Phenotypic Mutation 'Rakshasa' (pdf version)
Allele | Rakshasa |
Mutation Type |
missense
|
Chromosome | 8 |
Coordinate | 45,850,734 bp (GRCm39) |
Base Change | A ⇒ G (forward strand) |
Gene |
Tlr3
|
Gene Name | toll-like receptor 3 |
Chromosomal Location |
45,848,702-45,864,112 bp (-) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygotes for a null allele show alterations in innate immunity against different viruses, viral pathogenesis, anxiety, hippocampal synaptic plasticity, memory retention and neurogenesis. Homozygotes for another null allele show altered ds-RNA responses in dendritic and aorta smooth muscle cells. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_126166; MGI:2156367
|
Mapped | Yes |
Amino Acid Change |
Valine changed to Alanine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000034056]
[ENSMUSP00000126556]
[ENSMUSP00000147738]
[ENSMUSP00000147783]
|
AlphaFold |
Q99MB1 |
PDB Structure |
Crystal structure of mouse TLR3 ectodomain [X-RAY DIFFRACTION]
Mouse Toll-like receptor 3 ectodomain complexed with double-stranded RNA [X-RAY DIFFRACTION]
|
SMART Domains |
Protein: ENSMUSP00000034056 Gene: ENSMUSG00000031639 AA Change: V721A
Domain | Start | End | E-Value | Type |
LRRNT
|
28 |
56 |
1.14e1 |
SMART |
LRR
|
50 |
74 |
1.33e1 |
SMART |
LRR_TYP
|
99 |
122 |
4.72e-2 |
SMART |
LRR
|
123 |
146 |
2.47e2 |
SMART |
LRR
|
171 |
194 |
3.36e1 |
SMART |
LRR
|
198 |
220 |
7.57e0 |
SMART |
low complexity region
|
224 |
238 |
N/A |
INTRINSIC |
low complexity region
|
252 |
263 |
N/A |
INTRINSIC |
LRR
|
274 |
297 |
1.06e1 |
SMART |
LRR_TYP
|
298 |
321 |
1.28e-3 |
SMART |
LRR
|
355 |
378 |
6.23e1 |
SMART |
LRR
|
379 |
404 |
3.18e2 |
SMART |
LRR
|
405 |
430 |
8.98e1 |
SMART |
LRR
|
431 |
455 |
6.78e1 |
SMART |
LRR_TYP
|
506 |
529 |
1.79e-2 |
SMART |
LRR
|
530 |
553 |
2.63e0 |
SMART |
LRR_TYP
|
562 |
585 |
1.56e-2 |
SMART |
LRR
|
586 |
609 |
1.37e1 |
SMART |
LRR
|
611 |
633 |
8.48e0 |
SMART |
LRRCT
|
646 |
698 |
1.07e-10 |
SMART |
transmembrane domain
|
705 |
724 |
N/A |
INTRINSIC |
TIR
|
756 |
901 |
2.43e-26 |
SMART |
|
Predicted Effect |
probably benign
PolyPhen 2
Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
(Using ENSMUST00000034056)
|
SMART Domains |
Protein: ENSMUSP00000126556 Gene: ENSMUSG00000031639 AA Change: V721A
Domain | Start | End | E-Value | Type |
LRRNT
|
28 |
56 |
1.14e1 |
SMART |
LRR
|
50 |
74 |
1.33e1 |
SMART |
LRR_TYP
|
99 |
122 |
4.72e-2 |
SMART |
LRR
|
123 |
146 |
2.47e2 |
SMART |
LRR
|
171 |
194 |
3.36e1 |
SMART |
LRR
|
198 |
220 |
7.57e0 |
SMART |
low complexity region
|
224 |
238 |
N/A |
INTRINSIC |
low complexity region
|
252 |
263 |
N/A |
INTRINSIC |
LRR
|
274 |
297 |
1.06e1 |
SMART |
LRR_TYP
|
298 |
321 |
1.28e-3 |
SMART |
LRR
|
355 |
378 |
6.23e1 |
SMART |
LRR
|
379 |
404 |
3.18e2 |
SMART |
LRR
|
405 |
430 |
8.98e1 |
SMART |
LRR
|
431 |
455 |
6.78e1 |
SMART |
LRR_TYP
|
506 |
529 |
1.79e-2 |
SMART |
LRR
|
530 |
553 |
2.63e0 |
SMART |
LRR_TYP
|
562 |
585 |
1.56e-2 |
SMART |
LRR
|
586 |
609 |
1.37e1 |
SMART |
LRR
|
611 |
633 |
8.48e0 |
SMART |
LRRCT
|
646 |
698 |
1.07e-10 |
SMART |
transmembrane domain
|
705 |
724 |
N/A |
INTRINSIC |
TIR
|
756 |
901 |
2.43e-26 |
SMART |
|
Predicted Effect |
probably benign
PolyPhen 2
Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
(Using ENSMUST00000167106)
|
Predicted Effect |
probably benign
PolyPhen 2
Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
(Using ENSMUST00000209772)
|
Predicted Effect |
probably benign
PolyPhen 2
Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
(Using ENSMUST00000210013)
|
Meta Mutation Damage Score |
0.0692 |
Is this an essential gene? |
Probably nonessential (E-score: 0.175) |
Phenotypic Category |
Autosomal Semidominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All mutations/alleles(6) : Targeted(6)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00162:Tlr3
