Phenotypic Mutation 'Energy' (pdf version)
AlleleEnergy
Mutation Type missense
Chromosome6
Coordinate115,451,044 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Pparg
Gene Name peroxisome proliferator activated receptor gamma
Synonym(s) Ppar-gamma2, PPAR-gamma, Nr1c3, PPARgamma, PPARgamma2
Chromosomal Location 115,360,951-115,490,399 bp (+)
MGI Phenotype FUNCTION: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lethality due to placental defects. Heterozygotes show greater B cell proliferation, enhanced leptin secretion, and resistance to diet-induced adipocyte hypertrophy and insulin resistance. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001127330, NM_011146 (variant 2), NM_001308352 (variant 3), NM_001308354 (variant 4); MGI:97747

Mapped Yes 
Amino Acid Change Arginine changed to Leucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000000450] [ENSMUSP00000131962] [ENSMUSP00000145525] [ENSMUSP00000144975]
SMART Domains Protein: ENSMUSP00000000450
Gene: ENSMUSG00000000440
AA Change: R194L

DomainStartEndE-ValueType
Pfam:PPARgamma_N 31 108 1.1e-35 PFAM
ZnF_C4 136 206 2.61e-34 SMART
HOLI 315 474 9.89e-26 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000000450)
SMART Domains Protein: ENSMUSP00000131962
Gene: ENSMUSG00000000440
AA Change: R164L

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 3.1e-36 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000171644)
SMART Domains Protein: ENSMUSP00000145525
Gene: ENSMUSG00000000440
AA Change: R164L

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 2e-35 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000203732)
SMART Domains Protein: ENSMUSP00000144975
Gene: ENSMUSG00000000440
AA Change: R164L

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 7.1e-33 PFAM
ZnF_C4 106 176 1.1e-36 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000205213)
Meta Mutation Damage Score 0.9633 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 14603033
Body Weight (DSS) - decreased
Body Weight (DSS, z-score) - decreased
Body Weight (Z-score) - decreased
growth/size
Candidate Explorer Status CE: potential candidate; Verification probability: 0.402; ML prob: 0.372; human score: -0.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(34) : Spontaneous(1) Targeted(31) Transgenic(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Pparg APN 6 115439861 missense probably damaging 0.99
IGL00938:Pparg APN 6 115463139 missense probably benign 0.09
IGL01303:Pparg APN 6 115472954 missense possibly damaging 0.89
IGL01454:Pparg APN 6 115439939 missense probably damaging 1.00
IGL01552:Pparg APN 6 115490122 missense probably benign 0.00
IGL02998:Pparg APN 6 115463088 missense probably benign 0.01
IGL03167:Pparg APN 6 115473227 missense probably damaging 1.00
IGL03179:Pparg APN 6 115439872 missense probably damaging 1.00
R1083:Pparg UTSW 6 115490146 missense probably damaging 0.99
R1569:Pparg UTSW 6 115439999 missense probably benign 0.14
R1620:Pparg UTSW 6 115473281 missense probably benign 0.01
R1850:Pparg UTSW 6 115450980 missense probably damaging 1.00
R2339:Pparg UTSW 6 115451044 missense probably damaging 1.00
R4429:Pparg UTSW 6 115440023 missense probably benign 0.09
R4941:Pparg UTSW 6 115490110 missense probably damaging 1.00
R4946:Pparg UTSW 6 115451028 missense probably damaging 1.00
R5110:Pparg UTSW 6 115473003 missense probably damaging 1.00
R5523:Pparg UTSW 6 115490071 missense probably damaging 1.00
R6900:Pparg UTSW 6 115472988 missense possibly damaging 0.87
R6994:Pparg UTSW 6 115451050 missense probably benign 0.36
R7177:Pparg UTSW 6 115441620 missense probably benign 0.40
R7755:Pparg UTSW 6 115463106 missense probably damaging 1.00
R8103:Pparg UTSW 6 115473141 missense possibly damaging 0.91
X0064:Pparg UTSW 6 115439914 missense probably benign 0.01
Mode of Inheritance Autosomal Dominant
Local Stock
Repository
Last Updated 2019-11-06 4:51 PM by Bruce Beutler
Record Created 2015-07-08 10:24 AM by Zhe Chen
Record Posted 2018-04-11
Phenotypic Description

Figure 1. Energy mice exhibit reduced body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Energy phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2339 in which some mice showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 34 mutations (X-axis) identified in the G1 male of pedigree R2339. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 34 mutations. The body weight phenotype was linked to a mutation in Pparg: a G to T transversion at base pair 115,451,044 (v38) on chromosome 6, or base pair 90,168 in the GenBank genomic region NC_000072 encoding Pparg. Linkage was found with a dominant/additive model of inheritance, wherein nine heterozygous mice departed phenotypically from 28 homozygous reference mice with a P value of 6.68 x 10-5 (Figure 2); no homozygous variant mice were observed in the pedigree.

 

The mutation corresponds to residue 626 in the mRNA sequence NM_011146 within exon 4 of 7 total exons.

