Phenotypic Mutation 'shaky' (pdf version)
List |< first << previous [record 64 of 132] next >> last >|
Alleleshaky
Mutation Type nonsense
Chromosome6
Coordinate111,495,791 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Grm7
Gene Name glutamate receptor, metabotropic 7
Synonym(s) Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik
Chromosomal Location 110,645,581-111,567,230 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_177328; MGI:1351344

Mapped No 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000064404] [ENSMUSP00000133957] [ENSMUSP00000134635]
SMART Domains Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: K864*

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 3e-108 PFAM
Pfam:Peripla_BP_6 144 371 3e-11 PFAM
Pfam:NCD3G 519 569 1.2e-13 PFAM
Pfam:7tm_3 602 847 5.1e-59 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: K864*

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 1.7e-103 PFAM
Pfam:Peripla_BP_6 144 487 1e-12 PFAM
Pfam:NCD3G 519 569 1.2e-17 PFAM
Pfam:7tm_3 600 848 1.4e-87 PFAM
Predicted Effect probably null
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 176 4.9e-20 PFAM
Predicted Effect probably benign
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological
limbs/digits/tail phenotype
nervous system
Penetrance  
Alleles Listed at MGI

All mutations/alleles(6) : Gene trapped(1) Spontaneous(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Grm7 APN 6 111246184 missense probably benign 0.14
IGL02058:Grm7 APN 6 111358317 missense probably damaging 1.00
IGL02650:Grm7 APN 6 111358958 missense probably damaging 1.00
IGL02892:Grm7 APN 6 111254020 missense probably damaging 0.99
IGL03074:Grm7 APN 6 111495643 splice site probably null
IGL03185:Grm7 APN 6 110646222 missense possibly damaging 0.84
R0539:Grm7 UTSW 6 111359094 splice site probably benign
R0622:Grm7 UTSW 6 111358496 missense probably damaging 1.00
R1356:Grm7 UTSW 6 111359024 missense probably damaging 1.00
R1762:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1783:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1785:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1816:Grm7 UTSW 6 111495791 nonsense probably null
R1823:Grm7 UTSW 6 111207769 missense probably benign 0.17
R1864:Grm7 UTSW 6 111080423 missense probably benign 0.03
R1894:Grm7 UTSW 6 111358607 missense probably benign
R1987:Grm7 UTSW 6 110914511 missense probably damaging 1.00
R1993:Grm7 UTSW 6 111207808 missense probably benign 0.13
R2138:Grm7 UTSW 6 110646137 missense probably damaging 1.00
R2214:Grm7 UTSW 6 111358997 missense probably damaging 1.00
R2289:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2296:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2339:Grm7 UTSW 6 111495681 missense possibly damaging 0.64
R2847:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2849:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2879:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2884:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2921:Grm7 UTSW 6 111495905 splice site probably null
R2923:Grm7 UTSW 6 111495905 splice site probably null
R3014:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3015:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3703:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3713:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3963:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4009:Grm7 UTSW 6 111495722 missense probably damaging 1.00
R4091:Grm7 UTSW 6 110914340 missense probably damaging 1.00
R4131:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4132:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4161:Grm7 UTSW 6 111254020 missense probably damaging 0.99
R4329:Grm7 UTSW 6 110914364 missense probably damaging 1.00
R4357:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4359:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 111246374 missense probably benign 0.05
R4380:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4514:Grm7 UTSW 6 111358304 missense possibly damaging 0.81
R4518:Grm7 UTSW 6 110914546 splice site probably null
R4647:Grm7 UTSW 6 110914383 nonsense probably null
R4714:Grm7 UTSW 6 111080422 missense possibly damaging 0.52
R4775:Grm7 UTSW 6 110914371 missense probably damaging 1.00
R4957:Grm7 UTSW 6 111358863 missense probably damaging 1.00
R5056:Grm7 UTSW 6 111080443 missense probably damaging 0.99
R5062:Grm7 UTSW 6 110646136 missense probably damaging 1.00
R5256:Grm7 UTSW 6 111358221 missense probably benign 0.01
R5431:Grm7 UTSW 6 111358426 missense probably benign
R6026:Grm7 UTSW 6 111501539 nonsense probably null
R6174:Grm7 UTSW 6 111246297 missense probably benign
R6305:Grm7 UTSW 6 111358665 missense probably damaging 1.00
R6318:Grm7 UTSW 6 111358875 missense probably damaging 1.00
R6440:Grm7 UTSW 6 111254020 missense probably damaging 1.00
R6519:Grm7 UTSW 6 111207752 missense probably benign 0.00
R6531:Grm7 UTSW 6 111358425 missense probably benign 0.29
R6888:Grm7 UTSW 6 111358353 missense possibly damaging 0.79
R6949:Grm7 UTSW 6 110646304 missense probably benign 0.03
R6949:Grm7 UTSW 6 111495729 missense probably damaging 1.00
R6989:Grm7 UTSW 6 111207805 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 038207-MU
Last Updated 2018-05-22 9:38 AM by Anne Murray
Record Created 2015-02-25 11:55 AM by Jeff SoRelle
Record Posted 2015-06-18
Phenotypic Description

