Phenotypic Mutation 'lockdown' (pdf version)
List [record 1 of 4] next >> last >|
Allelelockdown
Mutation Type missense
Chromosome4
Coordinate129,558,127 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Lck
Gene Name lymphocyte protein tyrosine kinase
Synonym(s) Hck-3, p56
Chromosomal Location 129,548,344-129,573,641 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001162432, NM_010693, NM_001162433; MGI:96756

MappedYes 
Amino Acid Change Cysteine changed to Tyrosine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000066209] [ENSMUSP00000099656] [ENSMUSP00000119263] [ENSMUSP00000125777]
AlphaFold P06240
SMART Domains Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: C20Y

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000067240)
SMART Domains Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: C20Y

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000102596)
SMART Domains Protein: ENSMUSP00000119263
Gene: ENSMUSG00000000409
AA Change: C20Y

DomainStartEndE-ValueType
PDB:1Q69|B 7 33 9e-12 PDB
SCOP:d1awj__ 45 92 2e-8 SMART
PDB:1LCK|A 53 92 3e-20 PDB
Blast:SH3 64 92 4e-13 BLAST
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000134336)
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: C31Y

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000167288)
Meta Mutation Damage Score 0.9413 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: resistant day 10
DSS: sensitive day 7
FACS B:T cells - increased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased 8934570
FACS CD4+ T cells in CD3+ T cells - decreased 8934570
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
post-MCMV FACS CD4:CD8 - decreased
post-MCMV FACS CD4+ T cells - decreased 8934570
post-MCMV FACS CD4+ T cells in CD3+ T cells - decreased 8934570
post-MCMV FACS CD8+ T cells in CD3+ T cells - increased
post-MCMV FACS T cells - decreased 8934570
T-dependent humoral response defect- decreased antibody response to rSFV
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.955; ML prob: 0.932; human score: 1.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(24) : Chemically induced (ENU)(2) Gene trapped(15) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Lck APN 4 129558146 missense probably benign 0.00
IGL02666:Lck APN 4 129556419 missense probably damaging 0.98
iconoclast UTSW 4 129555604 missense probably damaging 1.00
stromberg UTSW 4 129555640 missense probably damaging 1.00
swan UTSW 4 129555640 missense probably damaging 1.00
R0091:Lck UTSW 4 129555681 missense possibly damaging 0.88
R0480:Lck UTSW 4 129555640 missense probably damaging 1.00
R1013:Lck UTSW 4 129558127 missense probably damaging 1.00
R1510:Lck UTSW 4 129555668 missense possibly damaging 0.92
R1569:Lck UTSW 4 129555656 missense probably damaging 0.98
R1845:Lck UTSW 4 129558086 missense probably benign 0.00
R2001:Lck UTSW 4 129548937 missense probably benign 0.00
R2141:Lck UTSW 4 129548920 missense probably damaging 1.00
R4694:Lck UTSW 4 129548972 missense possibly damaging 0.66
R4737:Lck UTSW 4 129555984 missense possibly damaging 0.93
R5706:Lck UTSW 4 129551638 critical splice acceptor site probably null
R5712:Lck UTSW 4 129556310 missense probably benign
R7023:Lck UTSW 4 129548865 missense possibly damaging 0.89
R7411:Lck UTSW 4 129551970 missense probably benign 0.02
Mode of Inheritance Autosomal Recessive
Local Stock gDNA
MMRRC Submission 038165-MU
Last Updated 2019-09-04 9:46 PM by Katherine Timer
Record Created 2015-01-22 2:51 PM by Tao Yue
Record Posted 2015-02-12
Phenotypic Description

Figure 1. Lockdown mice exhibit an increase in the B:T cell ratio in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine T and B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lockdown mice exhibit an decrease in the CD4+ to CD8+ T cell ratio in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ and CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Lockdown mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Lockdown mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ T cell in CD3+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Lockdown mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell in CD3+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Lockdown mice exhibit increased CD44 mean fluorescence intensity (MFI) on total T cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Lockdown mice exhibit increased CD44 mean fluorescence intensity (MFI) on CD8+ T cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The lockdown phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1013, some of which showed an increase in the B:T cell ratio (Figure 1), a decrease in the CD4+ to CD8+ T cell ratio (Figure 2) caused by a diminished frequency of CD4+ T cells (Figure 3) and CD4+ T cells in CD3+ T cells (Figure 4) coupled with an increased frequency of CD8+ T cells in CD3+ cells (Figure 5), all in the peripheral blood. Some mice also had an increase in the CD44 mean fluorescence intensity on total T cells (Figure 6) and on CD8+ T cells (Figure 7) in the peripheral blood.

