Phenotypic Mutation 'otiose'

• Allele: otiose
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 94,561,484 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Irak4
• Gene Name: interleukin-1 receptor-associated kinase 4
• Synonym(s): IRAK-4, 8430405M07Rik, NY-REN-64, 9330209D03Rik
• Chromosomal Location: 94,543,643-94,581,815 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] ; PHENOTYPE: Homozygous mutant mice exhibit defects of the innate immune system and show increased susceptibility to bacterial infection. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q8R4K2
• PDB Structure: Solution structure of the DEATH domain of Interleukin-1 receptor-associated kinase4 (IRAK4) from Mus musculus [SOLUTION NMR] ; Molecular Structure of the Interleukin-1 Receptor-Associated Kinase-4 Death Domain [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000074471; Gene: ENSMUSG00000059883; AA Change: I327T

Domain	Start	End	E-Value	Type
PDB:1WH4|A	1	114	1e-78	PDB
Pfam:Pkinase_Tyr	187	454	3.3e-53	PFAM
Pfam:Pkinase	187	456	4.9e-53	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000074936)
• SMART Domains: Protein: ENSMUSP00000104871; Gene: ENSMUSG00000059883; AA Change: I327T

Domain	Start	End	E-Value	Type
Pfam:Death	20	101	1.6e-6	PFAM
Pfam:Pkinase_Tyr	187	452	1.9e-51	PFAM
Pfam:Pkinase	188	452	1.3e-54	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000109248)
• Meta Mutation Damage Score: 0.3848
• Is this an essential gene?: Possibly nonessential (E-score: 0.463)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Embryos, Sperm, gDNA
• MMRRC Submission: 030625-UCD : 016983-UCD
• Last Updated: 2018-01-23 1:52 PM by Anne Murray
• Record Created: unknown
• Record Posted: 2007-09-24
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Michael Berger, Bruce Beutler

Accession Number

NCBI RefSeq: NM_029926; MGI: 2182474

Alleles Listed at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(3) Chemically induced(1)

Phenotypic Description

Figure 1. Responses of otiose macrophages to various TLR ligands. Otiose homozygous macrophages (diamonds) show little to no TNFα production in response to TLR1/2 signaling (A), TLR7 signaling (B), TLR9 signaling (C), and TLR2/6 signaling (D-F). Homozygous otiose macrophages showed partial TNFα responses to TLR4 signaling (G). TLR3 signaling is normal (H). Heterozygous otiose macrophages (triangles) responded normally to TLR signaling relative to wild type controls (squares).

The otiose phenotype was identified in a G3 screen for mutants with altered response to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Specifically, peritoneal macrophages from otiose mutants failed to produce (tumor necrosis factor) TNF-α in response to treatment with several TLR ligands: unmethylated CpG DNA (TLR9 ligand), resiquimod (TLR7 ligand), triacyl lipopeptides (TLR2/1 ligand), and peptidoglycans (TLR2/6 ligand). Lipopolysaccharide (LPS), a TLR4 ligand, stimulated production of detectable, but significantly reduced amounts of TNF-α. Otiose macrophages produced TNF-α at normal levels when treated with poly I:C, a TLR3 ligand (Figure 1).

Nature of Mutation

The otiose mutation was mapped to Chromosome 15, and corresponds to a T to C transition at position 1094 of the Irak4 transcript, in exon 9 of 12 total exons.

 

1078 GACTTTACTGCCAAAATATCTGACTTTGGGCTT

322  -D--F--T--A--K--I--S--D--F--G--L-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of isoleucine to threonine at residue 327 of the IRAK-4 protein.

Protein Prediction

Figure 2. Domain structure of IRAK-4. The death domain interacts with TIR-containing proteins, and the serine/threonine kinase domain phosphorylates targets such as IRAK-1. The location of the otiose mutation is indicated with a red asterisk within the kinase domain.

