Phenotypic Mutation 'lanzhou' (pdf version)
Allelelanzhou
Mutation Type missense
Chromosome11
Coordinate99,145,277 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Ccr7
Gene Name chemokine (C-C motif) receptor 7
Synonym(s) EBI1, Ebi1h, Cmkbr7, CD197
Chromosomal Location 99,144,196-99,155,077 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. The chemokine (C-C motif) ligand 19 (CCL19/ECL) has been reported to be a specific ligand of this receptor. Signals mediated by this receptor regulate T cell homeostasis in lymph nodes, and may also function in the activation and polarization of T cells, and in chronic inflammation pathogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice exhibit an impaired primary immune response. Dendritic cells, B, T and T regulatory cells show impaired migration to the lymph nodes and secondary lymph organs exhibit morphological abnormalities. Lymphocytic infiltrates to the pancreas, lung and stomach are observed in aged mice. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007719, NM_001301713; MGI:103011

MappedYes 
Amino Acid Change Isoleucine changed to Lysine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000099423]
AlphaFold P47774
SMART Domains Protein: ENSMUSP00000099423
Gene: ENSMUSG00000037944
AA Change: I273K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:7tm_1 75 326 1.8e-49 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
(Using ENSMUST00000103134)
Meta Mutation Damage Score 0.6427 question?
Is this an essential gene? Probably nonessential (E-score: 0.217) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4:CD8 - increased
FACS CD4+ T cells - increased
FACS macrophages - decreased
FACS T cells - increased
Candidate Explorer Status CE: potential candidate; Verification probability: 0.237; ML prob: 0.282; human score: 2
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(5) : Gene trapped(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Ccr7 APN 11 99145145 missense probably benign 0.45
IGL03047:Ccr7 UTSW 11 99145334 missense probably benign 0.44
R0707:Ccr7 UTSW 11 99145983 missense probably damaging 1.00
R1115:Ccr7 UTSW 11 99145277 missense possibly damaging 0.90
R1664:Ccr7 UTSW 11 99145691 missense possibly damaging 0.90
R2291:Ccr7 UTSW 11 99145335 missense probably damaging 1.00
R3743:Ccr7 UTSW 11 99145207 missense possibly damaging 0.86
R4108:Ccr7 UTSW 11 99145378 missense probably damaging 1.00
R4214:Ccr7 UTSW 11 99145046 missense probably damaging 0.98
R5402:Ccr7 UTSW 11 99145734 missense possibly damaging 0.93
R5602:Ccr7 UTSW 11 99145489 missense probably benign 0.08
R6275:Ccr7 UTSW 11 99145663 missense probably damaging 1.00
R6991:Ccr7 UTSW 11 99145304 missense probably damaging 1.00
R7470:Ccr7 UTSW 11 99145557 missense possibly damaging 0.80
R7549:Ccr7 UTSW 11 99145901 missense probably damaging 1.00
Z1176:Ccr7 UTSW 11 99144980 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038185-MU
Last Updated 2019-09-04 9:45 PM by Bruce Beutler
Record Created 2015-04-04 7:26 PM by Ming Zeng
Record Posted 2015-04-20
Phenotypic Description

Figure 1. Lanzhou mice exhibit an increased CD4+ to CD8+ T cell ratio in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lanzhou mice exhibit an increased CD4+ T cell frequency in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The lanzhou phenotype was identified among G3 mice of the pedigree R1115, some of which showed an increase in the CD4+ to CD8+ T cell ratio in the peripheral blood (Figure 1) caused by an increased frequency of CD4+ T cells (Figure 2). 

Nature of Mutation

Figure 3. Linkage mapping of the increased CD4+ T cell frequency in the peripheral blood using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 35 mutations (X-axis) identified in the G1 male of pedigree R1115. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 35 mutations. The T cell phenotypes were linked by continuous variable mapping to a mutation in Ccr7:  a T to A transversion at base pair 99,145,277 (v38) on chromosome 11, or base pair 9,801 in the GenBank genomic region NC_000077 encoding Ccr7. The strongest association was found with a recessive model of linkage to the normalized CD4+ T cell frequency, wherein 4 variant homozygotes departed phenotypically from 19 homozygous reference mice and 11 heterozygous mice with a P value of 7.37 x 10-6 (Figure 3).  The mutation corresponds to residue 897 in the mRNA sequence NM_007719 within exon 3 of 3 total exons.