|
APN |
8 |
45853727 |
missense |
probably damaging |
0.99 |
IGL01820:Tlr3
|
APN |
8 |
45851376 |
missense |
probably benign |
|
IGL02504:Tlr3
|
APN |
8 |
45850944 |
missense |
probably damaging |
1.00 |
IGL02523:Tlr3
|
APN |
8 |
45851428 |
splice site |
probably null |
|
IGL03166:Tlr3
|
APN |
8 |
45855965 |
missense |
probably benign |
0.05 |
IGL03287:Tlr3
|
APN |
8 |
45855817 |
missense |
probably benign |
|
Ultraman
|
UTSW |
8 |
45856018 |
missense |
probably damaging |
1.00 |
E0354:Tlr3
|
UTSW |
8 |
45853857 |
missense |
probably damaging |
1.00 |
R0960:Tlr3
|
UTSW |
8 |
45850452 |
missense |
probably damaging |
1.00 |
R1175:Tlr3
|
UTSW |
8 |
45850171 |
missense |
probably damaging |
1.00 |
R1332:Tlr3
|
UTSW |
8 |
45851774 |
missense |
probably damaging |
0.99 |
R1477:Tlr3
|
UTSW |
8 |
45851202 |
missense |
probably damaging |
1.00 |
R1667:Tlr3
|
UTSW |
8 |
45853874 |
missense |
probably benign |
0.00 |
R1755:Tlr3
|
UTSW |
8 |
45851010 |
missense |
probably benign |
|
R1996:Tlr3
|
UTSW |
8 |
45850734 |
missense |
probably benign |
0.08 |
R2012:Tlr3
|
UTSW |
8 |
45855823 |
missense |
possibly damaging |
0.91 |
R2288:Tlr3
|
UTSW |
8 |
45850705 |
missense |
probably damaging |
0.98 |
R2895:Tlr3
|
UTSW |
8 |
45850629 |
missense |
possibly damaging |
0.89 |
R3837:Tlr3
|
UTSW |
8 |
45849976 |
missense |
probably damaging |
1.00 |
R4905:Tlr3
|
UTSW |
8 |
45852260 |
critical splice acceptor site |
probably null |
|
R4934:Tlr3
|
UTSW |
8 |
45850072 |
missense |
probably benign |
0.10 |
R5025:Tlr3
|
UTSW |
8 |
45856075 |
missense |
probably benign |
0.00 |
R5086:Tlr3
|
UTSW |
8 |
45855862 |
missense |
probably damaging |
0.96 |
R5129:Tlr3
|
UTSW |
8 |
45856018 |
missense |
probably damaging |
1.00 |
R5320:Tlr3
|
UTSW |
8 |
45852137 |
missense |
possibly damaging |
0.95 |
R5411:Tlr3
|
UTSW |
8 |
45849992 |
missense |
probably benign |
0.01 |
R5497:Tlr3
|
UTSW |
8 |
45851851 |
missense |
possibly damaging |
0.60 |
R5498:Tlr3
|
UTSW |
8 |
45851851 |
missense |
possibly damaging |
0.60 |
R5499:Tlr3
|
UTSW |
8 |
45851851 |
missense |
possibly damaging |
0.60 |
R5501:Tlr3
|
UTSW |
8 |
45851851 |
missense |
possibly damaging |
0.60 |
R5731:Tlr3
|
UTSW |
8 |
45851157 |
missense |
probably benign |
0.00 |
R5761:Tlr3
|
UTSW |
8 |
45855808 |
missense |
probably benign |
0.00 |
R5992:Tlr3
|
UTSW |
8 |
45850851 |
missense |
probably benign |
|
R6031:Tlr3
|
UTSW |
8 |
45851565 |
missense |
probably damaging |
1.00 |
R6031:Tlr3
|
UTSW |
8 |
45851565 |
missense |
probably damaging |
1.00 |
R6104:Tlr3
|
UTSW |
8 |
45856130 |
missense |
probably benign |
0.00 |
R6289:Tlr3
|
UTSW |
8 |
45849966 |
missense |
probably benign |
0.04 |
R6372:Tlr3
|
UTSW |
8 |
45850048 |
missense |
probably damaging |
1.00 |
R6470:Tlr3
|
UTSW |
8 |
45850422 |
missense |
probably damaging |
1.00 |
R6486:Tlr3
|
UTSW |
8 |
45851650 |
splice site |
probably null |
|
R6504:Tlr3
|
UTSW |
8 |
45850486 |
missense |
possibly damaging |
0.79 |
R6721:Tlr3
|
UTSW |
8 |
45851917 |
missense |
probably benign |
0.00 |
R7089:Tlr3
|
UTSW |
8 |
45850810 |
missense |
probably benign |
0.02 |
R7169:Tlr3
|
UTSW |
8 |
45850056 |
missense |
probably damaging |
1.00 |
R7679:Tlr3
|
UTSW |
8 |
45852088 |
missense |
probably benign |
|
R7771:Tlr3
|
UTSW |
8 |
45856076 |
missense |
probably benign |
|
R7863:Tlr3
|
UTSW |
8 |
45850774 |
missense |
probably benign |
0.00 |
R7896:Tlr3
|
UTSW |
8 |
45850090 |
nonsense |
probably null |
|
R8009:Tlr3
|
UTSW |
8 |
45853819 |
missense |
not run |
|
R8219:Tlr3
|
UTSW |
8 |
45851016 |
missense |
possibly damaging |
0.95 |
R8397:Tlr3
|
UTSW |
8 |
45851896 |
missense |
possibly damaging |
0.94 |
R8411:Tlr3
|
UTSW |
8 |
45849978 |
missense |
probably damaging |
1.00 |
R8539:Tlr3
|
UTSW |