The shaky phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice in the pedigree R1816, some of which exhibited shaking behavior upon scruffing. Some mice also exhibited unilateral forepaw contractions that generalized and resolved within 30 seconds. In addition, the mice were hypersensitive to touch after the seizure when scruffing was attempted again for the next minute. After this episode, the seizure was unable to be provoked again.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 77 mutations. Among these, only one affected a gene (Grm7) with known neurological functions. The mutation in Grm7 was presumed to be causative because the shaky neurological phenotype mimics other mutant alleles of Grm7 (see MGI for a list of Grm7 alleles). The Grm7 mutation in shaky is an A to T transversion at base pair 111,495,791 (v38) on chromosome 10, or base pair 850,334 in the GenBank genomic region NC_000072. The mutation corresponds to residue 2,860 in the NM_177328 mRNA sequence in exon 9 of 10 total exons and residue 2,877 in the ENSMUST00000071076 cDNA sequence in exon 9 of 11 total exons.

 

850319  CGGAAGCGAAGCTTCAAGGCCGTAGTCACAGCA

859     -R--K--R--S--F--K--A--V--V--T--A-

 

Genomic numbering corresponds to NC_000076. The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine 864 (K864) for a premature stop codon (K864*) in all isoforms of the metabotropic glutamate receptor 7 (mGluR7) protein.

Protein Prediction
Figure 1. Domain structure of mGluR7a. mGluR7a is a G protein-coupled receptor with a signal peptide (SP), a ligand-binding domain (LBD), a Cys-rich domain (CYS), and seven transmembrane domains (TM). The locations of the PKC/CaM- and PICK1-binding regions are indicated. The location of the shaky mutation is shown with a red asterisk.
Figure 2. Crystal structure of the ligand-binding domain of rat mGluR1a. The two lobes, LB1 (N-terminal) and LB2 (C-terminal), are indicated. Figure was generated using UCSF Chimera and is based on PDB:1ISS
Figure 3. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, the GPCR undergoes conformational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.

mGluR7 is a class 3/C G-protein-coupled receptor (GPCR). Class 3 GPCRs include class B gamma-aminobutyric acid (GABAB) receptors, taste and pheromone receptors, and calcium-sensing receptor (CaR). Class 3 GPCRs have an N-terminal signal peptide (amino acids 1-34 in mGluR7), large extracellular ligand-biding domains (LBDs), a cysteine-rich domain (CRD), seven transmembrane domains, and a variable-length intracellular C-terminal tail (Figure 1) (1). mGluR7 is highly conserved whereby human mGluR7 shares 99.5% amino acid identity with rat mGluR7 (2).

