Phenotypic Mutation 'Guangzhou' (pdf version)
List |< first << previous [record 7 of 74] next >> last >|
AlleleGuangzhou
Mutation Type critical splice donor site (2 bp from exon)
Chromosome18
Coordinate37,896,093 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Diaph1
Gene Name diaphanous related formin 1
Synonym(s) Drf1, Dia1, D18Wsu154e, mDia1, Diap1, p140mDia
Chromosomal Location 37,843,601-37,935,476 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001305980 (variant 1), NM_007858 (variant 2), NM_001305981 (variant 3); MGI:1194490

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025337] [ENSMUSP00000078942] [ENSMUSP00000111292] [ENSMUSP00000111294] [ENSMUSP00000111297]
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS B1a cells in B1 cells - decreased
FACS CD4+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased
MCMV susceptibility
OVA-specific IgE - decreased
post-MCMV FACS CD4:CD8 - increased
post-MCMV FACS CD4+ T cells in CD3+ T cells - increased
post-MCMV FACS CD44+ CD4 MFI - decreased
post-MCMV FACS CD44+ CD8 MFI - increased
post-MCMV FACS CD44+ T MFI - increased
post-MCMV FACS CD8+ T cells in CD3+ T cells - decreased
post-MCMV FACS central memory CD4 T cells in CD4 T cells - increased
post-MCMV FACS central memory CD8 T cells in CD8 T cells - increased
post-MCMV FACS effector memory CD4 T cells in CD4 T cells - increased
post-MCMV FACS naive CD4 T cells in CD4 T cells - decreased
post-MCMV FACS naive CD8 T cells in CD8 T cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(112) : Gene trapped(107) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 37893348 critical splice donor site probably null
IGL01432:Diaph1 APN 18 37897504 missense unknown
IGL01646:Diaph1 APN 18 37893416 critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37856188 nonsense probably null
IGL01731:Diaph1 APN 18 37853709 critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37856208 missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 37890682 missense unknown
IGL02258:Diaph1 APN 18 37853330 missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37853600 missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37854573 missense possibly damaging 0.47
cucamonga UTSW 18 37896093 critical splice donor site
damselfly UTSW 18 37897550 nonsense probably null
devastator UTSW 18 37896093 critical splice donor site probably null
sheer UTSW 18 37896093 critical splice donor site probably null
R0137:Diaph1 UTSW 18 37891849 missense unknown
R0446:Diaph1 UTSW 18 37853590 missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37856500 missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 37905134 missense unknown
R1532:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1534:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1535:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1536:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1537:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1611:Diaph1 UTSW 18 37900702 missense unknown
R1756:Diaph1 UTSW 18 37854573 missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 37891018 missense unknown
R1812:Diaph1 UTSW 18 37891018 missense unknown
R2121:Diaph1 UTSW 18 37896389 missense unknown
R3710:Diaph1 UTSW 18 37845484 missense probably damaging 1.00
R3891:Diaph1 UTSW 18 37900638 splice site probably benign
R3892:Diaph1 UTSW 18 37900638 splice site probably benign
R4077:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37853551 missense probably damaging 1.00
R4815:Diaph1 UTSW 18 37895203 missense unknown
R5242:Diaph1 UTSW 18 37851635 missense probably damaging 1.00
R5294:Diaph1 UTSW 18 37897550 nonsense probably null
R5294:Diaph1 UTSW 18 37897580 missense unknown
R5349:Diaph1 UTSW 18 37891072 missense unknown
R5427:Diaph1 UTSW 18 37890595 missense unknown
R5623:Diaph1 UTSW 18 37896093 critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37855951 missense probably damaging 1.00
R5730:Diaph1 UTSW 18 37903776 missense unknown
R5767:Diaph1 UTSW 18 37853355 missense probably damaging 1.00
R5925:Diaph1 UTSW 18 37891935 missense unknown
R6151:Diaph1 UTSW 18 37853353 missense probably damaging 1.00
R6823:Diaph1 UTSW 18 37876383 intron probably null
R6876:Diaph1 UTSW 18 37896373 missense unknown
R6925:Diaph1 UTSW 18 37853679 nonsense probably null
R6983:Diaph1 UTSW 18 37889769 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock gDNA
Repository
Last Updated 2018-09-24 4:42 PM by Diantha La Vine
Record Created 2015-01-29 10:56 PM by Ming Zeng
Record Posted 2017-02-23
Phenotypic Description

