Phenotypic Mutation 'buckeye'

• Allele: buckeye
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 94,341,087 bp (GRCm38)
• Base Change: C ⇒ T (forward strand)
• Gene: Adamts20
• Gene Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
• Synonym(s): ADAMTS-20, bt
• Chromosomal Location: 94,270,163-94,465,418 bp (-)
• MGI Phenotype: FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016] ; PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
• Mapped: No
• Amino Acid Change: Serine changed to Asparagine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000036330] [ENSMUSP00000121696]
• AlphaFold: P59511
• SMART Domains: Protein: ENSMUSP00000036330; Gene: ENSMUSG00000022449; AA Change: S750N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	186	1.4e-30	PFAM
Pfam:Reprolysin_5	253	445	3.6e-13	PFAM
Pfam:Reprolysin_4	253	460	1.1e-7	PFAM
Pfam:Reprolysin	255	464	1.5e-26	PFAM
Pfam:Reprolysin_2	272	454	1.8e-10	PFAM
Pfam:Reprolysin_3	276	410	5.8e-10	PFAM
TSP1	556	608	7.73e-11	SMART
Pfam:ADAM_spacer1	718	836	2.6e-34	PFAM
TSP1	846	901	1.47e-1	SMART
TSP1	904	958	2.83e0	SMART
TSP1	965	1019	4.28e-4	SMART
TSP1	1020	1074	1.89e-5	SMART
TSP1	1075	1131	4.87e-8	SMART
TSP1	1152	1201	6.05e-4	SMART
TSP1	1204	1260	1.22e-8	SMART
TSP1	1304	1356	1.37e-2	SMART
TSP1	1357	1411	6e-8	SMART
TSP1	1416	1470	1.69e-2	SMART
TSP1	1471	1526	2.3e0	SMART
TSP1	1530	1579	1.23e0	SMART
TSP1	1653	1706	5.27e-4	SMART
Pfam:GON	1708	1905	5.8e-80	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000035342)
• SMART Domains: Protein: ENSMUSP00000121696; Gene: ENSMUSG00000022449; AA Change: S750N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Pep_M12B_propep	40	186	1e-31	PFAM
Pfam:Reprolysin_5	253	445	2.7e-13	PFAM
Pfam:Reprolysin_4	253	460	7.2e-8	PFAM
Pfam:Reprolysin	255	464	2.4e-28	PFAM
Pfam:Reprolysin_2	272	454	4e-10	PFAM
Pfam:Reprolysin_3	276	410	1.1e-10	PFAM
TSP1	556	608	7.73e-11	SMART
Pfam:ADAM_spacer1	718	836	2e-34	PFAM
TSP1	846	901	1.47e-1	SMART
TSP1	904	958	2.83e0	SMART
TSP1	965	1019	4.28e-4	SMART
TSP1	1020	1074	1.89e-5	SMART
TSP1	1075	1131	4.87e-8	SMART
TSP1	1152	1201	6.05e-4	SMART
TSP1	1204	1260	1.22e-8	SMART
TSP1	1304	1356	1.37e-2	SMART
TSP1	1357	1411	6e-8	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000155907)
• Meta Mutation Damage Score: 0.7698
• Is this an essential gene?: Probably nonessential (E-score: 0.170)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 038180-MU
• Last Updated: 2021-10-19 1:30 PM by Diantha La Vine
• Record Created: 2015-03-03 5:16 PM by Jeff SoRelle
• Record Posted: 2015-03-31
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle

Accession Number

NCBI RefSeq: NM_177431, NM_00164785, NM_00164786; MGI:2660628

Alleles Listed at MGI

All mutations/alleles(19) : Chemically induced (ENU)(6) Radiation induced(1) Spontaneous(11) Targeted(1)

Phenotypic Description

Figure 1. Phenotype of the buckeye mice.

