Phenotypic Mutation 'thistle'

• Allele: thistle
• Mutation Type: critical splice acceptor site
• Chromosome: 8
• Coordinate: 71,685,383 bp (GRCm38)
• Base Change: A ⇒ T (forward strand)
• Gene: Jak3
• Gene Name: Janus kinase 3
• Synonym(s): fae; wil
• Chromosomal Location: 71,676,296-71,690,575 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000060073 ^†] [ENSMUSP00000105639 ^†] [ENSMUSP00000105640 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000060073; Gene: ENSMUSG00000031805

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000105639; Gene: ENSMUSG00000031805

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000105640; Gene: ENSMUSG00000031805

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9493
• Is this an essential gene?: Probably essential (E-score: 0.753)
• Phenotypic Category: Autosomal Recessive
• Candidate Explorer Status: CE: excellent candidate; Verification probability: 0.975; ML prob: 0.986; human score: 5
• Mode of Inheritance: Autosomal Recessive
• MMRRC Submission: 038224-MU
• Last Updated: 2020-01-15 3:43 PM by Eva Marie Y. Moresco
• Record Created: 2015-04-22 8:23 PM by Jin Huk Choi
• Record Posted: 2015-04-28
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Kuan-Wen Wang, Jin Huk Choi, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010589; NM_001190830; MGI:99928

Alleles Listed at MGI

All mutations/alleles(25) : Chemically induced (ENU)(5) Gene trapped(14) Spontaneous(1) Targeted(5)

Phenotypic Description

Figure 1. Homozygous thistle mice exhibit a decrease in the B:T cell ratio in the peripheral blood. B and T cell frequencies were determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous thistle mice exhibit a decrease in the T cell frequency in the peripheral blood. T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous thistle mice exhibit a decrease in the B cell frequency in the peripheral blood. B cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Homozygous thistle mice exhibit a decrease in the B1 cell frequency in the peripheral blood. B1 cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Homozygous thistle mice exhibit a decrease in the IgM + B cell frequency in the peripheral blood. IgM + B cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Homozygous thistle mice exhibit a decrease in the percentage of IgD + B cells in the peripheral blood. IgD + B cell percentage was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Homozygous thistle mice exhibit an increase in the CD4 + to CD8 + T cell ratio in the peripheral blood. CD4 + and CD8 + T cell frequencies were determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Homozygous thistle mice exhibit a decreased frequency of CD4 + T cells in the peripheral blood. CD4 + T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Homozygous thistle mice exhibit a decreased frequency of naÏve CD4 + T cells in CD4 + T cells in the peripheral blood. NaÏve CD4 + T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Homozygous thistle mice exhibit a decreased frequency of CD8 + T cells in the peripheral blood. CD8 + T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Homozygous thistle mice exhibit a decreased frequency of CD8 + T cells in CD3 + T cells in the peripheral blood. CD8 + T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Homozygous thistle mice exhibit a decreased frequency of naÏve CD8 + T cells in CD8 + T cells in the peripheral blood. NaÏve CD8 + T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Homozygous thistle mice exhibit an increased frequency of effector memory CD8 + T cells in CD8 + T cells in the peripheral blood. Effector memory CD8 + T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Homozygous thistle mice exhibit a reduced frequency of natural killer (NK) cells in the peripheral blood. NK cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Homozygous thistle mice exhibit an increased frequency of CD11c + dendritic cells in the peripheral blood. Dendritic cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Homozygous thistle mice exhibit an increased frequency of macrophages in the peripheral blood. Macrophage frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 17. Homozygous thistle mice exhibit an increased CD44 mean fluorescence intensity (MFI) on T cells in the peripheral blood. CD44 MFI was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 18. Homozygous thistle mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The thistle phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2058, some of which exhibited a decrease in the B:T cell ratio (Figure 1) caused by a reduced frequency of T cells (Figure 2) coupled with a greater diminution of B cells (Figure 3), B1 cells (Figure 4), IgM+ B cells (Figure 5), and IgD+ B cells (Figure 6), all in the peripheral blood. Some mice also exhibited an increase in the CD4⁺ to CD8⁺ T cell ratio (Figure 7) caused by a decreased frequency of CD4⁺ T cells (Figure 8) and naïve CD4⁺ T cells in CD4⁺ T cells (Figure 9) coupled with a increased diminution of the frequency of CD8+ T cells (Figure 10), a decreased frequency of CD8⁺ T cells in CD3⁺ T cells (Figure 11), a decreased frequency of naïve CD8⁺ T cells in CD8⁺ T cells (Figure 12), and an increased frequency of effector memory CD8⁺ T cells in CD8⁺ T cells (Figure 13), all in the peripheral blood. Some mice exhibited a reduced frequency of natural killer (NK) cells (Figure 14) as well as increased frequencies of CD11c⁺ dendritic cells (Figure 15) and macrophages (Figure 16), all in the peripheral blood. The CD44 mean fluorescence intensity (MFI) on T cells in the peripheral blood was increased in some mice (Figure 17). Some mice also exhibited a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 18).