 

881 GTGGTGGTAGTCTTCATAGTCTTCCAGCTGCCC
268 -V--V--V--V--F--I--V--F--Q--L--P-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (L) to lysine (K) substitution at position 273 (I273K) in the chemokine (C-C motif) receptor 7 (CCR7) protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.899) (1).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. Domain structure topology of CCR7. The lanzhou mutation results in an isoleucine (L) to lysine (K) substitution at position 273 (I273K) and is indicated in red in both figures. CCR7 is a 7-pass transmembrane (TM) domain protein. Abbreviations: SP, signal peptide; N-term, N-terminal tail; TM, transmbembrane domain; C-term, C-terminal tail.
Figure 5. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, the GPCR undergoes conformational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.
Figure 6. CCR7-associated downstream signaling. CCR7-associated signaling controls cell survival, chemotaxis, endocytosis, cytoarchitecture, and migratory speed through several different signaling pathways.

CCR7 (alternatively, BLR2/EBI-1) is a G-protein-coupled receptor (GPCR) with seven transmembrane domains (amino acids 60-86, 96-116, 131-152, 171-191, 220-247, 264-289, 314-331), three intracellular loops (amino acids 87-95, 153-170, 248-263), three extracellular loops (amino acids 117-130, 192-219, and 290-313), a short acidic N-terminus (amino acids 25-59), and a serine- and threonine-rich C-terminus (amino acids 332-378) (Figure 4) (2). Amino acids 1-24 comprise a signal peptide.

 

As a GPCR, CCR7 couples with a heterotrimeric G protein to mediate its downstream effects. G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [reviewed in (3)Figure 5].  In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated.  Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit.  GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and one that may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. Ligand-induced phosphorylation of the GPCR by G protein coupled receptor kinases (GRKs) leads to sequestration of the receptor from the cell surface thereby downregulating signaling. Binding of CCL19/CCL21 to CCR7 activates the G-protein Gαi and the subsequent activation of Jak3 (see the record for mount_tai), PI3 kinase, and phospholipase C β2/β3, which trigger rapid calcium-flux and other downstream signaling molecules such as Src kinases and focal adhesion kinase (FAK), c-Jun N-terminal kinase (JNK), p38 MAPK, ERK and PI3K/Akt [(4-6); Figure 6].

 

The lanzhou mutation results in an isoleucine (L) to lysine (K) substitution at position 273 (I273K) within the sixth transmembrane domain.

Expression/Localization

CCR7 is expressed on several immune cell subsets including double negative (DN) thymocytes (7), single positive (SP) thymocytes (7), naïve T cells (8-10), central memory T cells (TCM) (9;11), regulator T cells (Treg) (12), naïve B cells (13), semi-mature and mature dendritic cells  (DCs) (14), macrophages (15), and neutrophils (16).  CCR7 is also expressed in non-immune cells including various malignancies and astrocytes (17;18). All of the CCR7+ cell types migrate to, and within, lymphoid organs. CCR7+ DN and SP thymocytes migrate within the thymus, CCR7+ DCs migrate from tissues to secondary lymphoid organs (SLOs), and mature CCR7+ T and B cells circulate through SLOs. CCR7 expression on macrophages and neutrophils promotes entry and positioning within SLOs.

 

A summary of the factors that regulate CCR7 expression is shown in Table 1.