8 |
45851553 |
missense |
probably damaging |
1.00 |
R8786:Tlr3
|
UTSW |
8 |
45851286 |
missense |
possibly damaging |
0.94 |
R8916:Tlr3
|
UTSW |
8 |
45856076 |
missense |
probably benign |
|
R9282:Tlr3
|
UTSW |
8 |
45851643 |
missense |
probably benign |
0.12 |
R9609:Tlr3
|
UTSW |
8 |
45850117 |
missense |
probably benign |
0.02 |
R9731:Tlr3
|
UTSW |
8 |
45850944 |
missense |
probably damaging |
1.00 |
Z1177:Tlr3
|
UTSW |
8 |
45851020 |
missense |
probably damaging |
1.00 |
|
Mode of Inheritance |
Autosomal Semidominant |
Local Stock | |
MMRRC Submission |
038219-MU
|
Last Updated |
2019-09-04 9:45 PM
by Katherine Timer
|
Record Created |
2015-05-07 10:52 AM
by Lei Sun
|
Record Posted |
2015-09-22 |
Phenotypic Description |
The Rakshasa phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1996, some of which exhibited decreased TNFα secretion from macrophages in response to the Toll-like receptor 3 (TLR3) ligand, poly(I:C) (Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 88 mutations. The diminished poly(I:C)-induced TNFα secretion phenotype was linked by continuous variable mapping to a mutation in Tlr3: a T to C transversion at base pair 45,397,697 (v38) on chromosome 8, or base pair 14,253 in the GenBank genomic region NC_000074. Linkage was found with a dominant model of inheritance (P = 1.87 x 10-4), wherein 2 variant homozygotes and eight heterozygotes departed phenotypically from 14 homozygous reference mice (Figure 2).
The mutation corresponds to residue 2,523 in the mRNA sequence NM_126166 within exon 6 of 7 total exons.
2507 GTTTTTATACTTGTGGTACTGCTCATTCACATC
216 -V--F--I--L--V--V--L--L--I--H--I-
|
The mutated nucleotide is indicated in red. The mutation results in a valine (V) to alanine (A) substitution at position 721 (V271A) in the TLR3 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.084) (1).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
TLR3 is a type I integral membrane glycoprotein containing 905 amino acids (Figure 3). Like the other TLRs, its cytoplasmic domain (at its C terminus) shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (2-4), which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs and in IL receptors contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (5). In addition, TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) that are connected by seven loops (named for the α-helix and β-strand they connect; e.g. AA connects βA with αA). The crystal structures of the TLR1 and TLR2 TIR domains reveal that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (6) (see the record for languid for a picture of the TLR2 TIR domain). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of an alanine to proline mutation in the BB loop of TLR3 (Ala795Pro), which has been reported to abolish TRIF-dependent IRF3 responses and promote MyD88-dependent responses (7). The extracellular domains of TLRs, unlike those of the interleukin receptors, contain multiple leucine-rich repeats (LRRs), which mediate ligand recognition by TLRs. LRRs consist of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) followed by XØXXØX4FXXLX (residues ~11-24, but variable in length, sequence and structure), where X is any amino acid and Øis a hydrophobic amino acid [discussed in (8)]. TLR3 has 23 predicted LRRs in its ectodomain along with the LRR-NT (LRR N-terminal) and LRR-CT (LRR-C-terminal) regions encoded by the N-terminal half of the protein. Crystal structures of several TLRs reveal that each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (9-12). In addition, the XLXXLXLXX sequence folds into a β-strand, with the remaining LRR residues oriented on the convex side of the structure. Some LRRs contain insertions of up to 16 amino acids following positions 10 or 15 in the LRR consensus