Phenotypic Mutation 'diminutive' (pdf version)
List |< first << previous [record 38 of 74] next >> last >|
Allelediminutive
Mutation Type critical splice donor site
Chromosome2
Coordinate163,864,865 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Rims4
Gene Name regulating synaptic membrane exocytosis 4
Synonym(s) Rim4
Chromosomal Location 163,859,751-163,918,683 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induec allele exhibit reduced body weight. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_183023; MGI:2674366

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000045637]
SMART Domains Protein: ENSMUSP00000045637
Gene: ENSMUSG00000035226

DomainStartEndE-ValueType
C2 129 232 1.42e-11 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased
Body Weight (Male) - decreased
growth/size
Penetrance 5/5 
Alleles Listed at MGI

All mutations/alleles(4) : Gene trapped(2) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Rims4 APN 2 163864102 missense probably damaging 1.00
IGL01980:Rims4 APN 2 163865782 splice site probably benign
demure UTSW 2 163864120 missense probably damaging 0.99
R0115:Rims4 UTSW 2 163864120 missense probably damaging 0.99
R0152:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0153:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0173:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0238:Rims4 UTSW 2 163864025 missense probably benign 0.03
R0238:Rims4 UTSW 2 163864025 missense probably benign 0.03
R0481:Rims4 UTSW 2 163864120 missense probably damaging 0.99
R0702:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0735:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0973:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0973:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0974:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1013:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1014:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1017:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1104:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1209:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1401:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1554:Rims4 UTSW 2 163879122 missense probably damaging 1.00
R1618:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R2104:Rims4 UTSW 2 163864865 critical splice donor site probably null
R2171:Rims4 UTSW 2 163864126 splice site probably null
R3611:Rims4 UTSW 2 163879206 missense possibly damaging 0.50
R3735:Rims4 UTSW 2 163863985 missense possibly damaging 0.88
R3836:Rims4 UTSW 2 163918653 missense possibly damaging 0.86
R4685:Rims4 UTSW 2 163864994 nonsense probably null
R4849:Rims4 UTSW 2 163865543 missense probably benign 0.11
R4873:Rims4 UTSW 2 163865523 missense probably null 0.00
R4875:Rims4 UTSW 2 163865523 missense probably null 0.00
R5337:Rims4 UTSW 2 163865843 missense probably benign 0.00
R5415:Rims4 UTSW 2 163918676 missense probably benign 0.26
R5646:Rims4 UTSW 2 163864017 nonsense probably null
R6487:Rims4 UTSW 2 163864897 missense possibly damaging 0.93
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository
Last Updated 2018-02-06 10:51 AM by Anne Murray
Record Created 2015-05-02 10:32 AM by Jeff SoRelle
Record Posted 2016-11-08
Phenotypic Description
Figure 1. Diminutive mice exhibit reduced body weights. Scaled body weight data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The diminutive phenotype was identified among G3 mice of the pedigree R2104, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 141 mutations (X-axis) identified in the G1 male of pedigree R2104. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 141 mutations. The body weight phenotype was linked to a mutation in Rims4: a G to A transition at base pair 163,864,865 (v38) on chromosome 2, or base pair 54,126 in the GenBank genomic region NC_000068 within the donor splice site of intron 5. Linkage was found with a recessive model of inheritance, wherein five variant homozygous mice departed phenotypically from 14 homozygous reference mice and 16 heterozygous mice (P = 1.099 x 10-7; Figure 2).

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic splice site in exon 5. The use of a cryptic splice site would result in a transcript with a 42-base pair deletion in exon 5 and an in-frame deletion of 14 amino acids (amino acids 185-198).


 
C57BL/6J:
          <--exon 4      <--exon 5 intron 5-->               <--exon 6-->
439 ……AAGACACTGCCAG ……AAAGTCCTGCAG gtaaggggttcctct…… GTAATCGTGTGG…………GAGCGATCTTAA 810
147 ……-K--T--L--P-- ……-K--V--L--Q-                   -V--I--V--W-…………-E--R--S--*- 269
diminutive:
          <--exon 4      <--exon 5 intron 5-->               <--exon 6-->
439 ……AAGACACTGCCAG ……TTGTACAACCAG gtaaggggttcctct…… GTAATCGTGTGG…… ……GAGCGATCTTAA 768
147 ……-K--T--L--P-- ……-L--Y--N--Q-                   -V--I--V--W-…… ……-E--R--S--*- 255

 

The donor splice site of intron 5, which is destroyed by the diminutive mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction
Figure 3. Domain organization of RIMS4. RIMS4 has a C2 domain. The diminutive mutation within intron 5 is marked. This image is interactive; click to view other mutations in Rims4.

Rims4 encodes RIMS4 (protein regulating synaptic membrane exocytosis 4; alternatively, RIM4γ), a member of the RIM (Rab-3 interacting molecules) family of synaptic proteins that regulate normal neurotransmitter release. There are four isoforms of the RIM proteins: RIM1 to RIM4. The RIM1 and RIM2 isoforms have longer α and β variants and a short γ variant that differ in their protein domain organization. RIM3 and RIM4 only have γ variants. RIMS4 is highly homologous to RIM2γ and RIM3γ.

 

RIMS4 has a C2 domain at amino acids 129-232 (Figure 3). The C2 domain putatively binds liprins, which are adaptor proteins that regulate the active zone size (1;2). The C2 domain also binds to synaptotagmin 1, which regulates neurotransmitter release (3;4). The RIM proteins bind Rab3 via their N-terminal domain, which is absent in RIMS4. Also, a central domain in RIM binds Cav2 (N and P/Q) channels to recruit the channels to the active zones.

 

The diminutive mutation is within intron 5, and is predicted to result in an in-frame deletion of amino acids 185-198 within the C2 domain.

 

For more information about Rims4, please see the record for demure.

Putative Mechanism

The RIM proteins are adaptor proteins that were identified as effectors of Rab3, which is a synaptic vesicle protein that binds GTP and regulates neurotransmitter release (5;6). The RIM proteins putatively regulate neurotransmitter release by interacting with synaptic proteins (e.g., Rab3). The RIM, RIM-BP, Munc13, and liprin proteins form a single large protein complex that forms the core of the active zone. RIM proteins bind Rab3, Rab27, Munc13, and Cav2 channels. The liprins function as a link between the RIM/RIM-BP/Munc13 complex and adhesion molecules of the receptor phosphotyrosine phosphatase family. Synaptic vesicle fusion with the presynaptic membranes is dependent on the interactions between SNARE proteins on the synaptic vesicle and syntaxin-1 and SNAP-25.

 

The function of RIMS4 is unknown. The cause of the low body weight in the diminutive mice is unknown.

Primers PCR Primer
diminutive(F):5'- TGTTCCAGGGATGAAACAGCC -3'
diminutive(R):5'- CCACAATTTGAAGGAGCAGC -3'

Sequencing Primer
diminutive_seq(F):5'- TGGCGACACAAGAAGTTGC -3'
diminutive_seq(R):5'- AGCCTAGAACCCTGCCTTCTG -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJeff SoRelle, Zhe Chen, and Bruce Beutler
List |< first << previous [record 38 of 74] next >> last >|