Phenotypic Mutation 'crawler'

• Allele: crawler
• Mutation Type: nonsense
• Chromosome: 6
• Coordinate: 64,406,678 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Grid2
• Gene Name: glutamate receptor, ionotropic, delta 2
• Synonym(s): tpr, B230104L07Rik, GluRdelta2
• Chromosomal Location: 63,232,860-64,681,307 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014] ; PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000093536]
• AlphaFold: Q61625
• SMART Domains: Protein: ENSMUSP00000093536; Gene: ENSMUSG00000071424; AA Change: Y679*

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, gDNA
• MMRRC Submission: 038228-MU
• Last Updated: 2019-09-04 9:46 PM by Anne Murray
• Record Created: 2015-03-10 7:11 PM by Jeff SoRelle
• Record Posted: 2016-12-01
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008167; MGI: 95813

Alleles Listed at MGI

All Mutations and Alleles(34) : Chemically induced (ENU)(2) Gene trapped(2) Spontaneous(22) Targeted(6) Transgenic(2)

Phenotypic Description

Figure 1. Phenotype of the crawler mice.

The crawler phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1572, some of which exhibited ataxia and an abnormal gait (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 120 mutations. Among these the mutation in Grid2 was presumed to be causative because the crawler neurological phenotype mimics other known alleles of Grid2 (see MGI for a list of Grid2 alleles). The mutation in Grid2 is a T to A transversion at base pair 64,429,694 (v38) on chromosome 6, or base pair 1,173,792 in the GenBank genomic region NC_000072 encoding Grid2. The mutation corresponds to residue 2,037 in the NM_008167 mRNA sequence in exon 13 of 16 total exons. 

2020 CAAACAGATATCCCTTATGGCACAGTCTTGGAC 674  -Q--T--D--I--P--Y--G--T--V--L--D-

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 679 for a premature stop codon (Y679*) in the GluRδ2 protein.

Protein Prediction

Figure 2. Domain organization (top) and membrane topography of GluRδ2 (bottom). The domains are labeled as explained in the text. The crawler mutation results in substitution of tyrosine 679 for a premature stop codon (Y679*). The SYTANLAAF sequence motif in the M3 transmembrane helix is indicated, with the alanine mutated in Lurcher mice and the tyrosine mutated in swagger mice indicated. The ligand binding pocket formed by the two lobes D1 and D2 is shown as filled with either glycine or D-serine, which have been shown to bind to GluRδ2 with low affinity. Not to scale.

Glutamate receptor ion channels (ionotropic glutamate receptors, iGluR), which are nonselective for monovalent cations (and sometimes Ca²⁺ permeable), are the major mediators of excitatory synaptic transmission in the central nervous system. iGluRs are tetramers arranged as a dimer of dimers (1-3). Each subunit has a characteristic modular architecture with four domains: the N-terminal domain (NTD), the ligand- or agonist-binding domain (LBD), the transmembrane region, and the C-terminal domain (CTD) (Figure 2) [reviewed in (4;5)]. The extracellular NTD mediates dimer formation and controls heteromer formation among members of the same iGluR subfamily (6). The extracellular LBD is encoded by two polypeptide segments, S1 and S2, which are separated by amino acids that make up part of the transmembrane portion of the protein. The CTD is important for proper delivery of the receptor to the membrane (7;8), for clustering the receptor at the PSD (9;10), and for maintaining stable localization of the receptor at the PSD (11). The transmembrane regions of iGluRs form the ion channel pore, and consist of three α-helices (M1, M3, and M4) and a membrane-inserted pore loop (P or M2).

The crawler mutation occurs within the S2 segment, and converts tyrosine 679 to a stop codon.

For more information about Grid2, please see the record for swagger.

Putative Mechanism

Glutamate is synthesized, stored, released from the presynaptic terminal, and acts through both ligand-gated ion channels (ionotropic glutamate receptors) and G-protein coupled receptors (metabotropic glutamate receptors) on postsynaptic neurons. Activation of these receptors accounts for basal excitatory synaptic transmission and synaptic plasticity, such as long-term potentiation (LTP) and long-term depression (LTD) that are thought to underlie learning and memory. 

Lurcher mice have an alanine to threonine point mutation at residue 654 in GluRδ2. Lurcher heterozygotes are smaller than normal at maturity, but are fertile and have a normal lifespan. Lc/+ mice show a swaying of the hindquarters, a jerky up and down movement, and a tendency to fall in their attempts to walk, which are visible by 12 to 14 days of age (12;13). Walking also involves exaggerated hindlimb flexion. GluRδ2-deficient mice display impaired motor coordination, with ataxia observable by postnatal day 12 (14). These mice walk with tottering steps, and lose balance and roll when they rear up on their hind legs. 

The phenotype of crawler mice resembles those of Grid2^-/- mice, as well as heterozygous Lurcher mice. Although protein expression of GluRδ2 has not been examined, two reasons suggest that the crawler mutation results effectively in a protein null phenotype rather than a gain-of-function phenotype causing massive Purkinje cell death such as that observed in Lurcher mice. First, the mutation creates a premature stop codon, which is likely to disrupt protein stability and lead to degradation. Second, like the Grid2 null allele and the hotfoot alleles (mainly deletions of portions of the CTD), the crawler mutation is recessive. In contrast, the Lurcher mutation causes death when present in homozygous form. 