Figure 1. Guangzhou mice exhibit increased expression of CD44 on T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Guangzhou mice exhibit increased expression of CD44 on CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Guangzhou mice exhibit increased expression of CD44 on CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Guangzhou mice exhibit increased frequencies of central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Guangzhou mice exhibit increased frequencies of central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Guangzhou mice exhibit increased frequencies of CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Guangzhou mice exhibit increased frequencies of CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Guangzhou mice exhibit reduced IgE secretion after ovalbumin-alum administration. ELISA was utilized to determine IgE concentration. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Guangzhou mice exhibit increased frequencies of effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized position-based superpedigree data from pedigrees R1534, R1535, and R1536 are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Guangzhou mice exhibit reduced frequencies of naïve CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized position-based superpedigree data from pedigrees R1534, R1535, and R1536 are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Guangzhou mice exhibit reduced frequencies of naïve CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized position-based superpedigree data from pedigrees R1534, R1535, and R1536 are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Guangzhou mice exhibit an increase in the CD4 to CD8 T cell ratio after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized position-based superpedigree data from pedigrees R1534, R1535, and R1536 are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Guangzhou mice exhibit an increased frequency of CD4+ T cells in CD3+ T cells after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized position-based superpedigree data from pedigrees R1534, R1535, and R1536 are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Guangzhou mice exhibit an reduced frequency of CD8+ T cells in CD3+ T cells after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized position-based superpedigree data from pedigrees R1534, R1535, and R1536 are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Guangzhou mice exhibit susceptibility to MCMV infection. Normalized position-based superpedigree data from pedigrees R1534, R1535, and R1536 are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Guangzhou phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1535, some of which showed increased expression of CD44 on T cells (Figure 1), CD4 T cells (Figure 2), and CD8 T cells (Figure 3). Some mice showed increased frequencies of central memory CD4 T cells in CD4 T cells (Figure 4), central memory CD8 T cells in CD8 T cells (Figure 5), CD44+ CD4 T cells (Figure 6), and CD44+ CD8 T cells (Figure 7). Some mice showed reduced secretion of IgE after ovalbumin-alum administration (Figure 8).

 

Position-based superpedigree analysis of three pedigrees (R1534, R1535, and R1536) from a common G0 male progenitor (U0546) identified additional phenotypes caused by the same Diaph1 mutation found in Guangzhou. The phenotypes include a slight increase in the frequency of effector memory CD4 T cells in CD4 T cells (Figure 9), a reduced frequency of naïve CD4 T cells in CD4 T cells (Figure 10), and a reduced frequency of naïve CD8 T cells in CD8 T cells (Figure 11) after mouse cytomegalovirus (MCMV) infection. In addition, some mice showed an increase in the CD4 to CD8 T cell ratio after MCMV infection (Figure 12), an increased frequency of CD4+ T cells in CD3+ T cells (Figure 13), and a reduced frequency of CD8+ T cells in CD3+ T cells after MCMV infection (Figure 14). Some mice exhibited susceptibility to MCMV infection (Figure 15).

Nature of Mutation

Figure 16. Linkage mapping of the reduced IgE secretion after ovalbumin-alum stimulation using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 82 mutations (X-axis) identified in the G1 male of pedigree R1535. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 17. A CRISPR-induced Diaph1 knockout mouse mimics the phenotypes observed in the Guangzhou mice. Several of the immune cell phenotypes were tested with the CRISPR-Diaph1 mouse. A representative scatter plot shows that loss of Diaph1 expression results in increased frequencies of effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 82 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Diaph1: a T to C transition at base pair 37,896,093 (v38) on chromosome 18, or base pair 39,542 in the GenBank genomic region NC_000084 within the donor splice site of intron 11. The strongest association was found with a dominant model of inheritance to the normalized amount of ovalbumin-specific IgE, wherein four variant homozygotes and 16 heterozygous mice departed phenotypically from nine homozygous reference mice with a P value of 2.258 x 10-5 (Figure 16). The other phenotypes observed in the Guangzhou mice linked to the mutation in Diaph1 with an additive model of inheritance.