 

Table 1. Factors that regulate CCR7 expression

Factor

Associated Mutagenetix page (if applicable)

Brief Description

Cell-type

References

Foxo1

crusty (Foxp3)

A transcription factor that drives Ccr7 expression

Naïve T cells

(19)

Interferon regulatory factor 4 (IRF4)

honey

Regulates CCR7 expression

CD11b+ dendritic cells

(20)

T cell receptor stimulation

thoth (Cd4) or allia (Cd247)

Attenuates CCR7 expression

T cells

 

Prostaglandin E2 (PGE2)

---

Induces CCR7 expression

Maturing dendritic cells

(21-23)

Positive selection in the thymus

---

Induces CCR7 expression

T cells

(24;25)

Calcium-dependent and protein kinase C (PKC)/Raf1-mediated signals

Untied

Induces CCR7 expression

CD4+CD8+ T cells and thymocytes

(26)

Suppressors of cytokine signaling 1 (SOCS1)

samson (Socs2)

Regulates Ccr7 expression through the regulation of STAT signaling pathways (see the record for domino)

 

(27)

Lipopolysaccharide (LPS)

lps3 (Tlr4)

Induces CCR7 expression

Astrocytes

(17)

Background

Chemokines are chemotactic cytokines that have several functions including regulation of leukocyte trafficking and organization of lymphoid organs. Stromal cells within primary lymphoid organs and SLOs constitutively produce the chemokine ligands of CCR7, CCL19 and CCL21 (28-30). The CCR7/CCL19/CCL21 axis regulates the formation of microenvironments that promote interactions between antigen-presenting cells (APCs) and antigen-specific lymphocytes, an essential process in adaptive immune system function. CCL19 and CCL21 do not mediate overlapping functions. CCL21 is predicted to be a predominantly matrix- and endothelial cell-bound chemokine that promotes chemotaxis and cell adhesion (31). CCL21 can be cleaved to form a soluble form that can promote chemotaxis, but not cell adhesion (31).  CCL19 is predicted to be predominantly soluble and stimulates CCR7 phosphorylation and internalization, leading to receptor desensitization [(32;33); reviewed in (34)].

 

Figure 7. The function of CCR7 in the thymus. (1) CCR7+ thymocyte precursors cross blood vessels at the cortico-medullary junction to enter the thymus. (2) DN1 cells and DN2 cells express CCR7 and use this receptor to migrate out to the subcapsular zone. CCR7 is lost on developing thymocytes during the DN3 and DN4 stage (3 & 4) CCR7 is re-expressed during the DP stage during positive selection. (4) Positively selected SP thymocytes use CCR7 to migrate back towards the medulla, where CCL19 and CCL21 are abundant. (5) Mature SP thymocytes that survive negative selection in the medulla also express CCR7 and this is involved in a partially redundant manner for (6) egress of mature thymocytes from the thymus.

Figure 8. CCR7 and CXCR5 function in the early steps of lymph node and Peyer's patch development.  (1) Lymphotoxin β receptor-expressing mesenchymal step cells differentiate into mesenchymal organizer cells. (2) The differentiation of the mesenchymal organizer cells induces the expression of adhesion molecules, such as vascular cellular adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1), and chemokines, including CXCL13, CCL19, and most probably CCL21.CXCL13 and CCL19 produced by mesenchymal organizer might be displayed on endothelial cells of blood vessels (b), this way contributing to the recruitment of additional IL-7Rα+ inducer cells from the circulation (3) CXCL13 leads to the activation of α4β1 integrin on IL-7Rα+ inducer cells. CCL19 may also act on the IL-7Rα+ inducer cells by binding to its cognate receptor, CCR7. Secretion of IL-7Rα+ inducer cells stimulated via IL-7Rα or tumor necrosis factor-related activation-induced cytokine receptor (TRANCE-R) upregulate the surface expression of LTα1β2 . (4) Binding of α4β7 integrin to its counter-receptor MAdCAM-1 may play a role in the extravasation of IL-7Rα+ inducer cells at sites of lymph node and Peyer's patch development. (5) The cluster of IL-7Rα+ inducer cells and mesenchymal organizer cells eventually reaches a critical size or level of chemokine expression that allows lymph node and Peyer's patch development to proceed to the next stage, which includes the immigration of other cell types such as B cells, T cells, and macrophages, as well as their organization into distinct microenvironments.