 

The LBD of mGluR7 mediates homodimerization. The structure of the LBD of rat mGluR1 (designated m1-LBR; see the record for donald), another class 3 GPCR, in both an active (open/closed) and resting (open/open) form have been solved [PDB: 1ISS; (3)]. Both the active and resting m1-LBR structures were a homodimer connected via a disulfide bond between Cys140 from each monomer. The role of mGluR dimerization is unknown, but is proposed to modulate the proper folding of the mGluRs, permitting the proper function of the receptor. The LBD of mGluR1 forms two lobes [LB1 (N-terminal) and LB2 (C-terminal)] connected by three short loops and separated by a cavity where glutamate binds [Figure 2; PDB: 1ISS; (3-5)]. The relative positions of LB1 and LB2 define the open and closed states of the receptor. Glutamate binding results in closing of the N-terminal lobes around the ligand. The conformational change between the open and closed forms is a rotation about an axis that passes across the three connecting loops (3;6). Within the dimer, the two LB1 domains rotate by about 70° (3). In the open/closed active state, two molecules of glutamate bind each monomer through an interaction only with the LB1 interface. In the closed state, glutamate interacts with both LB1 and LB2; full mGluR1 activation requires glutamate binding to both subunits (7).

 

The mGluR7 LBD is separated from the transmembrane region by a cysteine (Cys)-rich region. The Cys-rich region is essential for proper folding and trafficking of mGluRs and is proposed to be a flexible spacer that allows for the displacement of the glutamate binding pocket towards the transmembrane domains (8-11).

 

The second cytoplasmic loop of mGluR7 mediates coupling to a heterotrimeric G protein, promoting its downstream effects. mGluR7 couples to Gi/o proteins to inhibit cyclic AMP (cAMP) formation and protein kinase A (PKA) activation (1).  G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [reviewed in (12)Figure 3].  In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated.  Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit. GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. 

 

The central portion (amino acids 883-912) of the C-terminus is essential for axonal targeting of mGluR7 (13). The C-terminus of mGluR7a also mediates protein-protein interactions (14-18). Protein interacting with C kinase (PICK1) is a PDZ domain-containing protein that interacts with the PDZ-binding motif at the extreme C-terminus of mGluR7 (aa 913-915) (16-18). PICK1 attenuates PKC-mediated phosphorylation of mGluR7. A knock-in mouse expressing mGluR7a with the PDZ-binding motif (-LVI) replaced by three alanines (-AAA; mGluR7aAAA/AAA) did not exhibit altered localization of mGluR7a (19). In addition, the mGluR7aAAA/AAA mice did not exhibit defects in motor coordination or pain sensitivity; however, the mice exhibited defects in spatial working memory (19). In the mGluR7aAAA/AAA mice, mGluR7a-mediated presynaptic inhibition was lost indicating that the PDZ-binding motif is essential for mGluR7a-mediated regulation of synaptic transmission. The G-protein βγ-subunits associate with amino acids 857-861 of mGluR7 (14). The calmodulin (CaM)-binding domain of mGluR7a (amino acids 864-876) can be phosphorylated by protein kinase C (PKC); PKC-mediated phosphorylation of mGluR7a inhibits the binding of CaM, while CaM binding prevents mGluR7 phosphorylation (14;15). The interaction between mGluR7, PICK1, and PKC may promote the PKC-dependent coupling of mGluR7 to the P/Q-type Ca2+ channels (18;20). The N- and P/Q-type Ca2+ channels mediate glutamate release in cerebrocortical nerve terminals. mGluR7 selectively blocks the P/Q-type Ca2+ channels at low (0.1 mM) extracellular calcium concentrations, but blocks N-type Ca2+ channels at 1.3 mM extracellular calcium concentrations (21;22).  Phosphorylation of mGluR7 by cAMP-dependent protein kinase (PKA) and cGMP-dependent protein kinase (PKG) can also inhibit the association between mGluR7 and CaM (23). PKC-, PKA-, or PKG-mediated phosphorylation of mGluR7 occurs at Ser862. Phosphorylation of Ser862 does not regulate mGluR7-mediated activation of the G protein-coupled inward rectifier potassium (GIRK) currents, indicating that another residue may also be required for kinase-mediated function. The serine/threonine protein phosphatase 1 (PP1) regulates the constitutive and agonist-induced dephosphorylation of Ser862 (24). PP1 inhibition resulted in increased Ser862 phosphorylation as well as increased mGluR7 surface expression.

