Phenotypic Mutation 'rosa' (pdf version)
Allelerosa
Mutation Type missense
Chromosome5
Coordinate88,772,723 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Dck
Gene Name deoxycytidine kinase
Chromosomal Location 88,764,996-88,783,281 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have profound defects in lymphopoiesis. Thymic T cell number and overall lymphocyte number are greatly reduced. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007832; MGI:102726

Mapped Yes 
Limits of the Critical Region 88764996 - 88783281 bp
Amino Acid Change Cysteine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000031311]
SMART Domains Protein: ENSMUSP00000031311
Gene: ENSMUSG00000029366
AA Change: C101R

DomainStartEndE-ValueType
Pfam:dNK 24 258 2.5e-79 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000031311)
Meta Mutation Damage Score 0.9710 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased
Body Weight (Z-score) - decreased
FACS B cells - decreased 22407915
FACS B:T cells - decreased
FACS B1a cells - increased
FACS B1b cells - increased
FACS B2 cells - decreased
FACS B220 MFI - decreased
FACS CD11c+ DCs - increased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased 22407915
FACS CD4+ T cells in CD3+ T cells - decreased 22407915
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS CD8a+ DCs (gated in CD11c+ cells) - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD MFI - decreased
FACS IgD+ B cell percentage - decreased 22407915
FACS IgM+ B cells - decreased 22407915
FACS macrophages - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS NK cells - increased
LPS-induced Necroptosis - decreased
Macrophage necroptosis: low
OVA-specific IgE - increased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
total IgE level - increased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.99; ML prob: 0.9996; human score: 0
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(14) : Chemically induced (ENU)(1) Gene trapped(9) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Dck APN 5 88774236 splice site probably benign
IGL02229:Dck APN 5 88774105 missense probably damaging 1.00
IGL02317:Dck APN 5 88774083 missense probably damaging 1.00
IGL02696:Dck APN 5 88772807 missense probably damaging 1.00
R0600:Dck UTSW 5 88781221 missense probably benign 0.01
R2019:Dck UTSW 5 88774084 missense probably damaging 1.00
R2037:Dck UTSW 5 88772717 missense probably damaging 1.00
R2140:Dck UTSW 5 88772723 missense probably damaging 1.00
R2142:Dck UTSW 5 88772723 missense probably damaging 1.00
R4834:Dck UTSW 5 88772736 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2020-07-01 4:45 PM by External Program
Record Created 2015-06-17 11:00 PM by Jin Huk Choi
Record Posted 2016-10-03
Phenotypic Description

Figure 1. Rosa mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Rosa mice exhibit decreased frequencies of peripheral blood IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Rosa mice exhibit reduced IgD mean fluorescence intensity (MFI) on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Rosa mice exhibit decreased frequencies of peripheral blood IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Rosa mice exhibit a decrease in the CD4+ to CD8+ T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Rosa mice exhibit reduced frequencies of peripheral blood CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Rosa mice exhibit increased frequencies of peripheral blood CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Rosa mice exhibit increased frequencies of peripheral blood macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Rosa mice exhibit increased levels of total IgE in the peripheral blood. ELISA analysis of peripheral blood was utilized to determine IgE concentration. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Homozygous rosa mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Homozygous rosa mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The rosa phenotype was identified among G3 mice of the pedigree R2140, some of which showed a decrease in B cell frequency (Figure 1), a decreased IgD+ B cell percentage  (Figure 2), a reduced IgD mean fluorescence intensity (MFI) on B cells (Figure 3), and a decrease in IgM+ B cell frequency (Figure 4) in the peripheral blood compared to that in wild-type mice. Some mice also exhibited a decrease in the CD4+ to CD8+ T cell ratio (Figure 5) caused by a diminished frequency of CD4+ T cells in CD3+ T cells (Figure 6) coupled with an increased frequency of CD8+ T cells in CD3+ T cells (Figure 7) in the peripheral blood. Some mice had an increased frequency of macrophages (Figure 8) in the peripheral blood and increased serum levels of total IgE (Figure 9). The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 10) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 11) were diminished compared to that in wild-type mice.