The buckeye phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R1809, some of which exhibit a variable belted phenotype (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 112 mutations. Among these, only one affected a gene with known effects on pigmentation, Adamts20. The mutation in Adamts20 was presumed to be causative because the buckeye piebald spotting phenotype mimics other known alleles of Adamts20 (see MGI for a list of Adamts20 alleles). The Adamts20 mutation is a G to A transition at base pair 94,341,087 (v38) on chromosome 15, or base pair 124,341 in the GenBank genomic region NC_000081. The mutation corresponds to residue 2,510 in the mRNA sequence NM_177431 (isoform 1) within exon 16 of 39 total exons and residue 2,510 in the mRNA sequence NM_00164785 (isoform 2) within exon 16 of 28 total exons.

 

124325 GAAATCCTTCAGCACAGCTATTCTGGAAGACCA 745    -E--I--L--Q--H--S--Y--S--G--R--P-

 

Genomic numbering corresponds to NC_000081. The mutated nucleotide is indicated in red. The mutation results in a serine (S) to asparagine (N) substitution at position 750 (S750N) in both Adamts20 protein variants, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.999).

Protein Prediction

ADAMTS-20 is a 1906 amino acid protein that is a member of a large family of secreted zinc-dependent metalloproteases known as the ADAMTS (a disintegrin and metalloprotease domain, with thrombospondin type-1 repeats) family (Figure 2). ADAMTS-20 has an N-terminal signal peptide and a propeptide domain which contains three conserved Cys residues and ends in a basic region (aa 246-259). Following the prodomain, ADAMTS-20 contains the zinc-coordinating catalytic sequence HELGHVFNVPHD (aa 399-410) that is closely related to sequences found in metalloproteases. The catalytic domain of ADAMTS20 is followed by a disintegrin-like domain similar in size and structure amongst all ADAMTS proteins (76 residues) and includes eight conserved Cys residues. The disintegrin domain precedes a single thrombospondin type I repeat (TSP1) which is well-conserved and similar to a domain in Thrombospondin I. The first TSP1 repeat is followed by a cysteine (Cys)-rich domain that has ten conserved Cys residues as well as a spacer characteristic of ADAMTS family members. The spacer domain contains a putative sequence for glycosaminoglycan attachment and may be important in substrate recognition and ECM association (1;2). C-terminal to the spacer region, ADAMTS proteins have a highly variable number of TSP1 repeats. The full-length ADAMTS-20 protein contains fourteen of these motifs with linker sequences between the fifth and sixth repeat and the seventh and eighth repeat. The smaller splice variant for mouse ADAMTS-20 contains 9 instead of 14 TSP1 motifs at the C-terminal domain while the human splice variant contains 11 instead of 14 TSP1 domains (1;3-5). The buckeye mutation (S750N) is within the spacer domain of both splice variants.

 

Please see the record for splotch2 for more information about Adamts20.

Putative Mechanism

The ADAMTS proteins are predicted to interact with the extracellular matrix (ECM) and play a wide role in normal and pathological processes (1;3). White-spotting mutants are often the result of improper melanoblast development or survival. The lack of pigment in the adult reflects the absence of mature melanocytes in that area due to defects at various stages of melanocyte development including proliferation, survival, migration, invasion of the integument, hair follicle entry and melanocyte stem cell renewal (6;7). Adamts20 is the gene mutated in belted and splotch2 mutant mice. Belted animals exhibit a mostly pigmented coat except for a region near the hindlimbs that resembles a belt (8). At least fifteen different belted alleles are in existence and four of these, including splotch2, have been sequenced. Two of the three previously described mutations result in single amino acid changes either in the Cys-rich domain or one of the C-terminal TSP1 repeats. The third mutation generates a premature stop codon, resulting in truncation of the protein and loss of eight C-terminal TSP1 domains. Deficient ADAMTS-20 activity may cause loss of melanoblast entry into the hair follicles (3). ADAMTS-20 may degrade specific peptide substrates, either ECM components or signaling molecules, and this degradation could be necessary for melanoblast migration to the proper areas. Examination of ADAMTS-20 function during melanoblast development determined that mice with mutations in Adamts20 had a normal distribution of melanoblasts during embryogenesis suggesting that melanoblast migration is normal in these animals. The phenotype of the buckeye mice resembles those of other Adamts20 alleles indicating that the mutation results in impaired ADAMTS-20 function.