 

Alternative splicing of Grm7 generates two isoforms of mGluR7: mGluR7a (915 amino acids) and mGluR7b (922 amino acids) that differ at their C-termini due to an out-of-frame insertion of 92 base pairs (25;26). The C-terminus of mGluR7b replaces the last 16 amino acids of mGluR7a with 23 distinct amino acids (25). The differences in the C-termini have no influence on G-protein coupling efficacy and specificity or in the efficacy to induce an inward reactivation of the current (26).

 

The mutation in the shaky mice results in substitution of lysine 864 (K864) for a premature stop codon in both mGluR7 isoforms. K864 is within the C-terminal tail of mGluR7 and is within the PKC/CaM-binding motif.

Expression/Localization

Within the hippocampus, Grm7 is expressed in pyramidal cells throughout the CA1-CA4 regions and in the granule cells of the dentate gyrus (1). Both the mGluR7a- and mGluR7b-encoding transcripts are expressed in the brain (e.g., hippocampus, hypothalamus, thalamus, superior and inferior colliculi, neocortex, olfactory bulb, olfactory cortex) as well as in other central nervous system regions (1;25;27;28); mGluR7a is expressed in more diverse areas than mGluR7b (27). mGluR7a and mGluR7b are expressed in axon terminals of both glutamatergic (e.g., mitral cells in the olfactory bulb, retinal ganglion neurons, and somatic sensory ganglion neurons) and GABAergic neurons (e.g., projection neurons of the striatum and Purkinje cells) (27). Within the CA3 area of the hippocampus, mGluR7 is expressed on mossy fiber terminals contacting interneurons (29) as well as in the perforant pathway and recurrent collateral axons of CA3 pyramidal cells (29). Purkinje cells of the cerebellum express Grm7, while mitral and tufted cells in the olfactory bulb express Grm7 (1;30). In humans and mouse, mGluR7 is also expressed in the hair cells and spiral ganglion cells of the inner ear (31) as well as in the colon mucosa (32). mGluR7 is primarily localized presynaptically in both glutamergic and GABAergic synapses (33-35).

Background
Figure 4. Glutamate-stimulated signaling through mGluR7 and mGluR1a. Upon presynaptic depolarization, Ca2+ enters the presynapse through voltage-gated Ca2+ channels (VGCCs) and induces glutamate release and CaM activation. Upon G-protein activation, PKC is recruited to mGluR7 through binding to PICK1. Activation of mGluR7 results in inhibition of adenylate cyclase activity (i.e., the formation of cAMP and ATP), the attenuation of N-type VGCCs, the activation of K+ channels, and the subsequent decrease in neurotransmitter (glutamate and GABA) release. See the text for more details about mGluR7-associated signaling. Upon stimulation by glutamate, mGluR1s in the post-synaptic membrane couple to multiple signaling pathways through different G proteins. Several second messenger systems are activated upon mGluR1 activation including PKB, PLCγ, PI3K/AKT/mTOR, IP3/DAG, NFκB and CaM. The C-terminus of mGluR1 interacts with Homer proteins, which facilitate the association of mGluR1 with IP3 receptors in the endoplasmic reticulum. Activation of these signaling pathways result in cell survival (PKC/PLD), proliferation (PKC/ERK1/2), learning, memory, and long-term potentiation (CaM), synaptic remodeling and plasticity (cAMP, PI3K/AKT/mTOR).See the record for donald for more details on the signaling pathways activated downstream of mGluR1a.