Nature of Mutation

Figure 12. Linkage mapping of the reduced level of IgE in the peripheral blood using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 106 mutations (X-axis) identified in the G1 male of pedigree R2140. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 106 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Dck:  a T to C transition at base pair 88,772,723 (v38) on chromosome 5, or base pair 7,711 in the NC_000071 GenBank genomic region.  The strongest association was found with a recessive model of linkage to the normalized total IgE levels in the peripheral blood,  wherein three variant homozygotes departed phenotypically from 12 homozygous reference mice and seven heterozygous mice (P = 8.993 x 10-13; Figure 12).  

 

The mutation corresponds to residue 544 in the mRNA sequence NM_007832 within exon 3 of 7 total exons.

 

529 TTCCAGTCATATGCCTGTCTCAGCCGGATCCGA

96  -F--Q--S--Y--A--C--L--S--R--I--R-

 

The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to arginine (R) substitution at position 101 (C101R) in the deoxycytidine kinase (dCK) protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000) (1).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 13. The domain and motif organization of mouse dCK. The rosa mutation results in a cysteine (C) to arginine (R) substitution at position 101 (C101R). See the text for more information about the domains shown. Abbreviations: dNK, deoxynucleoside kinase; PHOS, phosphorylated residue; ERS motif, Glu-Arg-Ser motif.

Figure 14. Crystal structure of mouse dCK. Figure was generated using UCSF Chimera and is based on PDB:1P62 and (3). The image is interactive; click to rotate.

Dck encodes deoxycytidine kinase (dCK) a nucleoside kinase similar to deoxyguanosine kinase (dGK), thymdine kinase 1 (TK1), and TK2 (2). dCK folds into a homodimer (3), and has a single deoxynucleoside kinase (dNK) domain that is similar to that found in dGK and TK1/2 (Figure 13). The nucleoside kinases fold into a five-stranded beta sheet core surround by ten alpha helices [PDB:1P62, (3); PDB:3QEO, (4)]. Helices α4 and α7 from each dCK monomer function as a dimer interface (3). Crystal structures of dCK with deoxyadenosine (dA) and either UDP or ADP bound to the donor site determined that complexes bound with UDP were in an open state and the nucleoside was bound (PDB:2ZI6; (5)). Complexes bound with ADP were in a closed conformation, preventing catalysis. Upon activation, dCK undergoes a conformational change that exposes the C-terminus to immunoreagents. An insert region of 12-15 amino acids connects helices α2 and α3. The function of the insert is unknown, but Ser74 within the insert is phosphorylated (6). Phosphorylation of Ser74 promotes the open conformation of the nucleoside binding site through an interaction with the indole side chain of Trp58 (6). The open dCK conformation promotes phosphoryl transfer, but not product release (6). Therefore, a transition between the open and closed states is required during the catalytic cycle (6). Mutation of Ser74 (S74A or S74E) leads to defects in mouse T and B lymphocyte development (7). dCK has three additional phosphorylation sites: Thr3, Ser11, and Ser15 (8). Phosphorylation of Thr3, Ser11, and Ser15 does not significantly alter dCK activity. However, Thr3 phosphorylation promotes dCK stability (8).

 

dCK has several motifs essential for its function. dCK has a putative nuclear localization signal in the N-terminal region (9). A P-loop motif (GX4GKS/T; Gly28-Ser35) binds the α- and β-phosphoryl group of the phosphoryl donor (3). Glu127, Arg128, and Ser129 form a highly conserved ERS motif. Glu127 interacts with a magnesium ion (3). Arg128 interacts with the 5’-hydroxyl group of deoxycytidine (dC) and with Glu53 and Gly28 (3). Arg104 and Asp133 within the active site are essential for substrate specificity (10). Mutation of Arg104 and Asp133 to glutamine and glycine, respectively (Arg104Gln/Asp133Gly), results in a functional kinase with broad specificity and an increased rate of substrate turnover. Mutation of Arg104 and Asp133 to methionine and threonine, respectively (Arg104Met/Asp133Thr), resulted in a kinase with reversed substrate specificity exhibiting an increase in the specific constant for thymidine phosphorylation but removing the activity for dC, dA, and dG (10). An LID region (188-RIYLRGRN-195) has three conserved arginine residues (3). The LID region closes in on the phosphoryl donor when it binds and participates in ATP binding and catalysis (3).