Figure 9. CCR7 and Treg development in the lymph node. Naive and Treg (not shown) cells enter the lymph node via the high endothelial venules (HEVs). On homing to the lymph node, the T cells establish contacts with antigen-laden dendritic cells (DCs) that have homed via the afferent lymphatics. Consequently TReg cells proliferate and expand. The TReg cells also interfere with the concurrent antigen-induced proliferation of naive T helper (TH) cells reduce the number and differentiation of effector cells. Upon homing to the lymph node and coming into contact with DCs, naive T cells may also undergo direct conversion into TReg cells.

Development of thymocytes into mature T cells occurs in the thymus, where thymocytes follow a program of differentiation characterized by expression of distinct combinations of cell surface proteins including CD4, CD8, CD44 and CD25. The most immature thymocytes are CD4-CD8- double negative (DN). This group can be further subdivided into 4 groups that differentiate in the following order: CD44+CD25- (DN1) to CD44+CD25+ (DN2) to CD44-CD25+ (DN3) to CD44-CD25- (DN4). During this process, expression of pre-TCRα (pTα), TCRα, TCRβ and CD3 proteins is activated in temporal sequence to promote T cell development. The DN3 stage is the first critical checkpoint during thymocyte development. Progression and expansion past DN3 requires surface expression of the product of a productive chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with CD3 and TCRζ. This complex is known as the pre-TCR and produces a TCR-like signal that is necessary for continued survival. After progressing through the DN4 stage, αβ thymocytes express both CD4 and CD8 and are known as double positive (DP) cells. Progression past this state to single positive CD4 or CD8 cells requires a TCR signal that occurs through a newly rearranged TCRα chain and the previously expressed TCRβ chain. 

 

CCR7 functions at several stages during thymocyte development (Figure 7). CCR7 cooperates with two other chemokine receptors, CCR9 and CXCR4, to promote efficient immigration of circulating bone marrow-derived precursors into the thymus (35-38). CCR7 expression on DN2 cells is required for migration of DN2 cells to the cortex (7). Later in development, CCR7 is required for migration of CD4 and CD8 SP thymocytes back to the medulla where the SP cells undergo negative selection to remove cells that express self-reactive TCRs (39-42). CCR7-deficient thymocytes exhibit impaired TCR signaling necessary for optimal negative selection (40). High concentrations of CCL19/CCL21 initiates an inhibitory program in T cells by interfering with cell proliferation and IL-2 secretion in CCR7+ cells (43). In Ccr7-deficient (Ccr7-/-) mice, CCL19 did not have an inhibitory effect on T cells; Ccr7-/- T cells exhibited TCR-associated proliferation similar to CCL19-treated wild-type cells (43). Proliferation inhibition was associated with influence on cell cycle progression by delayed degradation of the cyclin-dependent kinase (CDK) inhibitor p27Kip1 and the down-regulation of CDK1 (43).

 

SLOs are the site of antigen accumulation and lymphocyte priming. CCR7 and CXCR5/CXCL13 (see the record for ice) are essential for the development of SLOs [Figure 8; (44-46)]. Ccr7-/- mice develop most SLOs including spleen, Peyer’s Patches (PPs), and most lymph nodes (LNs), although loss of inguinal, popliteal, and parathymic LNs have been observed (45). The SLOs in the Ccr7-/- mice exhibit defective lymphocyte compartmentalization and disrupted architecture. CCR7 and CXCR5 exhibit overlapping functions in lymph node development through their expression on CD4+IL-7R+CD3 CD45+RORγt+ (see the record for chestnut) lymphoid tissue inducer (LTi) cells, which function in the development of SLOs (45;46). LTi cells are recruited to the site of SLO development. Lymphotoxin (LT) receptor ligand LTα1β2 expressed on the LTi cells ligates to the LT receptor (LTR; see the record for kama) expressed on stromal ‘organizer’ cells to mediate lymphoid tissue development and maintenance [reviewed in (34)]. After the development of SLOs, CCR7 mediates lymphocyte recruitment to LNs and PPs. Rolling naïve lymphocytes in the high endothelium venules (HEVs) within the cortex of LNs and PPs express CCR7, which detects CCL21 and/or CCL19 on the luminal surface of the HEVs. CCR7-associated signals after ligation result in L-selectin (see the record for dim_sum) and integrin activation, adhesion, and subsequent extravasation into the LN or PP [reviewed in (34)].