Glutamate is the major excitatory amino acid in the mammalian brain, mediating an estimated 50% of all synaptic transmission in the central nervous system [reviewed in (36)]. Glutamate is synthesized, stored, released from the presynaptic terminal, and acts through both ligand-gated ion channels (ionotropic glutamate receptors; see the record for swagger) and G-protein coupled receptors (mGluRs) on postsynaptic neurons [Figure 4; e.g., mGluR1 (see the record for donald); reviewed in (37)]. Activation of these receptors accounts for basal excitatory synaptic transmission and synaptic plasticity, such as long-term potentiation (LTP) and long-term depression (LTD) that are thought to underlie learning and memory. Glutamatergic synaptic transmission is implicated in nearly all aspects of normal brain function, including learning, memory, movement, cognition, and development. However, at elevated concentrations that excessively stimulate the same receptors, glutamate acts as a neurotoxin capable of causing extensive neuronal damage and death in the development and progression of several neurological disorders. Thus, the brain maintains very low intrasynaptic concentrations of glutamate by the action of glutamate transporters present in the plasma membrane of both glial cells and neurons.

 

The mGluRs transduce signals through increased ion flux and second messenger signaling pathways. The mGluRs are subdivided into three groups, designated group I, II, and III, according to agonist selectivity, coupling to different effector systems, and sequence homology. Group I includes mGluR1 and mGluR5; group II includes mGluR2 and mGluR3; and group III consists of mGluR4, mGluR6, mGluR7, and mGluR8. Group I mGluRs function in inositol phospholipid metabolism leading to increased levels of intracellular calcium, the activation of ryanodine-sensitive calcium stores (38;39), and alteration in the activity of voltage-gated channels (40-42). Both group II and III are negatively coupled to adenylate cyclase activity, leading to reduced production of cyclic AMP (cAMP) and often resulting in reduced transmitter release (43). All three mGluR groups mediate long-term synaptic plasticity including long-term potentiation and long-term depression (44;45).

 

At rest, mGluR7 clusters at the presynaptic active zones and associates with PICK1 (Figure 4). Upon presynaptic depolarization, Ca2+ enters the presynapse through voltage-gated Ca2+ channels (VGCCs) and induces glutamate release and CaM activation. Glutamate binding to mGluR7 induces the recruitment of the G-protein. Upon G-protein activation, PKC is recruited to mGluR7 through binding to PICK1, facilitating mGluR7 and PICK1 phosphorylation. In the absence of PKC activation, the Gβγ displaces from mGluR7 through Ca2+-activated CaM or by PKC-induced phosphorylation of Ser862, subsequently leading to downregulation of VGCCs. Activation of mGluR7 results in inhibition of adenylate cyclase activity (i.e., the formation of cAMP and ATP), the attenuation of N-type VGCCs, the activation of K+ channels, and the subsequent decrease in neurotransmitter (glutamate and GABA) release (39;46). Suppression of VGCCs results in PKC- and PICK1-dependent inhibition of synaptic transmission (47;48). mGluR7 has low affinity for glutamate and may remain inactive during normal neurotransmission, but function as a backup receptor to inhibit glutamatergic transmission in pathophysiological conditions and/or when there is excessive glutamate release (1;49).

 

mGluR7 is essential for the regulation of GABA-glutamate balance in the central nervous system. mGluR7 expressed on GABA-releasing neurons inhibits the release of GABA (50;51). GABA is the primary inhibitory neuromodulator. Several proteins in GABAergic neurons are essential for the synthesis of the vesicular and cytoplasmic pools of glutamate from GABA (e.g., glutamic acid decarboxylase [GAD] expressed as two isoforms, GAD65 and GAD67) as well for the synthesis of proteins that function in synaptic transmission and plasticity (e.g., the extracellular matrix protein reelin) (52). The expression of GAD65 mRNA and protein in the CA region of the hippocampus of Grm7-deficient (Grm7-/-) mice was reduced compared to wild-type mice (52). In addition, the GAD67 mRNA and protein was reduced in the CA and dentate gyrus regions of the hippocampus in the Grm7-/- mice compared to wild-type mice (52). Reelin expression was significantly increased in the hippocampus of the Grm7-/- mice compared to that in wild-type mice. Taken together, mGluR7 regulates synthesis of both the neurotransmitter (via GAD65) and metabolic pool (via GAD67) of GABA and putatively the level of GABA.