 

The rosa mutation results in a cysteine (C) to arginine (R) substitution at position 101 (C101R) within the dNK domain. Cys101 is in proximity to the active site.

Expression/Localization

dCK is constitutively expressed (2), with high expression in the thymus, spleen, lymph nodes, and lymphocytes (11), intermediate expression levels in proliferating epithelial cells of the lung, colon, and placenta as well as in resting peripheral blood mononuclear cells, and at low expression levels in terminally differentiated tissues including brain, liver, kidney, and muscle. dCK is localized to the cytoplasm and the nucleus (9;12).

Background
Figure 15. Model for dCK function. The two biochemical pathways (salvage and de novo) involved in deoxycytidine metabolism converge at the level of dCDP. In the salvage pathway deoxycytidine (dC) is continuously converted to dCMP by dCK. Upstream of dCK, cellular and extracellular dC pools are in equilibrium via the nucleoside transporters (ENTs). Downstream of dCK, the dCMP pool is in equilibrium with the dCDP pool. The de novo pathway contributes to the dCDP pool by RNR-mediated reduction of CDP. ENT, equilibrative nucleoside transporters; NT, 5′ nucleotidase; dCDP, deoxycytidine diphosphate; CDP, cytidine diphosphate; RNR, ribonucleotide reductase. See the text for more details. Figure is modeled after Figure 1 in Ref. 14.

Purine and pyrimidine nucleotides are synthesized through both de novo and deoxyribonucleoside salvage pathways (13). The de novo pathway facilitates the synthesis of purine and pyrimidine ribonucleotides from carboyhydrate and amino acid derivatives. The de novo pathway produces ribonucleoside diphosphates (NDPs), which are reduced by the enzyme ribonucleotide reductase to deoxyribonucleotide diphosphates (dNDPs) and converted to deoxyribonucleotidetriphosphates (dNTPs) [reviewed in (14)]. In the salvage pathway, nucleosides are transported through the plasma and mitochondrial membranes by nucleoside transporters and phosphorylated by cytosolic (dCK and TK1) or mitochondrial (deoxyguanosine kinase (dGK) and TK2) dNKs, respectively. The dNK family members control the rate-limiting phosphorylation of deoxynucleoside and catalyze the production of deoxynucleotide 5'-monophosphate from a deoxynucleoside, using ATP and yielding ADP in the process. The salvage and de novo pathways converge at the level of dCDP.

 

dCK phosphorylates dA, dC, and deoxyguanosine (dG) to their monophosphate forms by binding the nucleoside phosphoryl group acceptor at one binding site and the nucleotide phosphoryl group donor at a second binding site and subsequently catalyzing the phosphoryl group transfer (4). dCK is also implicated in the phosphorylation of several antiviral (e.g., 3TC and ddC for the treatment of HIV infection) and anticancer (e.g., cytosine arabinoside [AraC], fludarabine, cladribine, and gemcitabine) nucleoside drugs into their active forms (15;16). Reduced dCK activity often results in resistance to the nucleoside drugs (17;18).

 

Putative functions of dCK include roles in DNA repair (during VDJ recombination), in the synthesis of liponucleotide precursors of membrane phospholipids, and in apoptosis. dCK is not necessary for dNTP metabolism and DNA synthesis during embryogenesis, organogenesis, and other developmental processes (11). Although no human diseases are directly associated with mutations in DCK, severe immune deficiency diseases are caused by mutations in adenosine deaminase and purine nucleoside phosphorylase (19;20). In breast cancer patients with poor clinical outcome, the expression level of dCK is higher than patients with good clinical outcomes (21).

 