 

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 119-nucleotide exon 11 (out of 28 total exons). Skipping of exon 11 would cause a frame-shifted protein product after amino acid 348 and premature termination after amino acid 348.

 

        <--exon 10    <--exon 11 intron 11-->      exon 12-->

    ……CAGGTGTTGCAG ……ATGGAGATGGA atatccttttatgac…… TGACTTTGGTGA……
345 ……-Q--V--L--Q- ……-M--E--M--D                   -*-

        correct        deleted                     aberrant

 
The donor splice site of intron 11, which is destroyed by the Guangzhou mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

 

The Diaph1 mutation was confirmed as causative of the immune cell phenotypes in a mouse model with CRISPR-mediated targeted disruption of Diaph1 (a representative scatter plot of the FACS effector memory CD4 T cells in CD4 T cells data is shown in Figure 17).

Protein Prediction

Figure 18. Domain and crystal structure of mDia1. (A) Dia consists of the formin homology domains 1 and 2 (FH1, FH2), Rho-binding domain (RBD), a Dia inhibitory domain (DID), dimerization domain (DD), a predicted coiled-coil region (CC) and a dia autoregulatory domain (DAD). The DID, DD, and CC are also referred to as FH3. The location of the Guangzhou mutation is indicated. This image is interactive; click to view other mutations in Diaph1. (B) Crystal structure of the tetrameric N+C mDia1 complex. Selected domains and subdomains are labeled. The crystal structure was generated by UCSF Chimera and is modeled after PDB:3O4X and Nezami et al (2010). Click to rotate the crystal structure.

Figure 19. Regulation of mDia1. (A) In the autoinhibited state, the C-terminal DAD interacts with the N-terminal FH3 domain. Binding to a GTP-bound Rho GTPase leads to relief of the autoinhibited state by a partial displacement of the DAD and formin activation. The proline-rich FH1 domains of the activated formin dimer recruits profilin–actin complexes in close proximity to the FH2 domain. G-actin molecules are polymerized to F-actin by the dimeric FH2 domain. 

Diaph1 encodes mammalian diaphanous-related formin 1 (mDia1; alternatively, mDia or Drf1), a member of the mDia family of formins. There are four subfamilies in the diaphanous-related formin family: the mDia proteins (i.e., mDia1, mDia2, and mDia3), Daam (Disheveled-associated activator of morphogenesis), FMNL (formin-like protein), and FHOD (FH1/FH2 domain-containing protein; FHOD1 and FHOD3).

 

mDia1 has several domains, including a GTPase-binding domain (GBD), a formin homology 3 (FH3; alternatively, diaphanous inhibitory domain [DID]) domain, a dimerization domain (DD), a coiled-coil, a FH1 domain, a FH2 domain and a diaphanous autoregulatory domain (DAD) (Figure 18A). The crystal structure of N-terminal (amino acids 131 to 458 [the FH3, DD, and CC domains]) and C-terminal (amino acids 736 to 1,200 [the FH2 and DAD domains]) fragments of mouse mDia1 has been solved (Figure 18B; PDB:3O4X; (1)). The FH1 domain was not crystalized, but is predicted to be unstructured. The N- and C-terminal fragments of mDia1 form a tetrameric complex composed of two interlocking N+C dimers ((DID-DD)4/(FH2-DAD)4). One N-terminal dimer is proposed to bind one C-terminal dimer through a dual FH3/DAD interaction. In the tetramer, the two FH2 domains form the two central layers and the N-terminal dimers pack on either side to form the outer layers. The structure is held together by the interactions of the FH3 domains of each dimer with the DAD domains of the more distal FH2 dimer. The FH2 domains are two rod-shaped domains connected head-to-tail by flexible linker segments. The dimer forms a ring. On each side of the FH2 dimer there is an elongated helical bundle containing the “knob” and “post” subdomains of one subunit and the “lasso” element of the adjoining subunit. The lasso of each subunit encircles the post of the other in a reciprocal manner to form the dimer. A flexible linker region follows the lasso, which leads to the knob subdomain. An α-helix (αT) that extends from the post of the FH2 domain and the DAD domain segment is connected to the end of helix αT by a 10-amino acid loop segment. There are two actin-binding surfaces: one on the knob subdomain and the other on the lasso/post. The knob actin-binding site is centered on Ile845 and the lasso/post site is on Lys994. The FH2 domains pack back-to-back, and the actin-binding surfaces face outward in the tetramer. The αT helices of each FH2 dimer extend diagonally between the bridge elements of the other FH2 dimer. The DID domain has five armadillo repeats; the fifth repeat connects to the DD through a long helix. The DD has a zig-zag of three helices from each subunit. The DAD domain has a core helical region.