In mice, Irak4 contains 12 exons and encodes the 460-amino acid protein IRAK-4 (Figure 2). Like other IRAKs (IRAK-1, IRAK-2, and IRAK-M), IRAK-4 has an N-terminal death domain used to interact with TIR-containing proteins, and a serine/threonine kinase domain used to phosphorylate targets such as IRAK-1 (1-3). While other IRAKs have a long C-terminal domain, IRAK-4 has only a few amino acids following the kinase domain (3). IRAK-4 shares 30-40% amino acid identity with the other IRAKs. The otiose mutation results in an isoleucine to threonine change at position 327, located in subdomain 7 of the kinase domain, outside of the ATP-binding site.

 

No IRAK-4 protein was detectable by Western blot analysis in otiose macrophages, indicating that the otiose mutation effectively results in IRAK-4 deficiency. When overexpressed in HEK293 cells, although detectable, IRAK-4 T-C expression levels are far below that of the wild type protein. Furthermore, no kinase activity towards a substrate is observed when IRAK-4 T-C is immunoprecipitated and subject to an in vitro kinase assay.

Expression/Localization

IRAK-4 is highly expressed in kidney and liver, and at lower levels in most other tissues (3). The protein is localized in the cytoplasm.

Background

Figure 3. IRAK4 signaling pathways. IRAK4 transduces many innate immune signals from TLRs (1, 2, 4, 5, 6, 7, and 9), IL-1 receptor, and IL-18 receptor to downstream signaling components, leading to the induction of genes involved in inflammatory responses, such as pro-inflammatory cytokines IL-1, IL-6 and TNF. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Toll-like receptors (TLRs) play an essential role in the innate immune response as key sensors of invading microorganisms. Studies of IRAK-4 –deficient mice revealed that IRAK-4 transduces many innate immune signals from TLRs, IL-1 receptor, and IL-18 receptor to downstream signaling components, leading to the induction of genes involved in inflammatory responses, such as pro-inflammatory cytokines IL-1, IL-6 and TNF (4) (Figure 3). IRAK-4-deficient mice are highly resistant to a lethal dose of LPS (ligand for TLR4), exhibiting no signs of septic shock and greatly reduced levels of IL-1, IL-6 and TNF-α upon injection with LPS at a dose of 40 mg/kg body weight (5). Similarly reduced cytokine levels are observed upon stimulation of TLR9 and TLR2 (5). IL-6 and TNF-α are also severely diminished following IL-1 administration (5). Thus, cytokine induction downstream of TLRs and IL-1 is largely dependent upon IRAK-4, just as it is largely dependent upon MyD88.

 

Once activated, TLRs initiate a cascade of signaling events leading to the activation of NF-κB and MAP kinase, and induction of target gene expression [discussed in (4)]. For example, following LPS stimulation, TLR4 associates with the Toll and interleukin-1 receptor (TIR)-domain containing adaptor proteins TRIF and MyD88. IRAK-4, IRAK-1, IRF5 and TRAF6 are recruited to MyD88 at the receptor, where IRAK-4 phosphorylates IRAK-1 (1;6).  It is believed that IRAK4 is recruited to MyD88 through interaction of the death domains present in both proteins. Together, IRAK-1 and TRAF6 then dissociate from the receptor. TRAF6 interaction with TAK1 activates TAK1 to phosphorylate the IκB kinase (IKK) complex, which goes on to phosphorylate IκB. Phosphorylated IκB is targeted for ubiquitination and degradation, freeing NF-κB to translocate to the nucleus and activate gene expression. In addition to NF-κB, TAK1 also activates MAP kinase, leading to expression of AP-1-regulated genes (7). The signaling pathway from TLR4 through TRIF bypasses the IRAK complex, impinging directly on TRAF6 and leading to NF-κB activation. Thus, IRAK-4 is required for TLR signaling through MyD88.

 

The kinase activity of IRAK-4 is critical to its signaling function. Like IRAK-4 null mice, IRAK-4 kinase-inactive knock-in mice are completely resistant to LPS- and CpG-induced septic shock, displaying greatly reduced amounts of TNF-α and IL-6 (8). Co-immunoprecipitation studies indicate that IRAK-4 kinase activity is required for interaction with and activation of IRAK-1, but not for interaction with MyD88 (9). IRAK-4 kinase activity is required for MAP kinase activation (9), and for optimal NF-κB activation, although activation still occurs in IRAK-4 kinase-inactive knock-in macrophages (8;9). Interestingly, cytokine mRNA stability may be reduced in IRAK-4 kinase-inactive macrophages, while production remains normal (8). These data indicate that IRAK-4 kinase-independent mechanisms exist for the activation of NF-κB. However, these mechanisms are insufficient to compensate for the lack of kinase-dependent activities required for LPS- and CpG-induced immune responses.