 
610 AAATGTCAGTACTGTCGGTTTCAGAAGTGCCTT
189 -K--C--Q--Y--C--R--F--Q--K--C--L-
 

The mutated nucleotide is indicated in red. The mutation results in an arginine (R) to leucine (L) substitution at residue 194 (R194L) in the PPARγ protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain organization of PPARγ. Abbreviations: LAD, ligand-independent activation domain; ZF, zinc fingers; DBD, DNA-binding domain; LBD, ligand-binding domain. The location of the Energy mutation is indicated. 
Figure 4. Ligand binding domain of human PPARγ. Image created by UCSF Chimera and is based on PDBID 3PRG.

Pparg encodes PPARγ, a peroxisome proliferator-activated receptor (PPAR). The PPARs are ligand-activated nuclear hormone receptors (NRs) of the steroid receptor superfamily.

 

PPARγ has an N-terminal ligand-independent activation domain (LAD), two C4-type zinc fingers within a DNA-binding domain, a hinge region, and a ligand-binding domain (LBD) (Figure 3) (1). A portion of the LAD contains a ligand-independent activation function-1 [AF-1] (2).

 

AF-1 is one of at least two activation domains found in NRs (3). Synergism between the AF domain is required for full transcriptional activity of an NR. The zinc fingers promote PPARγ binding to the promoters of target genes. The hinge region contains a nuclear localization signal and a region that is required for an interaction with FAM120B (4). The LBD binds specific ligands and promotes PPAR binding to target genes. A portion of the LBD comprises the ligand-dependent AF-2 domain, which recruits PPAR cofactors that assist in target gene transcription (5).The LBD has a four-stranded β-sheet and 12 α-helices, which fold to create a hydrophobic ligand-binding pocket [Figure 4; PDB:3PRG; (6;7)]. Helix 12, which contains the AF-2 core, closes the ligand-binding site in response to a ligand, leading to formation of an active form of the receptor (8).

 

There are four isoforms of PPARG in humans: PPARγ-1, PPARγ-2, PPARγ-3, and PPARγ-4 (9-12). The isoforms result from the use of different promoters and alternative splicing of the 5’ end (9). Although human PPARG encodes four mRNA variants, there are only two PPARγ protein isoforms PPARγ-1 and PPARγ-2. The PPARγ-1, PPARγ-3, and PPARγ-4 mRNAs encode the PPARγ-1 protein and the PPARγ-2 mRNA encodes the PPARγ-2 protein. The PPARγ-2 protein has 30 additional N-terminal amino acids compared to PPARγ-1.  

 

The Energy mutation results in an arginine (R) to leucine (L) substitution at residue 194 (R194L) in the PPARγ protein; amino acid 194 is within the second zinc finger domain.

Expression/Localization

PPARγ is predominantly expressed in adipose tissue and large intestine, with lower expression in bone marrow, spleen, testis, brain, skeletal muscle, liver, kidney, and small intestine (10;13).

 

The PPARγ-1 isoform is widely expressed, with highest expression in adipose tissue and the large intestine (11). PPARγ-2 and PPARγ-4 are predominantly expressed in adipose tissue, and PPARγ-4 is expressed in endothelial cells (14). PPARγ-3 is expressed in white adipose tissue, the large intestine, and macrophages (12;15;16).

Background
Figure 5. The PPARs function in the transcription of genes associated with glucose and lipid metabolism. PPARs form heterodimers with retinoid X receptors (RXRs), which subsequently bind to retinoic acid (RA) response elements (RARE; alternatively, peroxisome proliferator response elements [PPREs]) to regulate the transcription of target genes. Binding of ligand to the PPAR/RXR/corepressor complex causes the release of the corepressor from the PPAR/RXR complex. The activated PPAR/RXR complex binds to the PPRE, inducing structural changes in chromatin and the release of histone H1. The PPRE-bound PPAR/RXR targets a coactivator-acetyltransferase complex to the promoter, which acetylates the histone tails.

PPARs bind chemicals that promote the proliferation of peroxisomes, which are organelles that function in H2O2-based respiration, β-oxidation of fatty acids (FAs), and cholesterol metabolism. The PPARs also promote the transcription of genes associated with glucose and lipid metabolism by functioning as lipid sensors that can redirect metabolism once activated.

 

There are three members of the PPAR family: PPARα, PPARβ/δ, and PPARγ. Each member of the PPAR family exhibits unique tissue expression patterns and functions. PPARα is predominantly expressed in the liver and skeletal muscles and functions in fatty-acid catabolism (17), while PPARβ is ubiquitously expressed and is predicted to function in glucose and lipid metabolism (18;19). PPARγ is a transcriptional regulator during adipogenesis, lipogenesis, and glucose homeostasis. PPARγ functions in adipocyte differentiation from pre-adipocyte precursor cells into mature white or brown adipocytes (20;21).