sequence, a common occurrence among LRRs of many TLRs. In TLR3, insertions in two of the LRRs extend outward from the convex face of the protein [Figure 4; PDB ID 3CIY; (10;12;13)]. For TLR7, 8 and 9, LRRs 2, 5 and 8 contain long insertions following the tenth residue. These insertions, along with an insertion in LRR11, are positioned proximal to the β-strands formed by the first ten residues. These four insertions may contribute to the ligand-binding site (8). The two TLR3 monomers interact between the two LRR-CT domains. Each extracellular domain of TLR3 binds dsRNA at two sites at opposite ends of the structure. LRR19 and LRR20 comprise the first dsRNA binding site in TLR3. The second dsRNA binding site is comprised of LRR-NT, LRR1, LRR2, and LRR3. Deletion of the insertion within LRR12 did not have an effect on TLR3 stimulation, but deletion of the LRR20 insertion resulted in a significant loss of TLR3 activity (14). The loss of the LRR20 insertion may disrupt the structure of TLR3 near residues essential for ligand binding. The consensus leucine side chains of the LRRs point towards the interior and form a hydrophobic core. The first eight residues of each LRR contribute a β-strand to an extended parallel β-sheet that forms the concave, inner surface of the molecule. The LRR-NT motif has a hairpin loop that is stabilized by a disulfide bond. The LRR-CT motif is globular in structure, and contains an internal α-helix and two disulfide bonds, both of which are essential for TLR3 function (15). The TLR3 ectodomain has 15 putative N-glycosylation sites. The glycans are distributed on the concave, convex, and on the N-terminal side of the β-sheet of the ectodomain. The ribose-phosphate backbone of dsRNA interacts with the glycan-free surfaces of a TLR3 ectodomain homodimer. His539 is essential for ligand-dependent activation of TLR3 (14). Asn541 is essential for dsRNA recognition (14). Mutation of His539 to glutamic acid (H539E) and Asn541 to alanine (N541A) results in loss of dsRNA binding. Similar to other endosomal TLRs, TLR3 undergoes proteolytic processing to confer stability and endosomal localization (16). The ectodomain of TLR3 is cleaved between residues 342 and 343 (16). Phosphorylation of TLR3 is required for the recruitment of the adaptor protein TICAM-1 (TRIF), which mediates downstream signaling. Phosphorylation of Tyr759 and Tyr858 are sufficient to promote downstream signaling (17). The tyrosines c-Src (18) and epidermal growth factor receptor (EGFR; see the record for Velvet) (19) mediate TLR3 phosphorylation. The Rakshasha mutation results in a valine (V) to alanine (A) substitution at position 721 (V271A) in the TLR3 protein, which lies within the transmembrane domain.
|
Expression/Localization | TLR3 is expressed in myeloid dendritic cells (20), macrophages (21), mast cells, CD8+ T cells (22), γδ T cells, and natural killer cells (23) as well as fibroblasts, epithelial cells (24;25), the retina (26), hepatocytes (27;28), keratinocytes (29), and the nervous system including neurons, oligodendrocytes, astrocytes, and microglia (30-32). TLR3 mRNA is expressed in human placenta, pancreas, lung, liver, heart, lymph nodes, and brain (20;33). In resting cells, TLR3 is localized in the endoplasmic reticulum and at endosomal/lysosomal membranes. Upon TLR3 stimulation, TLR3 interacts with UNC-93B (see the record for 3d), which assists in trafficking of TLR3 to the endosome. TRL3 localizes to the early endosome in myeloid DCs (34), but on both the cell surface and early endosome in macrophages, splenic CD8+ dendritic cells, marginal zone B cells, lung fibroblasts, and some epithelial cell lines (16;35;36). TLR3 expression in DCs is upregulated by viral infection and exogenous addition of poly(I:C) or type I IFN (37).