 

In prefontal cortex pyramidal neurons, mGluR7 inhibits N-methyl-D-aspartic acid receptor (NMDAR)-mediated currents (53). NMDAR is an ionotropic glutamate receptor that can function as an ion channel to allow sodium, calcium, and potassium ions to flow through the membrane when activated. The NMDAR is essential for the regulation of synaptic plasticity and memory and NMDAR dysregulation has been associated with the pathophysiology of mental illness.

 

In the mouse colon, mGluR7 activation results in increased colonic secretory function (32). Treatment with AMN082, a selective mGluR7 agonist, promoted calcium signaling in a subset of submucosal neurons as well as fecal water content upon stress and electrolyte secretion (32).

 

In humans, GRM7 is proposed to be a risk factor for alcoholism (54) as well as a putative gene associated with schizophrenia susceptibility (55). Mutations in GRM7 have been linked to susceptibility to age-related hearing loss in a European cohort (31;56). In the inner ear, mGluR7 is proposed to regulate glutamate synaptic transmission in the cochlea at the synapses between hair cells and the dendrites of afferent auditory nerve fibers.

Putative Mechanism

The loss of mGluR7 expression and/or function results in altered synaptic transmission in the amygdala and hippocampus, subsequently leading to cognitive defects. Grm7-/- mice display delayed learning curves (57), impaired short-term working memory (57-59), increased seizure susceptibility (60), diminished fear responses (e.g., reduced fear-related freezing responses induced by electric shock) (33;57;61;62), dysregulated stress responses (63), diminished anxiety and depression (i.e., the mice exhibited an antidepressant-like effect in the forced swim test and tail suspension test) (64;65), and diminished conditioned taste aversion [i.e., failure to associate taste (saccharin) with a negative stimulus (an injection of toxic LiCl)] (33). The Grm7-/- mice did not exhibit defects in pain sensitivity, locomotor activity, taste preference, or sensitivity to LiCl toxicity (33). In Grm7-/- mice, long-term potentiation could be induced, but short-term potentiation was attenuated. In addition, the frequency facilitation was altered and the post-tetanic potentiation was reduced (66). Grm7-/- mice over 12 weeks of age developed epilepsy; mice younger than 12 weeks of age appeared normal (33). Treatment of the 12 week old (or older) Grm7-/- mice with sub-threshold doses of two convulsant drugs (pentylenetetrazole (PTZ) and bicuculline) induced seizures; Grm7+/- mice did not have seizures (60).

 

Small-interfering RNA (siRNA)-mediated knockdown of Grm7 in the mouse brain resulted in reduced anxiety-like behavior, attenuated stress-induced hyperthermia, and a reduced acoustic startle response (67). Behavioral changes were not observed among the siRNA-treated Grm7 mice in the forced swim test compared to wild-type mice. In addition, the siRNA-induced Grm7 mice did not exhibit an epilepsy-prone phenotype in contrast to Grm7-/- mice (67).

 

Similar to the Grm7-/- mice, the shaky mice exhibit increased seizure susceptibility, indicating impaired function of mGluR7shaky. Other mGluR7-associated functions have not been assessed in the shaky mice.

Primers PCR Primer
shaky(F):5'- TTTAAGTATTCACACCCTATCTGCGG -3'
shaky(R):5'- AGCTTACTCCACAGAGCAGC -3'

Sequencing Primer
shaky_seq(F):5'- ACACCCTATCTGCGGTCATTG -3'
shaky_seq(R):5'- GCAACACACATCCCACTTTCTACAG -3'
References
  36. Rousseaux, C. G. (2008) A Review of Glutamate Receptors I: Current Understanding of their Biology. J Toxicol Pathol. 21, 25-51.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Jianhui Wang
List |< first << previous [record 64 of 132] next >> last >|