 

PPARs form heterodimers with retinoid X receptors (RXRs; see the record pinkie for information about RXRα), which subsequently bind to retinoic acid (RA) response elements (RARE; alternatively, peroxisome proliferator response elements [PPREs]) to regulate the transcription of target genes (Figure 5) (22;23). PPARγ/RXRα can be activated by several factors, including polyunsaturated fatty acids (24;25), prostaglandin J2 derivatives (26;27), and oxidized fatty acids (28). PPARγ activates the transcription of several adipose markers, including adipocyte fatty acid binding protein (aP2) (29), phosphoenolpyruvate carboxykinase (PEPCK) (30), lipoprotein lipase (LPL) (31), and C/EBP-α (32). PPARγ also promotes mature adipocyte apoptosis (33). PPARγ also functions in lipid uptake and cholesterol efflux (34;35). After treatment with the synthetic ligand thiazolidinedione, activated PPARγ inhibits leptin production (36).

 

Mutations in PPARG are associated with carotid intimal medial thickness-1 (carotid intimal medial thickness is a measure of atherosclerosis; OMIM: #609338), severe digenic insulin resistance [OMIM: #604367; (37;38)], partial familial lipodystrophy type-3 [OMIM: #604367; (39;40)], severe obesity [OMIM: 601665; (41)], and type 2 diabetes [OMIM: #125853; (38)].

 

Pparg-deficient mice exhibit embryonic lethality between embryonic day (E) 9.5 and E10.5 (21;42-46). Heterozygous mice exhibited increased insulin sensitivity, decreased levels of circulating insulin and leptin, reduced susceptibility to diet-induced obesity, postnatal growth retardation, and reduced total body fat amount (44;45;47). Heterozygous mice also exhibited increased B cell proliferation, increased levels of IgM and IgG, increased secretion of interferon-gamma and interleukin-2, and increased susceptibility to antigen-induced arthritis (44). Homozygous mice expressing a hypomorphic Pparg allele exhibited increased rates of lethality (24% died within one week of birth, and more than 40% died by weaning), reduced amounts of brown adipose tissue, absence of white adipose tissue, reduced body weights, reduced growth rates, hyperlipidemia, reduced body temperatures, impaired glucose tolerance, and insulin resistance (48). Homozygous mice with PPARγ-2-specific deletion exhibited a significant decrease in life span, but were not lipodystrophic or insulin resistant (49). The PPARγ-2 knockout mice exhibited reduced body weights, reduced levels of circulating leptin and adiponectin, and reduced white adipose tissue amounts (50;51). Adipocyte-specific deletion of Pparg resulted in apoptosis of both white and brown adipocytes (21). Homozygous mice expressing a missense Pparg mutation (P465L) also exhibited preweaning lethality (52). Mice heterozygous for the P465L mutation exhibited reduced adiponectin levels, increased circulating triglyceride levels, increased liver weight, and hepatic steatosis (52). Homozygous mice expressing a missense dominant-negative Pparg mutation (L466A) exhibited embryonic lethality by E10.5 (53). Mice heterozygous for the L466A mutation exhibited reduced fat mass, lipodystrophy, reduced body weights, insulin resistance, hypertension, hepatic steatosis, and increased levels of circulating insulin, free fatty acids, and liver triglyceride (53).

 

Homozgyous mice expressing a knock-in Pparg allele exhibited lower blood pressure as well as slower glucose clearance following a glucose load compared to wild-type mice (54). Homozygous mice expressing a knock-in Pparg allele (S122A; nonphosphorylatable) that has more biological activity than wild-type exhibited reduced circulating levels of leptin, free fatty acids, and triglycerides (55). The mice also exhibited improved glucose tolerance and increased insulin sensitivity compared to wild-type mice (55).

Putative Mechanism

Activation of PPARγ increases expression of genes involved in fatty acid transport and oxidation. The reduced body weight phenotype of the Energy mice mimics that of mice expressing Pparg mutant alleles (44;45;47;48;53), indicating loss of PPARγEnergy.

Primers PCR Primer
Energy_pcr_F: ATCCACTTTTGCTGATGTCCAAG
Energy_pcr_R: ACACGAAGAAGCTCTCATCAGG

Sequencing Primer
Energy_seq_F: CTGATGTCCAAGTCAATGAGTGTC
Energy_seq_R: GAAGCTCTCATCAGGATGACTTTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 400 nucleotides is amplified (chromosome 6, + strand):


1   atccactttt gctgatgtcc aagtcaatga gtgtctttat ccacaggttg ctgcttctat
61  gtatcacata gacttaaaaa ttgtttattt tccatatcct tttgcagggt tttttccgaa
121 gaaccatccg attgaagctt atttatgata ggtgtgatct taactgccgg atccacaaaa
181 aaagtagaaa taaatgtcag tactgtcggt ttcagaagtg ccttgctgtg gggatgtctc
241 acaatggtaa gtggatactg agagccatgt gtacatcttg taactctcct ggccaatgcc
301 aggtccaggt cagtaggcac taggacaact aatggaagcg agtaaattct tctaaagagc
361 attaagtttc aaagtcatcc tgatgagagc ttcttcgtgt 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Katherine Timer
AuthorsZhe Chen, Jianhui Wang, Takuma Misawa, and Bruce Beutler