|
Background |
Toll-like receptors (TLRs) play an essential role in the innate immune response as key sensors of invading microorganisms by recognizing conserved molecular motifs found in many different pathogens, including bacteria, fungi, protozoa and viruses. The twelve mouse TLRs and ten human TLRs recognize a wide range of structurally distinct molecules, and all signal through only four adaptor proteins known to date: MyD88, Tirap (Mal), TICAM-1 (TRIF) and TRAM (Figure 5). TLR signaling through these adaptors initiates a cascade of signaling events involving various kinases, adaptors and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7. TLR3 is an endosomal TLR along with TLR7 (see the record for rsq1), TLR8, and TLR9 (see the record for Cpg1). The endosomal TLRs recognize exogenous nucleic acids: double-stranded DNA unmethylated at CpG motifs [TLR9; (2)], single-stranded (ss) RNA viruses (TLR7 and TLR8; (38)] and double-stranded RNA (dsRNA; TLR3]. TLR3 recognizes both virus-derived dsRNA and the synthetic dsRNA, poly(I:C) [Figure 6; (35;39)]. TLR3 recognizes dsRNA in a sequence-independent manner. Recently, an RNA structure was identified that mediates TLR3 recognition of RNA. The RNA contains an incomplete stem with bulge and internal loops, but is able to induce type I interferons and pro-inflammatory cytokines (40). 5’-Triphosphorylation of dsRNA is essential for TLR3 recognition. In addition, 2’-hydroxy groups are essential for TLR3 activation by poly(I:C). dsRNA exists both as a viral genome and can be generated in the cytosol during replication of positive-strand RNA viruses (e.g., poliovirus, coxsackievirus group B serotype 3, and encephalomyocarditis) and DNA viruses [e.g., herpes simplex virus 1 [HSV1; (41)] and murine cytomegalovirus (MCMV)] (42). In the case of negative-strand RNA viruses, TLR3-mediated signaling can intensify the immune response to infection (43;44). Tlr3-deficient mice are susceptible to encephalomyocardititis virus (ECMV) (45), coxsackievirus group B3 (CVB3) (46), CVB4 (47), poliovirus (48;49), MCMV (50), HSV-1 (51), Theiler’s murine encephalomyelitis virus (TMEV) (52), vesicular stomatitis virus (VSV) (53), LCMV (53), Vaccinia virus (54), influenza virus (43), T3 reovirus (53), Punta toro virus (PTV) (44), and West Nile Virus (WNV) (55). A polymorphism in TLR3 (rs3775291, Leu412Phe) confers resistance to HIV-1 infection (56). The 412Phe allele occurs in approximately 30% of the population with European and Asian ancestry. The 412Phe allele is more common among a population of Spanish HIV-1-exposed seronegative individuals when compared to controls. The TLR3412Phe protein exhibits reduced poly(I:C)-stimulated activation. TLR3 mediates downstream signaling through TICAM-1 [Toll-interleukin 1 receptor (TIR) domain-containing adaptor molecule-1; hereafter TRIF (TIR domain-containing adaptor inducing IFN-β); see the record for Lps2] (57). In the TRIF-dependent pathway, TRIF recruits polyubiquitinated RIP1 (58), which interacts with TRAF6, an E3 ubiquitin ligase that also coordinates the activation of several kinases including TAK-1 and in turn MAP kinases and the IKK complex leading to NF-κB activation. TRIF signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3. TRIF-mediated MyD88-independent pathway induces a late-phase activation of NF-κB and MAP kinases, while MyD88-dependent pathway induces an early-phase activation of NF-κB and MAP kinases.
|
Putative Mechanism | The defective poly(I:C)-induced TLR signaling defect observed in Rakshasa indicates that TLR3Rakshasa exhibits loss-of-function. The mutation affects amino acid 721 within the transmembrane domain and is not predicted to be a residue involved in dsRNA binding or recognition of downstream signaling proteins.
|
Primers |
PCR Primer
Rakshasa_pcr_F: CCATTGGGGAGAAATGTTCCC
Rakshasa_pcr_R: AATCCGTTCGACTGCACGTG
Sequencing Primer
Rakshasa_seq_F: TTGGGGAGAAATGTTCCCAGACC
Rakshasa_seq_R: CGACTGCACGTGTGAAAGTATTTCC
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 400 nucleotides is amplified (chromosome 8, - strand):
1 aatccgttcg actgcacgtg tgaaagtatt tcctggtttg ttaactggat caaccagacc 61 cacactaata tctctgagct gtccactcac tacctctgta acactccaca tcattattat 121 ggcttccccc tgaagctttt cgatacatca tcctgtaaag acagcgcccc ctttgaactc 181 ctcttcataa tcagcaccag tatgctcctg gtttttatac ttgtggtact gctcattcac 241 atcgagggct ggaggatctc tttttactgg aatgtttcag tgcatcggat tcttggtttc 301 aaggaaatag acacacaggc tgagcagttt gaatatacag cctacataat tcatgcccat 361 aaagacagag actgggtctg ggaacatttc tccccaatgg
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.
2. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., and Akira, S. (2000) A Toll-Like Receptor Recognizes Bacterial DNA. Nature. 408, 740-745.
3. Du, X., Poltorak, A., Wei, Y., and Beutler, B. (2000) Three Novel Mammalian Toll-Like Receptors: Gene Structure, Expression, and Evolution. Eur Cytokine Netw. 11, 362-371.
5. Slack, J. L., Schooley, K., Bonnert, T. P., Mitcham, J. L., Qwarnstrom, E. E., Sims, J. E., and Dower, S. K. (2000) Identification of Two Major Sites in the Type I Interleukin-1 Receptor Cytoplasmic Region Responsible for Coupling to Pro-Inflammatory Signaling Pathways. J Biol Chem. 275, 4670-4678.
6. Xu, Y., Tao, X., Shen, B., Horng, T., Medzhitov, R., Manley, J. L., and Tong, L. (2000) Structural Basis for Signal Transduction by the Toll/interleukin-1 Receptor Domains. Nature. 408, 111-115.
8. Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-Rich Repeats and Pathogen Recognition in Toll-Like Receptors. Trends Immunol. 24, 528-533.