 

The GBD mediates the interaction between mDia1 and Rho family proteins, subsequently promoting the localization of mDia1 to the membrane. The GBD and FH3 domains bind to the DAD domain to keep mDia1 in an inactive conformation (Figure 19) (2;3). Rho protein binding to the GBD facilitates the release of the DAD and allows the formin to nucleate. Also, unbranched actin filament elongation is induced (4;5). The FH1 domain is a proline-rich domain that binds the actin monomer-binding protein profilin as well as other ligands. The mDia1-profilin interaction mediates the recruitment of G-actin, subsequently accelerating the actin polymerization rate. The FH2 domain binds directly to G- and F-actin. In many formins, the FH2 domain nucleates actin and promotes actin filament elongation. The FH2 domain forms a doughnut-shaped head-to-tail dimer that is associated with the fast-growing actin filament barbed end (6). The FH2 domain is inhibited by the interaction between the FH3 and DAD domains. The DAD binds to actin monomers and, along with the FH2 domain, promotes nucleating actin assembly.

 

The Guangzhou mutation in intron 11 is predicted to result in skipping of the 119-nucleotide exon 11 and premature termination at amino acid 348, which is within the FH3/DID domain.

Expression/Localization

In humans, the DIAPH1 transcript was observed in all tissues; highest expression was observed in skeletal muscle. One study found that mDia1 is the sole mDia protein in T cells (7), wherein it localizes the leading edge of polarized T lymphoblasts (8). However, a second study found that all three mDia proteins were expressed in CD4+ T cells (9). All three of the mDia proteins are expressed in all dendritic cells populations (9).

 

In polarized T lymphoblasts, cultured fibroblasts, and sMDCK2 cells, mDia1 localizes to the leading edge and membrane ruffles (8;10). mDia1 also localizes to the mitotic spindle and midbody. Phospholipids regulate the localization and activity of mDia1. mDia1 binding to the lipid bilayer induces clustering of phosphatidylinositol-4,5-bisphosphate (PIP2) (11). After mDia1-induced clustering of PIP2, mDia1 subsequently inserts into the membrane bilayer. The interaction between mDia1 and phospholipids in the plasma membrane subsequently reduces the actin filament assembly activity of mDia1.

Background
Figure 20. mDia1 functions in actin nucleation and elongation. The FH2 domains of the formin dimer bind to actin monomers to initiate filament assembly. The FH1 domains of the formin dimer have short polyproline sequences that interact with profilin. Profilin binds to both formin and actin monomers to increase the addition of actin monomers to the barbed end of the filament. 

The formins are Rho effectors that direct actin assembly in several processes, such as cytokinesis, cell migration, and establishment and maintenance of cell polarity. mDia1 specifically functions in actin assembly, stress fiber and filopodia formation, phagocytosis, activation of serum response factor, and formation of adherens juctions (Figure 20). mDia1 has several functions in actin assembly, including regulating de novo nucleation, the rate of filament elongation, and filament growth duration before capping (12).

 

Immune cell-related functions of mDia1

In macrophages, mDia1 assists in CR3-mediated phagocytosis by an unknown mechanism (13). mDia1 is recruited early during CR3-mediated phagocytosis and colocalizes with polymerized actin in the phagocytic cup. Diminished mDia1 activity results in inhibition of CR3-mediated phagocytosis, but does not alter FcR-mediated phagocytosis. During macrophage migration and phagocytic cup formation, mDia1 interacts with the cytoskeletal scaffold protein IQGAP1 (14).