 

Within the SLOs, segregation of T and B cells is mediated by CCR7. The differential expression of CCR7 versus CXCR5 between naïve T and B cells regulates whether the cells locate to T cell areas or follicles, respectively [reviewed in (34)]. CCR7 also functions in regulation of antigen-engaged T cell recirculation and T cell survival in SLOs (47-49). CCR7 counteracts the lymphocyte egress signal mediated by sphingosine-1 phosphate receptor 1 (S1P1) (50). After naïve T cell activation by antigen, helper and cytotoxic T cells proliferate and differentiate. After antigen-specific T cell expansion, most effector cells undergo activation-induced cell death (AICD) to prevent autoimmunity, while others survive as memory T cells. CCL19/CCL21 expressed by stromal cells in the T cell zone of SLOs regulate CD4+ T-cell immune responses in SLOs by promoting AICD through a FasL-dependent pathway (see the records for cherry (Fas) and riogrande (Fasl)) (51).

 

CCR7/CCL21 regulates homeostatic trafficking of DCs to LNs (52-55), including the migration of small intestine lamina propria DCs (LP-DCs) to mesenteric LNs (56). CCR7-mediated activation of Jak3 is essential for DC maturation, migration, and function (57). Jak3-deficient (Jak3−/−) mice exhibit impaired bone marrow-derived macrophage migration towards CCL19 and CCL21 (57). Neutrophils also migrate in response to CCL19/CCL21 (16). Injection of Freund adjuvant induced recruitment of neutrophils to lymph nodes in wild-type mice, but not Ccr7-/- mice (16),

 

Treg cells maintain immune system homeostasis and regulate self-tolerance. CCR7 regulates Treg homing to the T cell zone in the LN and subsequent interaction between the Treg cells and antigen presenting cells [Figure 9; (58-60)]. Naive-like αECD25+ Treg cells from Ccr7-/- mice exhibited diminished rates of migration into LNs with a concomitant reduced capacity to suppress antigen-induced naïve T cell proliferation (61). CCR7 is required for the egress of effector T cells from tissues. CCR7 deficiency resulted in effector T cell accumulation in peripheral tissues including the skin, asthmatic lung, and peritoneal cavity (62-64). Loss of CCR7-dependent egress of effector T cells from peripheral tissues results in impaired resolution of peripheral immune responses that subsequently led to autoimmune lesions. CCR7 is also required for lymph node accumulation of central memory T cells (CD62L+CCR7hi) (65;66).

 

Immune responses

Ccr7-/- mice exhibit reduced or delayed adaptive immune responses, aberrant humoral immune responses, and diminished interactions between DCs and T cells in the LN paracortex [Figure 9; (44;67)]. CCR7 is not required in immune responses when B cells are able to provide sufficient antigen presentation such as in cases of various viral infections such as vesicular stromatitis virus (VSV), lymphochorio meningitis virus (LCMV) or vaccinia virus (VV) (68;69). CCR7 is required at multiple steps during DC migration from peripheral tissues to SLOs during inflammation (6). CCR7/CCL21 is required for DC entry into the LN as well as for entry into the LN paracortex from the subcabsular sinus (70). CCL19 promotes DC production of IL-1β, IL-12 and TNFα as well as the expression of co-stimulatory molecules CD40 and CD86 (71).  Both CCL19 and CCL21 induce rapid endocytosis of antigen by DCs (72), promote mature DC survival (73;74), and CCL19 induces DC dendrite extension (75).

 

CCR7 is required for the T and B cell interactions that initiate a germinal center (GC) reaction. Antigen-inexperienced B cells exhibit a CXCR5+CCR7lo cell surface phenotype, which attracts and retains these cells within B cell follicles (13). After activation, antigen-stimulated B cells upregulate CCR7 expression (13), which facilitates their migration to and distribution along the T-B border (76). Increased CCR7 expression is also essential for T follicular helper (TFH) cell recruitment to the T-B border. TFH cell differentiation from naïve precursors is coupled with the loss of CCR7 and the induction of CXCR5, which subsequently promotes TFH cell migration into B cell follicles and GCs (77-79). Forced expression of CCR7 on T cells prevents their migration to follicular zones after immunization (79;80).

