Allele | geodude | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 72,992,263 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ C (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Rab27a | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | RAB27A, member RAS oncogene family | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | 2410003M20Rik, 4933437C11Rik, 2210402C08Rik | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 72,952,136-73,004,911 bp (+) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: The protein encoded by this gene is a member of the Rab family of proteins, which is the largest family within the Ras superfamily of GTPases. This gene product is thought to regulate vesicular transport, together with its specific effectors. Mutations in this gene cause several defects, including actin-based melanosome transport defects and immunodeficiency. Mutations in the human ortholog of this gene are associated with Griscelli syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] PHENOTYPE: Homozygotes have abnormal melanocyte development producing abnormal pigmentation and a gray coat color. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Leucine changed to Proline | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000034722] [ENSMUSP00000139310] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9ERI2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure | Crystal Structure of the complex Rab27a-Slp2a [X-RAY DIFFRACTION] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000034722 Gene: ENSMUSG00000032202 AA Change: L97P
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000139310 Gene: ENSMUSG00000032202 AA Change: L97P
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9665 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Possibly nonessential (E-score: 0.474) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All mutations/alleles(158) : Chemically induced (ENU)(2) Gene trapped(151) Spontaneous(2) Targeted(3) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 038203-MU | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-10-14 4:02 PM by Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2015-05-27 11:09 AM by Carlos Reyna | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2015-06-11 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The geodude phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2497, some of which exhibited a dark gray coat color (Figure 1) as well as increased viral titres in the liver after mouse cytomegalovirus (MCMV) infection (Figure 2). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. Among these, only one affected a gene with known effects on pigmentation, Rab27a. The mutation in Rab27a was presumed to be causative because the geodude hypopigmenation phenotype mimics other known alleles of Rab27a (see MGI for a list of Rab27a alleles and the record for concrete). The Rab27a mutation is a T to C transition at base pair 73,084,981 (v38) on chromosome 9, or base pair 40,172 in the GenBank genomic region NC_000075. The mutation corresponds to residue 663 in the mRNA sequence NM_001301230 (isoform 1) within exon 5 of 7 total exons, residue 514 in the mRNA sequence NM_023635 (isoform 2) within exon 4 of 6 total exons, and residue 556 in the mRNA sequence NM_001301232 (isoform 3) within exon 4 of 6 total exons.
Genomic numbering corresponds to NC_000075. The mutated nucleotide is indicated in red. The mutation results in a leucine (L) to proline (P) substitution at position 97 (L97P) in all of the isoforms of the Rab27a protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.00) (1). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Rab27a and Rab27b form the Rab27 subfamily of Rab proteins, which are low molecular weight GTPases that function in membrane trafficking and vesicular fusion and targeting. The presence of five sequence motifs designated Rab family motif (RabF) 1-5 distinguishes Rabs from other small GTPases (2). In addition, four regions designated Rab subfamily motif (RabSF) 1-4 share high amino acid sequence identity among Rabs of the same subfamily. Rab27a contains four consensus sequences that mediate GTP-binding of Rabs (Figure 3) (3;4). The phosphate-interacting domain consists of six residues (DTAGQE) that are strictly conserved in all small GTPases. The C-terminus of Rab27a contains a dicysteine motif (CXC), one of four consensus isoprenylation motifs present in Rabs (3;4), to which Rab geranylgeranyl transferase (GGTase) attaches two geranylgeranyl groups that serve to target Rab27a to target membranes (5). The geodude mutation results in the conversion of leucine 97 to a proline within the RabF5 motif. Please see the record concrete for information about Rab27a. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Rabs are molecular switches, cycling between an inactive GDP-bound and an active GTP-bound state. Rab27a regulates the exocytosis of lysosome related organelles from cytotoxic T lymphocytes, melanocytes, platelets, and endothelial cells, as well as the secretion of non-lysosome organelles from several other cell types including insulin-containing secretory granules of pancreatic β cells (6-8), and secretory granules of PC12 and chromaffin cells (9). Mutation of Rab27a results in the mouse phenotype ashen (ash), in which mice have a light coat color due to defects in pigment granule transport (10). In Rab27aash mice, melanosomes are synthesized normally, but cluster in the perinuclear region, resulting in uneven and impaired release of melanin (11). In humans, mutations in RAB27A cause Griscelli syndrome type II, which is characterized by partial albinism and hemophagocytic syndrome [OMIM #607624; (12)]. Hemophagocytic syndrome (also called hemophagocytic lymphohistiocytosis, HLH) is characterized by polyclonal CD8 T cell and macrophage activation and infiltration of multiple organs, leading to death unless treated by bone marrow transplant (13). In Rab27aash mice, lytic granules of CTLs and natural killer (NK) cells are blocked at a late secretory step, successfully polarizing towards the immunological synapse (a microtubule-dependent step) but failing to fuse and release their contents (14;15). The hypopigmentation phenotype of the geodude mice indicates loss of function of Rab27ageodude. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer geodude_pcr_F: TTAGCTCCTCCTTTTGTGCCTTT geodude_pcr_R: TGGGGAAACCACACGTACTTATC Sequencing Primer geodude_seq_F: TACCTGGCTGCTGTTTCTTG geodude_seq_R: ACCACACGTACTTATCCAGT |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 405 nucleotides is amplified (chromosome 9, + strand): 1 ttagctcctc cttttgtgcc tttggctacc tggctgctgt ttcttgctcg ctctctctct Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Carlos Reyna Jamie Russell |