 

In natural killer (NK) cells, mDia1 functions in NK-mediated cytotoxicity (15). mDia1-deficient NK cells displayed defective target cell lysis due to alterations in the microtubule cytoskeleton such as targeting of microtubules to the lytic synapse.

 

mDia1 assists in T cell trafficking (7). After T cell activation, mDia1 expression is induced, subsequently regulating actin polymerization and cell migration (8). Expression of an activating mDia mutant inhibited spontaneous and chemokine-directed T cell motility and blocked CD3- and PMA-mediated cell spreading. Constitutive mDia activation resulted in increased levels of polymerized actin, and subsequently blocked chemokine-induced actin polymerization. Diaph1-deficient (Diaph1-/-) T cells displayed aberrant lymphocyte function-associated antigen 1 (LFA-1)-mediated T cell adhesion, migration and trafficking due to defects in microtubule polarization, stabilization, and microtubule dynamics (7;16).

 

Loss of mDia1 expression resulted in diminished chemoattractant-induced neutrophil actin polymerization, polarization, and directional migration with a concomitant impaired activation of RhoA, its downstream target p160-Rho-associated coil-containing protein kinase (ROCK), and the leukemia-associated RhoA guanine nucleotide exchange factor (LARG) (17).
 
Non-immune cell mDia1 functions
The Rho proteins are GTPases that regulate actin and microtubule dynamics, gene transcription, the cell cycle, and membrane trafficking. In non-immune cells, mDia1 functions as a RhoA and RhoB effector during adhesion, cytokinesis, cell polarity, morphogenesis, and Golgi complex architecture and dynamics (10;18;19). mDia1 cooperates with Memo (effector of the ErbB2 receptor tyrosine kinase) and RhoA to sustain cell motility by regulating the organization of the lamellipodial actin network, adhesion site formation, and microtubule outgrowth (20). During platelet spreading, mDia1 cooperates with RhoA and PI3-kinase to promote thrombin signaling to cytoskeletal remodeling (21). After thrombin stimulation, mDia1 translocates to the platelet cytoskeleton in a PI3K-dependent manner. mDia1 also regulates megakaryocyte protoplatelet formation by remodeling actin and microtubule cytoskeletons in a Rock (Rho-associated protein kinase)-dependent manner (22). mDia1 cooperates with ROCK to induce Rho-induced actin stress fiber formation and the regulation of actin fiber thickness and density (23). The mDia1-generated actin filaments direct exocrine secretory vesicles to the apical membrane (24).
 
mDia-mediated regulation of actin polymerization and assembly controls serum response factor activity (25) as well as oocyte meiotic maturation in the mouse (26). Reduced expression of mDia1 resulted in reduced polar body extrusion and reduced expression of profilin-1. Furthermore, reducing the expression of another formin family member, FMNL1, caused reduced expression of mDia1. Taken together, a FMNL1-mDia1-Profilin-1 signaling pathway exists in mouse oocytes to regulate meiotic maturation.
 
During malignant transformation, Rho-mDia1-associated signaling manipulates the actin cytoskeleton and targeting of Src to the cell periphery (27). mDia1 is required for inducing stable microtubules as well as upregulating glycogen synthase kinase 3 beta phosphorylation by novel PKCs (28). In dividing cells, mDia1 promotes PKD2 localization to mitotic spindles, subsequently positively regulating intracellular calcium release during mitosis (29). mDia1 controls the organization of E-cadherin-mediated cell-cell junctions (30). Diminished expression of mDia1 in human MCF7 epithelial cells disrupted adherens junctions. Furthermore, a constitutively active mDia1 did not localized to cell-cell junctions and did not strengthen the junctions.
 
mDia1 is required for efficient caveloar domain organization (31). Knockdown of mDia1 expression resulted in caveolae clustering and defective inward trafficking upon loss of cell adhesion. mDia1 functions with the actin regulator WAVE2 and IRSp53 to promote filopodia formation (32). During vascular remodeling, mDia1 promotes the membrane translocation of c-Src, subsequently resulting in Rac1 activation, redox phosphorylation of AKT/glycogen synthase kinase 3β, and smooth muscle cell migration (33).
 