9. Jin, M. S., Kim, S. E., Heo, J. Y., Lee, M. E., Kim, H. M., Paik, S. G., Lee, H., and Lee, J. O. (2007) Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide. Cell. 130, 1071-1082.
10. Bell, J. K., Botos, I., Hall, P. R., Askins, J., Shiloach, J., Segal, D. M., and Davies, D. R. (2005) The Molecular Structure of the Toll-Like Receptor 3 Ligand-Binding Domain. Proc Natl Acad Sci U S A. 102, 10976-10980.
11. Kim, H. M., Park, B. S., Kim, J. I., Kim, S. E., Lee, J., Oh, S. C., Enkhbayar, P., Matsushima, N., Lee, H., Yoo, O. J., and Lee, J. O. (2007) Crystal Structure of the TLR4-MD-2 Complex with Bound Endotoxin Antagonist Eritoran. Cell. 130, 906-917.
13. Liu, L., Botos, I., Wang, Y., Leonard, J. N., Shiloach, J., Segal, D. M., and Davies, D. R. (2008) Structural Basis of Toll-Like Receptor 3 Signaling with Double-Stranded RNA. Science. 320, 379-381.
14. Bell, J. K., Askins, J., Hall, P. R., Davies, D. R., and Segal, D. M. (2006) The dsRNA Binding Site of Human Toll-Like Receptor 3. Proc Natl Acad Sci U S A. 103, 8792-8797.
15. Ranjith-Kumar, C. T., Miller, W., Xiong, J., Russell, W. K., Lamb, R., Santos, J., Duffy, K. E., Cleveland, L., Park, M., Bhardwaj, K., Wu, Z., Russell, D. H., Sarisky, R. T., Mbow, M. L., and Kao, C. C. (2007) Biochemical and Functional Analyses of the Human Toll-Like Receptor 3 Ectodomain. J Biol Chem. 282, 7668-7678.
16. Murakami, Y., Fukui, R., Motoi, Y., Kanno, A., Shibata, T., Tanimura, N., Saitoh, S., and Miyake, K. (2014) Roles of the Cleaved N-Terminal TLR3 Fragment and Cell Surface TLR3 in Double-Stranded RNA Sensing. J Immunol. 193, 5208-5217.
17. Sarkar, S. N., Elco, C. P., Peters, K. L., Chattopadhyay, S., and Sen, G. C. (2007) Two Tyrosine Residues of Toll-Like Receptor 3 Trigger Different Steps of NF-Kappa B Activation. J Biol Chem. 282, 3423-3427.
18. Johnsen, I. B., Nguyen, T. T., Ringdal, M., Tryggestad, A. M., Bakke, O., Lien, E., Espevik, T., and Anthonsen, M. W. (2006) Toll-Like Receptor 3 Associates with c-Src Tyrosine Kinase on Endosomes to Initiate Antiviral Signaling. EMBO J. 25, 3335-3346.
19. Yamashita, M., Chattopadhyay, S., Fensterl, V., Saikia, P., Wetzel, J. L., and Sen, G. C. (2012) Epidermal Growth Factor Receptor is Essential for Toll-Like Receptor 3 Signaling. Sci Signal. 5, ra50.
20. Muzio, M., Bosisio, D., Polentarutti, N., D'amico, G., Stoppacciaro, A., Mancinelli, R., van't Veer, C., Penton-Rol, G., Ruco, L. P., Allavena, P., and Mantovani, A. (2000) Differential Expression and Regulation of Toll-Like Receptors (TLR) in Human Leukocytes: Selective Expression of TLR3 in Dendritic Cells. J Immunol. 164, 5998-6004.
21. Zhou, Y., Wang, X., Liu, M., Hu, Q., Song, L., Ye, L., Zhou, D., and Ho, W. (2010) A Critical Function of Toll-Like Receptor-3 in the Induction of Anti-Human Immunodeficiency Virus Activities in Macrophages. Immunology. 131, 40-49.
22. Tabiasco, J., Devevre, E., Rufer, N., Salaun, B., Cerottini, J. C., Speiser, D., and Romero, P. (2006) Human Effector CD8+ T Lymphocytes Express TLR3 as a Functional Coreceptor. J Immunol. 177, 8708-8713.
23. Schmidt, K. N., Leung, B., Kwong, M., Zarember, K. A., Satyal, S., Navas, T. A., Wang, F., and Godowski, P. J. (2004) APC-Independent Activation of NK Cells by the Toll-Like Receptor 3 Agonist Double-Stranded RNA. J Immunol. 172, 138-143.
24. Harada, K., Sato, Y., Itatsu, K., Isse, K., Ikeda, H., Yasoshima, M., Zen, Y., Matsui, A., and Nakanuma, Y. (2007) Innate Immune Response to Double-Stranded RNA in Biliary Epithelial Cells is Associated with the Pathogenesis of Biliary Atresia. Hepatology. 46, 1146-1154.
