posted: 2015-01-23
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Bruce Beutler, Hexin Shi, Ying Wang, Zhao Zhang, Doan Dao, Lei Sun

Accession Number

NCBI RefSeq: NM_145827; MGI:2653833

Alleles Listed at MGI

All mutations/alleles(17) : Chemically induced (ENU)(6) Targeted(11)

Phenotypic Description

Figure 1. Park5 mice exhibited decreased IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Park5 phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1622, some of which showed decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced IL-1β secretion after nigericin treatment using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R1622. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. The impaired NLRP3 inflammasome response was linked by continuous variable mapping to a mutation in Nlrp3:  a T to A transversion at base pair 59,548,476 (v38) on chromosome 11, or base pair 6,908 in the GenBank genomic region NC_000077.  Linkage was found with an additive model of inheritance (P = 3.476 x 10^-6), wherein five variant homozygotes and five heterozygotes departed phenotypically from five homozygous reference mice (Figure 2). The mutation corresponds to residue 1,104 in the mRNA sequence NM_145827 within exon 4 of 10 total exons.

 

1088 CGCAAGCCTTCCAGGATCCTCTTCCTCATGGAT 288  -R--K--P--S--R--I--L--F--L--M--D-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to asparagine (N) substitution at position 293 (I293N) in the NLRP3 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.991).

Protein Prediction

Figure 3. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT-associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The Park5 mutation results in an isoleucine to asparagine substitution at position 293. This image is interactive. Other mutations found in NLRP3 are noted in red. Click on each mutation for more specific information.

The Nlrp3 gene encodes a 1,033 amino acid protein that is a member of the nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) or CATERPILLER [for CARD, transcription enhancer, R(purine)-binding, pyrin, lots of leucine repeats] family [Figure 3; (1)]. NLRP3 has a C-terminal leucine-rich repeat (LRR) domain, a central oligomerization NACHT usually with a C-terminal extension known as the NACHT associated domain (NAD), and an N-terminal effector domain. The N-terminus of NLRP3 contains a pyrin domain (PYD). The Park5 mutation results in an isoleucine to asparagine substitution at amino acid 293; Iso293 is within the NBD domain.

 

For more information about Nlrp3, please see the record for ND1.

Putative Mechanism

NLRP3 is able to oligomerize through its NBD domain and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. A large variety of agents have been shown to activate the NLRP3 inflammasome, and NLRP3 plays an important role in the innate immune response. The phenotype of the Park5 mice suggests that the mutated protein, if expressed, is inactive or has reduced activity.

Primers

PCR Primer
Park5_pcr_F: GGCACTGGGAAAGCTCTTCAAAGAC
Park5_pcr_R: CCTTCCTTTTGGCCTCAGAGAAACC

Sequencing Primer
Park5_seq_F: CAAGGAGTCTAGCAGACCTGAT
Park5_seq_R: CTAGGATCTCCACATGGCG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 410 nucleotides is amplified (chromosome 11, + strand):

1   ggcactggga aagctcttca aagacaaatt tgactatttg ttctttatcc actgccgaga
61  ggtgagcctc aggacgccaa ggagtctagc agacctgatt gtcagctgct ggcctgaccc
121 aaacccacca gtgtgcaaga tcctgcgcaa gccttccagg atcctcttcc tcatggatgg
181 ctttgatgag ctacaagggg cctttgacga gcacattggg gaggtctgca cagactggca
241 aaaggctgtg cggggagaca ttctgctaag cagcctcatc cgaaagaaac tgctgcccaa
301 ggcctctctg ctcataacga cgaggccggt agccttggag aaactgcagc atctcctgga
361 ccacccccgc catgtggaga tcctaggttt ctctgaggcc aaaaggaagg 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.