Nature of Mutation

Figure 19. Linkage mapping of the reduced frequency of naïve CD4 T cells in CD4 T cells in the peripheral blood using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 100 mutations (X-axis) identified in the G1 male of pedigree R2058. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 100 mutations. All of the above phenotypic abnormalities were linked by continuous variable mapping to a mutation in Jak3:  an A to T transversion at base pair 71,685,383 (v38) on chromosome 8, or base pair 9,001 in the GenBank genomic region NC_000074 encoding Jak3. The strongest association was found with a recessive model of linkage to the normalized frequency of naïve CD4 T cells in CD4 T cells in the peripheral blood (P = 3.705 x 10^-23), wherein 5 variant homozygotes departed phenotypically from 11 homozygous reference mice and 23 heterozygous mice (Figure 19). The mutation is located within the acceptor splice site of intron 18 (in both Jak3 protein-coding transcripts on Ensembl; both transcripts encode the same protein), two nucleotides from exon 19. The effect of the mutation at the mRNA and protein level is unknown. One possibility, shown below, is that aberrant splicing would cause skipping of the 190-base pair exon 19 (out of 25 total exons) and a frame-shift that would result in coding of 7 aberrant amino acids followed by a premature stop codon in exon 20.  

 

<--exon 18    <--intron 18        <--exon 19-->        exon 20--> 8909 ……TCTTTGCTGGGCAAG……tcatcctcccacag GGCAACTTTGGC……AGCTATGGGCCAG GTCGCCAGAGCCTGCGGTTGGTGA 822  ……-S--L--L--G--K-                 -G--N--F--G-……-S--Y--G--P-- -V--A--R--A--C--G--W--*           correct                               deleted                   aberrant

          

Genomic numbering corresponds to NC_000074. The acceptor splice site of intron 18, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction

Figure 20. Domain structure of JAK3. The thistle mutation destroys the acceptor splice site of intron 18. See the text for more details. Abbreviations: B41, 4.1, ezrin, radixin, moesin (FERM) homology domain; SH2, Src Homology 2-like. This image is interactive. Other mutations found in JAK3 are noted in red. Click on each mutation for more information.

Jak3 encodes Janus kinase 3 (JAK3). JAK3 has seven different highly conserved JAK homology (JH) regions (JH1-JH7) [Figure 20; reviewed in (1)]. The JH1 region is the kinase domain (amino acids 818-1091), the JH2 domain corresponds to the pseudokinase domain (amino acids 517-773), the JH3 and JH4 regions comprise an Src Homology 2 (SH2)-like domain (amino acids 370-460), and the JH6 and JH7 regions consist of a 4.1, ezrin, radixin, moesin (FERM) homology domain (alternatively, B41 domain; amino acids 20-254). The thistle mutation is predicted to result in deletion of exon 19 (which encodes amino acids 827-889), a frame-shift, and coding of a premature stop codon within the JAK3 kinase domain. Expression and localization of JAK3^­citron has not been examined.

 

Please see the record mount_tai for more information about Jak3.

Putative Mechanism

JAK3 binding is restricted to hematopoietic-specific cytokine receptors that have a γ_c receptor subunit (i.e., the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors) [reviewed in (1)]. The γ_c receptor-associated cytokines have known functions. For example, IL-7 is necessary for T and B cell development, IL-2 functions in peripheral T cell homeostasis and antigen-driven T-cell expansion, IL-15 functions in natural killer (NK) cell differentiation, IL-4 functions in B-cell maturation and isotype switching (2). JAK3 mutations result in defective γ_c receptor-associated signaling and subsequent defects in lymphocyte development (2;3). Mutations in JAK3 are linked to autosomal recessive T- and NK-cell negative/B-cell positive type of severe combined immunodeficiency [T⁻B⁺NK^- SCID; OMIM: #600802; (4-6); reviewed in (2)]. Patients with T⁻B⁺NK^- SCID do not have T or NK cells, but have normal to elevated numbers of immature nonfunctional B lymphocytes (5;6). Patients with SCID have persistent, recurring infections due to loss of T cell-associated immunity.  Jak3 knockout (Jak3^-/-) mice have reduced numbers of T, B, γδ T, and NK cells (7-11). B cell maturation in the Jak3^-/- mice is blocked at the pre-B stage, leading to a reduced frequency of IgM⁺ B cells (10). Thistle mice exhibit reduced frequencies of T, B and NK cells as well as a reduced frequency of IgM⁺ B cells, indicating that JAK3^thistle has loss of function.