 

CCR7 also controls lymphocyte trafficking through nonlymphoid tissues. Ccr7-/- mice exhibit accumulation of lymphocytes in epithelial tissues (81). The gastrointestinal mucosal tissues of the Ccr7-/- mice exhibited the formation of lymphoid aggregates, which have topologic characteristics of LNs (81). The ectopic follicles have a high percentage of CD44hiCD62Llo effector memory T cells within the gastric lymphoid aggregates (81). In T-cell acute lymphoblastic leukemia (T-ALL), CCR7 functions as an adhesion signal that targets leukemic T cells into the central nervous system (82).

Putative Mechanism

Ccr7-/- mice exhibit naïve T cell and DC deficiency, but the CD4+ T cell population in the peripheral blood, red pulp of the spleen, and bone marrow is expanded (44). Forster et al. determined that B and T cell migration into LNs and PPs as well as T cell migration into the splenic periarteriolar lymphoid sheath (PALS) was disrupted in the Ccr7-/- mice (44). In addition, B cells were retained in the PALS (44). The Ccr7-/- mice were unable to mount primary T cell responses and T-dependent (TD) antigen responses. Ccr7-/- mice immunized with T-independent type 2 (TI-2) antigens exhibited extrafollicular plasma cell responses, but persisting splenic germinal centers (83). Germinal center formation upon TI-2 and TD immunization were located in the PALS. The TI-2-induced GCs had peripheral rings of follicular DCs and T cells. Although the GC persisted, class-switching, affinity maturation, and memory B cell generation were not increased in the Ccr7-/- mice (83). Ccr7-/- mice exhibit increased susceptibility to streptozotocin-induced diabetes, spontaneous chronic autoimmune renal disease (84), and spontaneous autoimmune gastritis with a concomitant metaplasia of the gastric mucosa and formation of tertiary lymphoid organs at mucosal sites (85). Similar to the Ccr7-/- mice, the lanzhou mice exhibit an expanded population of CD4+ T cells in the peripheral blood, indicating loss of CCR7lanzhou function. Other immune-related phenotypes (e.g., diminished TD or TI responses) were not observed in the lanzhou mice, indicating that CCR7lanzhou may retain some residual function.

Primers PCR Primer
lanzhou_pcr_F: ACTTGACGCCGATGAAGGCATAC
lanzhou_pcr_R: CCTATGCATCAGCATTGACCGCTAC

Sequencing Primer
lanzhou_seq_F: CATACAAGAAAGGGTTGACGC
lanzhou_seq_R: ATCAGCAAGCTGTCCTGTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 557 nucleotides is amplified (chromosome 11, - strand):


1   cctatgcatc agcattgacc gctacgtagc catcgtccag gccgtgtcgg ctcatcgcca
61  ccgcgcccgc gtgcttctca tcagcaagct gtcctgtgtg ggcatctgga tgctggccct
121 cttcctctcc atcccggagc tgctctacag cggcctccag aagaacagcg gcgaggacac
181 gctgagatgc tcactggtca gtgcccaagt ggaggccttg atcaccatcc aagtggccca
241 gatggttttt gggttcctag tgcctatgct ggctatgagt ttctgctacc tcattatcat
301 ccgtaccttg ctccaggcac gcaactttga gcggaacaag gccatcaagg tgatcattgc
361 cgtggtggta gtcttcatag tcttccagct gccctacaat ggggtggtcc tggctcagac
421 ggtggccaac ttcaacatca ccaatagcag ctgcgaaacc agcaagcagc tcaacattgc
481 ctatgacgtc acctacagcc tggcctccgt ccgctgctgc gtcaaccctt tcttgtatgc
541 cttcatcggc gtcaagt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Bruce Beutler