Primers

PCR Primer
crawler_pcr_F: TGTCACCAAGGGAGATGTATGAACAAC
crawler_pcr_R: TGCCTGCTTGGGACTCCAAAAC

Sequencing Primer
crawler_seq_F: GAACTTAGAGGCAGTCCTCCTTAG
crawler_seq_R: GGGACTCCAAAACATTGTTTTCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 535 nucleotides is amplified (chromosome 6, + strand):

1   tgtcaccaag ggagatgtat gaacaactaa atttgtcact gctaatttgc cactactttg
61  atgagatagc tgagttttcc cccatgaagc ctccaaacac aaggaaagca ttagtactga
121 aacttcacct tcactttgct aatgatgttg tctcttggta acttgctatg tagaacttag
181 aggcagtcct ccttagccat tatatttcaa tagtaagaaa ccgtaagtta agaaaacttg
241 gatggtatct agctttggat aaatagccct tttgttcctt cagttttatt tatacttgac
301 aatagtcagc actctctttt atgtctccct tttctcccct aatcaaggtc tcttcaggat
361 ctgtccaagc aaacagatat cccttatggc acagtcttgg actcggcagt atatcagcat
421 gtccgcatga aggggctgaa tcctttcgag agagacagca tgtattccca gatgtggagg
481 atgatcaacc gaagcaatgg gtcagaaaac aatgttttgg agtcccaagc aggca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Sobolevsky, A. I., Yelshansky, M. V., and Wollmuth, L. P. (2004) The Outer Pore of the Glutamate Receptor Channel has 2-Fold Rotational Symmetry. Neuron. 41, 367-378.

  2. Sun, Y., Olson, R., Horning, M., Armstrong, N., Mayer, M., and Gouaux, E. (2002) Mechanism of Glutamate Receptor Desensitization. Nature. 417, 245-253.

  3. Armstrong, N., and Gouaux, E. (2000) Mechanisms for Activation and Antagonism of an AMPA-Sensitive Glutamate Receptor: Crystal Structures of the GluR2 Ligand Binding Core. Neuron. 28, 165-181.

  4. Dingledine, R., Borges, K., Bowie, D., and Traynelis, S. F. (1999) The Glutamate Receptor Ion Channels. Pharmacol Rev. 51, 7-61.

  5. Mayer, M. L. (2006) Glutamate Receptors at Atomic Resolution. Nature. 440, 456-462.

  6. Ayalon, G., Segev, E., Elgavish, S., and Stern-Bach, Y. (2005) Two Regions in the N-Terminal Domain of Ionotropic Glutamate Receptor 3 Form the Subunit Oligomerization Interfaces that Control Subtype-Specific Receptor Assembly. J Biol Chem. 280, 15053-15060.

  7. Matsuda, I., and Mishina, M. (2000) Identification of a Juxtamembrane Segment of the Glutamate Receptor delta2 Subunit Required for the Plasma Membrane Localization. Biochem Biophys Res Commun. 275, 565-571.

  8. Matsuda, S., Hannen, R., Matsuda, K., Yamada, N., Tubbs, T., and Yuzaki, M. (2004) The C-Terminal Juxtamembrane Region of the Delta 2 Glutamate Receptor Controls its Export from the Endoplasmic Reticulum. Eur J Neurosci. 19, 1683-1690.

  9. Roche, K. W., Ly, C. D., Petralia, R. S., Wang, Y. X., McGee, A. W., Bredt, D. S., and Wenthold, R. J. (1999) Postsynaptic Density-93 Interacts with the delta2 Glutamate Receptor Subunit at Parallel Fiber Synapses. J Neurosci. 19, 3926-3934.

  10. Yap, C. C., Muto, Y., Kishida, H., Hashikawa, T., and Yano, R. (2003) PKC Regulates the delta2 Glutamate Receptor Interaction with S-SCAM/MAGI-2 Protein. Biochem Biophys Res Commun. 301, 1122-1128.

  11. Matsuda, S., Matsuda, K., and Yuzaki, M. (2006) A New Motif Necessary and Sufficient for Stable Localization of the delta2 Glutamate Receptors at Postsynaptic Spines. J Biol Chem. 281, 17501-17509.

  12. Phillips, R. (1960) 'Lurcher', a New Gene in Linkage Group XI of the House Mouse. J Genet. 57, 35-42.

  13. Fortier, P. A., Smith, A. M., and Rossignol, S. (1987) Locomotor Deficits in the Mutant Mouse, Lurcher. Exp Brain Res. 66, 271-286.

  14. Kashiwabuchi, N., Ikeda, K., Araki, K., Hirano, T., Shibuki, K., Takayama, C., Inoue, Y., Kutsuwada, T., Yagi, T., and Kang, Y. (1995) Impairment of Motor Coordination, Purkinje Cell Synapse Formation, and Cerebellar Long-Term Depression in GluR Delta 2 Mutant Mice. Cell. 81, 245-252.