Primers

PCR Primer
buckeye_pcr_F: GCCAAAGAGTACTACCATGAACATTAG
buckeye_pcr_R: GAGCTTTGTGCAATAGTGAGC

Sequencing Primer
buckeye_seq_F: AACTAAAAATTCTCCCCGTTATTCC
buckeye_seq_R: GTGCAATAGTGAGCTTATTGCAATAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

 

The following sequence of 485 nucleotides is amplified (chromosome 15, - strand):

 

 

1   gagctttgtg caatagtgag cttattgcaa tagtgatact ttggggagtt cgaagattgg
61  ggatgaaagg ggcaaagaac tacatttaca gttttgtgag attttctgct tgcaaatcta
121 ttttgcaggt tacaatgtgg ttgtaaagat ccctgcgggg gctacaaaca ttgaaatcct
181 tcagcacagc tattctggaa gaccagaaga tgacaactat ctcggtaagc aaccgtggtg
241 tatgtctgcc tcaggtgcaa actgttggac atctgtggtt gaggtagctc tgtctacaca
301 aagtatattt aagctacaca caatatatcc tttttagaaa gaaaaaaagg aataacgggg
361 agaattttta gtttttgttt ttcattatag tatcttaggt aaccaaatgt ttagtcaatt
421 aaaattgcat gcatattcgg aataaatttc tcttctctct aatgttcatg gtagtactct
481 ttggc

 

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Tang, B. L. (2001) ADAMTS: A Novel Family of Extracellular Matrix Proteases. Int J Biochem Cell Biol. 33, 33-44.

  2. Somerville, R. P., Longpre, J. M., Jungers, K. A., Engle, J. M., Ross, M., Evanko, S., Wight, T. N., Leduc, R., and Apte, S. S. (2003) Characterization of ADAMTS-9 and ADAMTS-20 as a Distinct ADAMTS Subfamily Related to Caenorhabditis Elegans GON-1. J Biol Chem. 278, 9503-9513.

  3. Rao, C., Foernzler, D., Loftus, S. K., Liu, S., McPherson, J. D., Jungers, K. A., Apte, S. S., Pavan, W. J., and Beier, D. R. (2003) A Defect in a Novel ADAMTS Family Member is the Cause of the Belted White-Spotting Mutation 1. Development. 130, 4665-4672.

  4. Llamazares, M., Cal, S., Quesada, V., and Lopez-Otin, C. (2003) Identification and Characterization of ADAMTS-20 Defines a Novel Subfamily of Metalloproteinases-Disintegrins with Multiple Thrombospondin-1 Repeats and a Unique GON Domain 1. J Biol Chem. 278, 13382-13389.

  5. Cal, S., Obaya, A. J., Llamazares, M., Garabaya, C., Quesada, V., and Lopez-Otin, C. (2002) Cloning, Expression Analysis, and Structural Characterization of Seven Novel Human ADAMTSs, a Family of Metalloproteinases with Disintegrin and Thrombospondin-1 Domains. Gene. 283, 49-62.

  6. Baxter, L. L., Hou, L., Loftus, S. K., and Pavan, W. J. (2004) Spotlight on Spotted Mice: A Review of White Spotting Mouse Mutants and Associated Human Pigmentation Disorders 1. Pigment Cell Res. 17, 215-224.

  7. Bennett, D. C., and Lamoreux, M. L. (2003) The Color Loci of Mice--a Genetic Century. Pigment Cell Res. 16, 333-344.

  8. Murray, J. M., and Snell, G. D. (1945) Belted, A New 6Th Chromosome Mutation in the Mouse. J Hered. 36, 266-268.