26. Kumar, M. V., Nagineni, C. N., Chin, M. S., Hooks, J. J., and Detrick, B. (2004) Innate Immunity in the Retina: Toll-Like Receptor (TLR) Signaling in Human Retinal Pigment Epithelial Cells. J Neuroimmunol. 153, 7-15.
27. Wang, N., Liang, Y., Devaraj, S., Wang, J., Lemon, S. M., and Li, K. (2009) Toll-Like Receptor 3 Mediates Establishment of an Antiviral State Against Hepatitis C Virus in Hepatoma Cells. J Virol. 83, 9824-9834.
28. Li, K., Chen, Z., Kato, N., Gale, M.,Jr, and Lemon, S. M. (2005) Distinct Poly(I-C) and Virus-Activated Signaling Pathways Leading to Interferon-Beta Production in Hepatocytes. J Biol Chem. 280, 16739-16747.
29. Tohyama, M., Dai, X., Sayama, K., Yamasaki, K., Shirakata, Y., Hanakawa, Y., Tokumaru, S., Yahata, Y., Yang, L., Nagai, H., Takashima, A., and Hashimoto, K. (2005) DsRNA-Mediated Innate Immunity of Epidermal Keratinocytes. Biochem Biophys Res Commun. 335, 505-511.
31. Town, T., Jeng, D., Alexopoulou, L., Tan, J., and Flavell, R. A. (2006) Microglia Recognize Double-Stranded RNA Via TLR3. J Immunol. 176, 3804-3812.
32. Cameron, J. S., Alexopoulou, L., Sloane, J. A., DiBernardo, A. B., Ma, Y., Kosaras, B., Flavell, R., Strittmatter, S. M., Volpe, J., Sidman, R., and Vartanian, T. (2007) Toll-Like Receptor 3 is a Potent Negative Regulator of Axonal Growth in Mammals. J Neurosci. 27, 13033-13041.
34. Matsumoto, M., Funami, K., Tanabe, M., Oshiumi, H., Shingai, M., Seto, Y., Yamamoto, A., and Seya, T. (2003) Subcellular Localization of Toll-Like Receptor 3 in Human Dendritic Cells. J Immunol. 171, 3154-3162.
35. Matsumoto, M., Kikkawa, S., Kohase, M., Miyake, K., and Seya, T. (2002) Establishment of a Monoclonal Antibody Against Human Toll-Like Receptor 3 that Blocks Double-Stranded RNA-Mediated Signaling. Biochem Biophys Res Commun. 293, 1364-1369.
36. Funami, K., Matsumoto, M., Oshiumi, H., Akazawa, T., Yamamoto, A., and Seya, T. (2004) The Cytoplasmic 'Linker Region' in Toll-Like Receptor 3 Controls Receptor Localization and Signaling. Int Immunol. 16, 1143-1154.
37. Heinz, S., Haehnel, V., Karaghiosoff, M., Schwarzfischer, L., Muller, M., Krause, S. W., and Rehli, M. (2003) Species-Specific Regulation of Toll-Like Receptor 3 Genes in Men and Mice. J Biol Chem. 278, 21502-21509.
38. Heil, F., Hemmi, H., Hochrein, H., Ampenberger, F., Kirschning, C., Akira, S., Lipford, G., Wagner, H., and Bauer, S. (2004) Species-Specific Recognition of Single-Stranded RNA Via Toll-Like Receptor 7 and 8. Science. 303, 1526-1529.
41. Zhang, S. Y., Jouanguy, E., Ugolini, S., Smahi, A., Elain, G., Romero, P., Segal, D., Sancho-Shimizu, V., Lorenzo, L., Puel, A., Picard, C., Chapgier, A., Plancoulaine, S., Titeux, M., Cognet, C., von Bernuth, H., Ku, C. L., Casrouge, A., Zhang, X. X., Barreiro, L., Leonard, J., Hamilton, C., Lebon, P., Heron, B., Vallee, L., Quintana-Murci, L., Hovnanian, A., Rozenberg, F., Vivier, E., Geissmann, F., Tardieu, M., Abel, L., and Casanova, J. L. (2007) TLR3 Deficiency in Patients with Herpes Simplex Encephalitis. Science. 317, 1522-1527.
42. Weber, F., Wagner, V., Rasmussen, S. B., Hartmann, R., and Paludan, S. R. (2006) Double-Stranded RNA is Produced by Positive-Strand RNA Viruses and DNA Viruses but Not in Detectable Amounts by Negative-Strand RNA Viruses. J Virol. 80, 5059-5064.
43. Le Goffic, R., Balloy, V., Lagranderie, M., Alexopoulou, L., Escriou, N., Flavell, R., Chignard, M., and Si-Tahar, M. (2006) Detrimental Contribution of the Toll-Like Receptor (TLR)3 to Influenza A Virus-Induced Acute Pneumonia. PLoS Pathog. 2, e53.