Several Dck mutant mouse models have been characterized. Dck deficiency in mice leads to loss of dCTP pools, induces replication stress, early S-phase arrest, and DNA damage in erythroid, B, and T cells (22). The ENU-induce mutant Dckmemi (E247*) exhibited defects in lymphocyte development, alterations in peripheral hematopoietic cell populations, and a high rate of cellular proliferation with a concomitant increased level of cell death in peripheral lymphocytes in response to lymphocytic choriomeningitis virus (LCMV) infection (23). The Dckmemi mice displayed a variable antigen-specific CD8+ T-cell response to LCMV. In addition, the antigen-specific population exhibited increased levels of effector cells (KLRG1+IL-7Rgp33+CD8+) and reduced levels of memory precursors (KLRG1IL-7R+gp33+CD8+). Uninfected Dckmemi mice exhibited a reduced frequency of CD4+ and B220+ lymphocytes with a concomitant increased frequency of myeloid cells (CD11c+, CD11b+, Gr-1+ or Ly-6A+) in the peripheral blood. The thymus size and cellularity was reduced in the Dckmemi mice. T cell development in the thymus was blocked between the DN3 (CD44 CD25+) and DN4 (CD44CD25) stages. In addition, proliferation was also increased in the Dckmemi cells. The fraction of pro- and pre-B cells was also increased in the Dckmemi mice. The Dckmemi mice also had enlarged spleens due to increased frequencies of myeloid cells and erythrocytes. CD4+ T cells and B220+ B cells were reduced in numbers, but CD8+ T lymphocytes numbers were comparable to that of the control mice. Conditional Dck knockout (Dck KO) mice exhibited defects in T and B lymphopoiesis (11). In the bone marrow, the Dck KO mice had a 2- to 3-fold reduction in B220+IgM+ and B220+IgMcells. The percentage of pre-B late (CD43-) cells was reduced with a concomitant increase in the percentage of pro-B (CD43+) cell fraction. The Dck KO mice were microthymic at 6-8 weeks of age and the KO thymi exhibited defects in corticomedullary organization. In the thymus the percentage of double-positive (DP; CD4+/CD8+) thymocytes was reduced (37% of the cell population in the thymus) compared to that in wild-type mice (85% of the cell population in the thymus) with a concomitant increase in the double-negative (DN; CD4/CD8) fraction. Within the DN fraction, the percentage of DN3 (44lo/25+) cells was increased, while the DN4 (44/25) population was reduced. Dck KO mice also exhibited splenomegaly with defects in red and white pulp architecture, and a loss of white pulp. The Dck KO mice did not exhibit susceptibility to opportunistic infections; the mice were not challenged with specific pathogens.

Putative Mechanism

The period between DN to DP transition and the pro- to pre-B transition occur after lymphopoiesis checkpoints following VDJ recombination. Signaling through the pre-T and BCR stops further V(D)J recombination, induces differentiation and promotes clonal expansion. Toy et al. propose that the loss of dCK expression results in a blockade of dNTP production and subsequent DN thymocyte proliferation and differentiation into DP cells (11). The phenotypes of the rosa mice mimic that of the Dck mutant mouse models, indicating loss of dCKrosa function.

Primers PCR Primer
rosa_pcr_F: CGCATTTCTCTTTGAACCTCTTAAA
rosa_pcr_R: CGCAGCCTCTAATTTGATTACCA

Sequencing Primer
rosa_seq_F: TTTAATCCCAGCATGGAGGC
rosa_seq_R: GCCTCTAATTTGATTACCAGGAAATG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 509 nucleotides is amplified (chromosome 5, + strand):


1   cgcatttctc tttgaacctc ttaaaaagtt aaaacagatg agcacagtgg tacacgcctt
61  taatcccagc atggaggcag gggtaggtgg atgtctgtga gttccagaac agctagagca
121 acgtagtgag accttgtctc agaaaacata aaacaaaaca gtgaaagtaa ctctattggc
181 aattatattg gtgtttgttt gtttcttttg acaatttaaa ataggaattg acaacgtctc
241 agaagagcgg tggaaatgtt cttcaaatga tgtatgagaa acctgaacgg tggtctttca
301 ccttccagtc atatgcctgt ctcagccgga tccgagccca gctagcctct ctcaatggca
361 agctcaaaga tgcagagaaa cctgtattat tttttgaaag atctgtgtat agtgacaggt
421 atgcaaatgg cttgtatttg gctcttggga gtttataact agacattttc tttttttctc
481 atttcctggt aatcaaatta gaggctgcg


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
  14. Staub, M., and Eriksson, S. (2006) The Role of Deoxycitidine Kinase in DNA Synthesis and Nucleoside Analog Activation, in Cancer Drug Discovery and Development: Deoxynucleoside Analogs in Cancer Therapy (G. J. Peters, Ed.) pp 29, Humana Press Inc., Totowa, N.J.
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsJin Huk Choi, Kuan-wen Wang, Bruce Beutler