Putative Mechanism

The otiose mutation effectively results in IRAK-4-deficient mice. Like targeted IRAK-4 knockout mice, otiose mice do not produce TNF-α in response to stimulation of TLR9, TLR7, TLR2/1 or TLR2/6, receptors which rely on MyD88 signaling to transduce their signals. On the other hand, the TLR3 ligand poly I:C, which does not signal through MyD88, stimulates normal levels TNF-α production. The fact that LPS induces production of TNF-α at all may be attributed to TRIF/TRAM-dependent signaling, which occurs independently of IRAK-4.

 

Patients with IRAK4 deficiency have recurrent life-threatening infections (10-12) (OMIM 606883). Lymphocytes and fibroblasts from these patients do not activate NF-κB or MAPK, and fail to induce cytokines upon TLR stimulation (10). Pyogenic bacteria were exclusively responsible for their infections, and patients showed resistance to most other microorganisms, such as Mycobacterium avium and Pneumocystis carinii (10). This may be due to patients’ more or less normal production of IFN-α, IFN-β and IFN-λ, stimulated through IRAK-4-independent pathways through TLR3 and TLR4 (13).

Primers

Primers cannot be located by automatic search.

Genotyping

Otiose genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Otiose(F): 5’-CTTGCTGTCATCTGAATAATTGACTGATTTG -3’

Otiose(R): 5’-GCTGTAGATGTCAGATTTGGGTGTTATTTCTC -3’

 

PCR program

1) 94°C             5:00

2) 94°C             0:30

3) 55°C             0:30

4) 68°C             1:00

5) repeat steps (2-4) 40X

6) 68°C            10:00

7) 4°C              ∞

 

Primers for sequencing

Otiose_seq(F): 5’-GATATCCTAGGCAAGAAGCATG -3’

Otiose_seq(R): 5’- AAGCCGTTGTGCCCACGATTC -3’

 

The following sequence of 404 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Irak4) is amplified:

 