44. Gowen, B. B., Hoopes, J. D., Wong, M. H., Jung, K. H., Isakson, K. C., Alexopoulou, L., Flavell, R. A., and Sidwell, R. W. (2006) TLR3 Deletion Limits Mortality and Disease Severity due to Phlebovirus Infection. J Immunol. 177, 6301-6307.
45. Hardarson, H. S., Baker, J. S., Yang, Z., Purevjav, E., Huang, C. H., Alexopoulou, L., Li, N., Flavell, R. A., Bowles, N. E., and Vallejo, J. G. (2007) Toll-Like Receptor 3 is an Essential Component of the Innate Stress Response in Virus-Induced Cardiac Injury. Am J Physiol Heart Circ Physiol. 292, H251-8.
46. Negishi, H., Osawa, T., Ogami, K., Ouyang, X., Sakaguchi, S., Koshiba, R., Yanai, H., Seko, Y., Shitara, H., Bishop, K., Yonekawa, H., Tamura, T., Kaisho, T., Taya, C., Taniguchi, T., and Honda, K. (2008) A Critical Link between Toll-Like Receptor 3 and Type II Interferon Signaling Pathways in Antiviral Innate Immunity. Proc Natl Acad Sci U S A. 105, 20446-20451.
48. Abe, Y., Fujii, K., Nagata, N., Takeuchi, O., Akira, S., Oshiumi, H., Matsumoto, M., Seya, T., and Koike, S. (2012) The Toll-Like Receptor 3-Mediated Antiviral Response is Important for Protection Against Poliovirus Infection in Poliovirus Receptor Transgenic Mice. J Virol. 86, 185-194.
49. Oshiumi, H., Okamoto, M., Fujii, K., Kawanishi, T., Matsumoto, M., Koike, S., and Seya, T. (2011) The TLR3/TICAM-1 Pathway is Mandatory for Innate Immune Responses to Poliovirus Infection. J Immunol. 187, 5320-5327.
50. Tabeta, K., Georgel, P., Janssen, E., Du, X., Hoebe, K., Crozat, K., Mudd, S., Shamel, L., Sovath, S., Goode, J., Alexopoulou, L., Flavell, R. A., and Beutler, B. (2004) Toll-Like Receptors 9 and 3 as Essential Components of Innate Immune Defense Against Mouse Cytomegalovirus Infection. Proc Natl Acad Sci U S A. 101, 3516-3521.
51. Davey, G. M., Wojtasiak, M., Proietto, A. I., Carbone, F. R., Heath, W. R., and Bedoui, S. (2010) Cutting Edge: Priming of CD8 T Cell Immunity to Herpes Simplex Virus Type 1 Requires Cognate TLR3 Expression in Vivo. J Immunol. 184, 2243-2246.
52. Jin, Y. H., Kaneyama, T., Kang, M. H., Kang, H. S., Koh, C. S., and Kim, B. S. (2011) TLR3 Signaling is either Protective Or Pathogenic for the Development of Theiler's Virus-Induced Demyelinating Disease Depending on the Time of Viral Infection. J Neuroinflammation. 8, 178-2094-8-178.
53. Edelmann, K. H., Richardson-Burns, S., Alexopoulou, L., Tyler, K. L., Flavell, R. A., and Oldstone, M. B. (2004) Does Toll-Like Receptor 3 Play a Biological Role in Virus Infections? Virology. 322, 231-238.
54. Hutchens, M., Luker, K. E., Sottile, P., Sonstein, J., Lukacs, N. W., Nunez, G., Curtis, J. L., and Luker, G. D. (2008) TLR3 Increases Disease Morbidity and Mortality from Vaccinia Infection. J Immunol. 180, 483-491.
55. Wang, T., Town, T., Alexopoulou, L., Anderson, J. F., Fikrig, E., and Flavell, R. A. (2004) Toll-Like Receptor 3 Mediates West Nile Virus Entry into the Brain Causing Lethal Encephalitis. Nat Med. 10, 1366-1373.
56. Sironi, M., Biasin, M., Cagliani, R., Forni, D., De Luca, M., Saulle, I., Lo Caputo, S., Mazzotta, F., Macias, J., Pineda, J. A., Caruz, A., and Clerici, M. (2012) A Common Polymorphism in TLR3 Confers Natural Resistance to HIV-1 Infection. J Immunol. 188, 818-823.
57. Hoebe, K., Janssen, E. M., Kim, S. O., Alexopoulou, L., Flavell, R. A., Han, J., and Beutler, B. (2003) Upregulation of Costimulatory Molecules Induced by Lipopolysaccharide and Double-Stranded RNA Occurs by Trif-Dependent and Trif-Independent Pathways. Nat Immunol. 4, 1223-1229.
58. Meylan, E., Burns, K., Hofmann, K., Blancheteau, V., Martinon, F., Kelliher, M., and Tschopp, J. (2004) RIP1 is an Essential Mediator of Toll-Like Receptor 3-Induced NF-Kappa B Activation. Nat Immunol. 5, 503-507.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine, Peter Jurek, Katherine Timer |
Authors | Lei Sun and Bruce Beutler |