Nature of Mutation

Figure 8. Linkage mapping of the normalized CD44+ MFI on peripheral CD8+ T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 35 mutations (X-axis) identified in the G1 male of pedigree R1013. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 35 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Lck:  a G to A transition at base pair 129,558,127 (v38) on chromosome 4, or base pair 15,515 in the GenBank genomic region NC_000070 encoding Lck. The strongest association was found with a recessive model of linkage to the normalized CD44+ MFI on peripheral CD8+ T cells, wherein five variant homozygotes departed phenotypically from five homozygous reference mice and 11 heterozygous mice with a P value of 5.847 x 10-6 (Figure 8). The mutation corresponds to residue 149 in the NM_001162432 mRNA sequence in exon 2 of 13 total exons, or at position 191 bp of the NM_001162433 mRNA sequence in exon 2 of 13 total exons, or at position 1,050 of the NM_010693 mRNA sequence in exon 1 of 12 total exons.

 

15499 GAGAACATTGACGTGTGTGAAAACTGCCACTAT

26    -E--N--I--D--V--C--E--N--C--H--Y- NP_001155904

20    -E--N--I--D--V--C--E--N--C--H--Y- NP_001155905

20    -E--N--I--D--V--C--E--N--C--H--Y- NP_034823

 

Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red lettering and results in a cysteine to tyrosine substitution at position 31 (C31Y) in the Lck protein isoform encoded by NM_001162432 and a cysteine to tyrosine substitution at position 25 (C25Y) in the Lck protein isoforms encoded by NM_001162433 and NM_010693.

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 9. The structure of Lck. A, Domain structure of Lck. The position of the lockdown mutation is indicated. B, 3D structure of inactive Src. The unique domain is not part of this structure. Image is interactive; click to see other Lck mutations. UCSF Chimera structure is based on PDB:2SRC, Xu et al, Mol. Cell 3, 629-638 (1999). Click on the 3D structure to view it rotate.

Lck encodes lymphocyte protein tyrosine kinase (Lck), a member of the Src family of nonreceptor tyrosine kinases (Figure 9). Lck is a protein of 56 kDa [also known as p56(lck)], and consists of 509 amino acids. Lck contains tandem Src-homology (SH) 3 and SH2 domains, which are separated by a short linker segment from a C-terminal tyrosine kinase domain terminating in a short C-terminal tail. The kinase domain of Src family kinases (amino acids 238-496 in Lck) consists of two lobes, designated the N- and C-lobes, linked by a flexible hinge. Unique to each Src family kinase is a 60-80 amino acid sequence at the extreme N-terminus, the structure of which is unknown. In Lck, the unique region (amino acids 1-62) functions to target the protein to the plasma membrane and/or lipid rafts through the attachment of fatty acid chains to select residues. The lockdown mutation lies within the unique domain. The effect of the mutation on kinase activity, expression level, or localization has not been tested.

 

Please see the record iconoclast for information about Lck.

Putative Mechanism

Lck functions in one of the first steps in T cell receptor (TCR) signaling, in which it phosphorylates the immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 heterodimer (CD3εγ or CD3εδ) and CD3ζ chains of the TCR. Recruitment of Lck to the TCR complex depends on association with CD4, which recognizes MHC class II, or CD8, which recognizes MHC class I (1). This event is necessary for the propagation of signals from the TCR. In animal models that are Lck-deficient or are transgenic for a dominant-negative form of Lck, severe combined immunodeficiency (SCID)-like phenotypes are observed. These animals demonstrate severe T cell developmental defects with pronounced thymic deficiency and a dramatic reduction in DP thymocytes, indicating a significant although incomplete block at the DN3 stage of development where pre-TCR signaling is required for further differentiation (2;3). Mature single-positive thymocytes are absent and peripheral T cells are much reduced. The lockdown mutation affects a cysteine residue in the unique domain and results in reduced protein function. However, some function may be retained, as the mature single-positive T cells in the periphery are not completely depleted. Fyn, another Src kinase may compensate to maintain T cell survival at the periphery (4).

Primers PCR Primer
lockdown_pcr_F: GGAGTGCTGCTATTTTCCAGAGCC
lockdown_pcr_R: GGAACCCAGTCAGGAGCTTGAATC

Sequencing Primer
lockdown_seq_F: CCAGAGCCTTTAGTTATGGTCC
lockdown_seq_R: TCAGGAGCTTGAATCCCACG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 464 nucleotides is amplified (chromosome 4, - strand):


1   ggaacccagt caggagcttg aatcccacga ttcagcgctt ctgtctgcgg ccaatggggg
61  cctctgagct gacgatctcg ggtacttttt gtaacttcca gaacagggct ctaggatgtc
121 tgatgttggg gcgagtggct taggggcagc tccttcaggc ctctctacat tccttcaggg
181 atcatgggct gtgtctgcag ctcaaaccct gaagatgact ggatggagaa cattgacgtg
241 tgtgaaaact gccactatcc catagtccca ctggacagca agatctcggt aagaggaaga
301 tgggattagt gaagggatgg gggccaggag ataggattgg tggagggatg ggggcggagg
361 acataagatt ggtgaaggga tggcatgggg ttgaaaggtt gtgtatccag gagaaaaaac
421 ctaaatggac cataactaaa ggctctggaa aatagcagca ctcc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsTao Yue, Duanwu Zhang, Bruce Beutler
List [record 1 of 4] next >> last >|