17498                                         ctt gctgtcatct gaataattga

17521 ctgatttgaa tatatttcag tcttctctac tgcacatata aaatgacaca caatgtgaca

17581 tgtgcgtata taatatataa tatatagtat gtagaatgca tgatatatat atatatatat

17641 cacattatat acctcttcct aagaacctgt tggatatcct aggcaagaag catgttttcc

17701 accttcaaat ttaatttgtt ttccagtgca aatatcttac tagacaaaga ctttactgcc

17761 aaaatatctg actttgggct tgcacgggct tcggcaaggc tagcgcagac ggtcatgacc

17821 agccgaatcg tgggcacaac ggcttacatg gcacccgaag ctttgcgggg agaaataaca

17881 cccaaatctg acatctacag c

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

  1.  Lye, E., Mirtsos, C., Suzuki, N., Suzuki, S., and Yeh, W. C. (2004) The role of interleukin 1 receptor-associated kinase-4 (IRAK-4) kinase activity in IRAK-4-mediated signaling, J. Biol. Chem. 279, 40653-40658.
  2.  Qin, J., Jiang, Z., Qian, Y., Casanova, J. L., and Li, X. (2004) IRAK4 kinase activity is redundant for interleukin-1 (IL-1) receptor-associated kinase phosphorylation and IL-1 responsiveness, J. Biol. Chem. 279, 26748-26753.
  3.  Li, S., Strelow, A., Fontana, E. J., and Wesche, H. (2002) IRAK-4: a novel member of the IRAK family with the properties of an IRAK-kinase, Proc. Natl. Acad. Sci. U. S. A 99, 5567-5572.
  4.  Suzuki, N., Suzuki, S., and Yeh, W. C. (2002) IRAK-4 as the central TIR signaling mediator in innate immunity, Trends Immunol. 23, 503-506.
  5.  Suzuki, N., Suzuki, S., Duncan, G. S., Millar, D. G., Wada, T., Mirtsos, C., Takada, H., Wakeham, A., Itie, A., Li, S., Penninger, J. M., Wesche, H., Ohashi, P. S., Mak, T. W., and Yeh, W. C. (2002) Severe impairment of interleukin-1 and Toll-like receptor signalling in mice lacking IRAK-4, Nature 416, 750-756.
  6.  Cao, Z., Xiong, J., Takeuchi, M., Kurama, T., and Goeddel, D. V. (1996) TRAF6 is a signal transducer for interleukin-1, Nature 383, 443-446.
  7.  Ninomiya-Tsuji, J., Kishimoto, K., Hiyama, A., Inoue, J., Cao, Z., and Matsumoto, K. (1999) The kinase TAK1 can activate the NIK-I kappaB as well as the MAP kinase cascade in the IL-1 signalling pathway, Nature 398, 252-256.
  8.  Kim, T. W., Staschke, K., Bulek, K., Yao, J., Peters, K., Oh, K. H., Vandenburg, Y., Xiao, H., Qian, W., Hamilton, T., Min, B., Sen, G., Gilmour, R., and Li, X. (2007) A critical role for IRAK4 kinase activity in Toll-like receptor-mediated innate immunity, J. Exp. Med. 204, 1025-1036.
  9.  Kawagoe, T., Sato, S., Jung, A., Yamamoto, M., Matsui, K., Kato, H., Uematsu, S., Takeuchi, O., and Akira, S. (2007) Essential role of IRAK-4 protein and its kinase activity in Toll-like receptor-mediated immune responses but not in TCR signaling, J. Exp. Med. 204, 1013-1024.
 10.  Picard, C., Puel, A., Bonnet, M., Ku, C. L., Bustamante, J., Yang, K., Soudais, C., Dupuis, S., Feinberg, J., Fieschi, C., Elbim, C., Hitchcock, R., Lammas, D., Davies, G., Al Ghonaium, A., Al Rayes, H., Al Jumaah, S., Al Hajjar, S., Al Mohsen, I. Z., Frayha, H. H., Rucker, R., Hawn, T. R., Aderem, A., Tufenkeji, H., Haraguchi, S., Day, N. K., Good, R. A., Gougerot-Pocidalo, M. A., Ozinsky, A., and Casanova, J. L. (2003) Pyogenic bacterial infections in humans with IRAK-4 deficiency, Science 299, 2076-2079.
 11.  Medvedev, A. E., Lentschat, A., Kuhns, D. B., Blanco, J. C., Salkowski, C., Zhang, S., Arditi, M., Gallin, J. I., and Vogel, S. N. (2003) Distinct Mutations in IRAK-4 Confer Hyporesponsiveness to Lipopolysaccharide and Interleukin-1 in a Patient with Recurrent Bacterial Infections, J. Exp. Med. 198, 521-531.
 12.  Cardenes, M., von, B. H., Garcia-Saavedra, A., Santiago, E., Puel, A., Ku, C. L., Emile, J. F., Picard, C., Casanova, J. L., Colino, E., Bordes, A., Garfia, A., and Rodriguez-Gallego, C. (2006) Autosomal recessive interleukin-1 receptor-associated kinase 4 deficiency in fourth-degree relatives, J. Pediatr. 148, 549-551.
 13.  Yang, K., Puel, A., Zhang, S., Eidenschenk, C., Ku, C. L., Casrouge, A., Picard, C., von, B. H., Senechal, B., Plancoulaine, S., Al-Hajjar, S., Al-Ghonaium, A., Marodi, L., Davidson, D., Speert, D., Roifman, C., Garty, B. Z., Ozinsky, A., Barrat, F. J., Coffman, R. L., Miller, R. L., Li, X., Lebon, P., Rodriguez-Gallego, C., Chapel, H., Geissmann, F., Jouanguy, E., and Casanova, J. L. (2005) Human TLR-7-, -8-, and -9-mediated induction of IFN-alpha/beta and -lambda Is IRAK-4 dependent and redundant for protective immunity to viruses, Immunity 23, 465-478.