mDia1 regulates Pax6-induced transcriptional activity and axonal pathfinding and it may act via Pax6 to modulate early neuronal development (34). mDia1 promotes the tangential migration of interneuron precursors (35). Diminished mDia1 expression in neuroblasts resulted in reduced separation of the centrosome from the nucleus and slowed nuclear translocation. The mDia1-deficient neuroblasts also showed impaired anterograde F-actin movement and F-actin condensation. Furthermore, loss of mDia1 expression resulted in reduced tangential migration of cortical and olfactory inhibitory interneurons.
 
mDia mouse models
Diaph1-/- mice are viable and fertile (7;36). The weight of the spleen and peripheral lymph nodes (axillary and inguinal lymph nodes) were lighter in the Diaph1-/- mice than that in wild-type littermates; the weight of the thymus was comparable between the Diaph1-/- and wild-type mice. Although the segregation of T and B cells in the spleen and lymph nodes were normal in the Diaph1-/- mice, the frequencies of both CD4 and CD8 T cells in the spleen and lymph nodes were reduced compared to wild-type mice. The frequencies of B cells, CD11c+ dendritic cells, and CD11b+ dendritic cells were not changed. The number of T cells was reduced in the peripheral blood; however, the numbers of CD4CD8, CD4+CD8+, CD4+CD8, and CD4CD8+ T cells in the thymus were similar to that in wild-type mice. The numbers of CD69loCD62Lhi CD4 or CD8 single-positive T cells was higher indicating that there was an impaired egression of mature T cells from the thymus in the Diaph1-/- mice. The CD4+CD8+, CD4+CD8, and CD4CD8+ T cells from the Diaph1-/- mice exhibited impaired chemotaxis toward CXCL12 and CCL21; B cell chemotaxis to CXCL12 was comparable in the Diaph1-/- mice to that in wild-type mice (7;36;37). In Diaph1-/- T cells, F-actin production and cell polarization were diminished. T cell proliferation after stimulation with CD3 antibodies and the T-dependent immune response were also impaired. Bone marrow-derived dendritic cell proliferation and maturation were normal in the Diaph1-/ mice (9). Also, the number and maturation of dendritic cells in the lymph nodes, spleen, and skin were comparable to that in wild-type mice. Adhesion and spreading of the bone marrow-derived dendritic cells was impaired in the Diaph1-/ mice. After CCL21 stimulation, cutaneous dendritic cell migration to draining lymph nodes as well as invasive migration and directional migration was diminished in the Diaph1-/ mice.
 
With age (greater than postnatal day 300), the Diaph1-/ mice often developed dermatoses and/or alopecia (36). In addition, the Diaph1-/ mice developed splenomegaly, fibrotic and hypercellular bone marrow, extramedullary hematopoiesis in both spleen and liver. Also, the Diaph1-/ mice had immature myeloid progenitor cells with high nucleus-to-cytoplasm ratios.
 
Human conditions

Mutations in human DIAPH1 have been linked to autosomal dominant deafness 1 (DFNA1; OMIM: #124900) (38).  DFNA1 is a fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. In addition, DIAPH1 mutations have also been linked to seizures, cortical blindness, microcephaly syndrome (SCBMS; OMIM: #616632) (39;40).

Putative Mechanism

The immune phenotypes observed in the Guangzhou mice indicate that mDia1Guangzhou exhibits loss of function.

Primers PCR Primer
Guangzhou(F):5'- ACTTGAATGACTGCCAGGGTGATG -3'
Guangzhou(R):5'- ACCTTTCCTTAGAGAGGCTGGACTG -3'

Sequencing Primer
Guangzhou_seq(F):5'- gcatcaaactcagaagagatcc -3'
Guangzhou_seq(R):5'- CAGCCCTGATCATCTCTGAG -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsMing Zeng, Xue Zhong, Tao Yue, Takuma Misawa, Duanwu Zhang, and Bruce Beutler
List |< first << previous [record 7 of 74] next >> last >|