Primers

PCR Primer
thistle_pcr_F: TGATCCCCGCCCTAGATTAC
thistle_pcr_R: CCCGGTACTTGACGATGAAG

Sequencing Primer
thistle_seq_F: TAGATTACGAGCTCCTCTCAGAC
thistle_seq_R: AGTCGCTGTGCAGAGCCTTAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 406 nucleotides is amplified (chromosome 8, + strand):

1   tgatccccgc cctagattac gagctcctct cagaccccac acctggcatc ccgagtcctc
61  gagatgagct gtgcggtggc gcccagctct atgcctgcca ggaccccgcc atattcgagg
121 agagacacct taagtacatc tctttgctgg gcaaggtgag tgggcgggca tgtgggggag
181 gaacgtgggt gggtggatgg gtcaggtgga cactgccctc tcatcctccc acagggcaac
241 tttggcagcg tggagctgtg ccgctatgac cccctggggg acaatacggg acccctggtg
301 gcagtgaaac agctacagca cagcgggcca gaccagcaga gggacttcca gcgggagatt
361 cagatcctta aggctctgca cagcgacttc atcgtcaagt accggg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Wu, W., and Sun, X. H. (2012) Janus Kinase 3: The Controller and the Controlled. Acta Biochim Biophys Sin (Shanghai). 44, 187-196.

  2. Notarangelo, L. D., Mella, P., Jones, A., de Saint Basile, G., Savoldi, G., Cranston, T., Vihinen, M., and Schumacher, R. F. (2001) Mutations in Severe Combined Immune Deficiency (SCID) due to JAK3 Deficiency. Hum Mutat. 18, 255-263.

  3. Thomis, D. C., and Berg, L. J. (1997) The Role of Jak3 in Lymphoid Development, Activation, and Signaling. Curr Opin Immunol. 9, 541-547.

  4. Candotti, F., Oakes, S. A., Johnston, J. A., Giliani, S., Schumacher, R. F., Mella, P., Fiorini, M., Ugazio, A. G., Badolato, R., Notarangelo, L. D., Bozzi, F., Macchi, P., Strina, D., Vezzoni, P., Blaese, R. M., O'Shea, J. J., and Villa, A. (1997) Structural and Functional Basis for JAK3-Deficient Severe Combined Immunodeficiency. Blood. 90, 3996-4003.

  5. Macchi, P., Villa, A., Giliani, S., Sacco, M. G., Frattini, A., Porta, F., Ugazio, A. G., Johnston, J. A., Candotti, F., and O'Shea, J. J. (1995) Mutations of Jak-3 Gene in Patients with Autosomal Severe Combined Immune Deficiency (SCID). Nature. 377, 65-68.

  6. Russell, S. M., Tayebi, N., Nakajima, H., Riedy, M. C., Roberts, J. L., Aman, M. J., Migone, T. S., Noguchi, M., Markert, M. L., Buckley, R. H., O'Shea, J. J., and Leonard, W. J. (1995) Mutation of Jak3 in a Patient with SCID: Essential Role of Jak3 in Lymphoid Development. Science. 270, 797-800.

  7. Nosaka, T., van Deursen, J. M., Tripp, R. A., Thierfelder, W. E., Witthuhn, B. A., McMickle, A. P., Doherty, P. C., Grosveld, G. C., and Ihle, J. N. (1995) Defective Lymphoid Development in Mice Lacking Jak3. Science. 270, 800-802.

  8. Park, S. Y., Saijo, K., Takahashi, T., Osawa, M., Arase, H., Hirayama, N., Miyake, K., Nakauchi, H., Shirasawa, T., and Saito, T. (1995) Developmental Defects of Lymphoid Cells in Jak3 Kinase-Deficient Mice. Immunity. 3, 771-782.

  9. Baird, A. M., Thomis, D. C., and Berg, L. J. (1998) T Cell Development and Activation in Jak3-Deficient Mice. J Leukoc Biol. 63, 669-677.

  10. Thomis, D. C., Gurniak, C. B., Tivol, E., Sharpe, A. H., and Berg, L. J. (1995) Defects in B Lymphocyte Maturation and T Lymphocyte Activation in Mice Lacking Jak3. Science. 270, 794-797.

  11. Eynon, E. E., Livak, F., Kuida, K., Schatz, D. G., and Flavell, R. A. (1999) Distinct Effects of Jak3 Signaling on Alphabeta and Gammadelta Thymocyte Development. J Immunol. 162, 1448-1459.