Phenotypic Mutation 'Energy' (pdf version)
Allele | Energy |
Mutation Type |
missense
|
Chromosome | 6 |
Coordinate | 115,428,005 bp (GRCm39) |
Base Change | G ⇒ T (forward strand) |
Gene |
Pparg
|
Gene Name | peroxisome proliferator activated receptor gamma |
Synonym(s) | Nr1c3, PPARgamma2, PPARgamma, Ppar-gamma2, PPAR-gamma |
Chromosomal Location |
115,337,912-115,467,360 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015] PHENOTYPE: Homozygotes for targeted null mutations exhibit lethality due to placental defects. Heterozygotes show greater B cell proliferation, enhanced leptin secretion, and resistance to diet-induced adipocyte hypertrophy and insulin resistance. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_001127330, NM_011146 (variant 2), NM_001308352 (variant 3), NM_001308354 (variant 4); MGI:97747
|
Mapped | Yes |
Amino Acid Change |
Arginine changed to Leucine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000000450]
[ENSMUSP00000131962]
[ENSMUSP00000145525]
[ENSMUSP00000144975]
|
AlphaFold |
no structure available at present |
SMART Domains |
Protein: ENSMUSP00000000450 Gene: ENSMUSG00000000440 AA Change: R194L
Domain | Start | End | E-Value | Type |
Pfam:PPARgamma_N
|
31 |
108 |
1.1e-35 |
PFAM |
ZnF_C4
|
136 |
206 |
2.61e-34 |
SMART |
HOLI
|
315 |
474 |
9.89e-26 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000000450)
|
SMART Domains |
Protein: ENSMUSP00000131962 Gene: ENSMUSG00000000440 AA Change: R164L
Domain | Start | End | E-Value | Type |
Pfam:PPARgamma_N
|
1 |
78 |
3.1e-36 |
PFAM |
ZnF_C4
|
106 |
176 |
2.61e-34 |
SMART |
HOLI
|
285 |
444 |
9.89e-26 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000171644)
|
SMART Domains |
Protein: ENSMUSP00000145525 Gene: ENSMUSG00000000440 AA Change: R164L
Domain | Start | End | E-Value | Type |
Pfam:PPARgamma_N
|
1 |
78 |
2e-35 |
PFAM |
ZnF_C4
|
106 |
176 |
2.61e-34 |
SMART |
HOLI
|
285 |
444 |
9.89e-26 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000203732)
|
SMART Domains |
Protein: ENSMUSP00000144975 Gene: ENSMUSG00000000440 AA Change: R164L
Domain | Start | End | E-Value | Type |
Pfam:PPARgamma_N
|
1 |
78 |
7.1e-33 |
PFAM |
ZnF_C4
|
106 |
176 |
1.1e-36 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000205213)
|
Meta Mutation Damage Score |
0.9633 |
Is this an essential gene? |
Essential (E-score: 1.000) |
Phenotypic Category |
Autosomal Dominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(34) : Spontaneous(1) Targeted(31) Transgenic(2)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00906:Pparg
|
APN |
6 |
115416822 |
missense |
probably damaging |
0.99 |
IGL00938:Pparg
|
APN |
6 |
115440100 |
missense |
probably benign |
0.09 |
IGL01303:Pparg
|
APN |
6 |
115449915 |
missense |
possibly damaging |
0.89 |
IGL01454:Pparg
|
APN |
6 |
115416900 |
missense |
probably damaging |
1.00 |
IGL01552:Pparg
|
APN |
6 |
115467083 |
missense |
probably benign |
0.00 |
IGL02998:Pparg
|
APN |
6 |
115440049 |
missense |
probably benign |
0.01 |
IGL03167:Pparg
|
APN |
6 |
115450188 |
missense |
probably damaging |
1.00 |
IGL03179:Pparg
|
APN |
6 |
115416833 |
missense |
probably damaging |
1.00 |
R1083:Pparg
|
UTSW |
6 |
115467107 |
missense |
probably damaging |
0.99 |
R1569:Pparg
|
UTSW |
6 |
115416960 |
missense |
probably benign |
0.14 |
R1620:Pparg
|
UTSW |
6 |
115450242 |
missense |
probably benign |
0.01 |
R1850:Pparg
|
UTSW |
6 |
115427941 |
missense |
probably damaging |
1.00 |
R2339:Pparg
|
UTSW |
6 |
115428005 |
missense |
probably damaging |
1.00 |
R4429:Pparg
|
UTSW |
6 |
115416984 |
missense |
probably benign |
0.09 |
R4941:Pparg
|
UTSW |
6 |
115467071 |
missense |
probably damaging |
1.00 |
R4946:Pparg
|
UTSW |
6 |
115427989 |
missense |
probably damaging |
1.00 |
R5110:Pparg
|
UTSW |
6 |
115449964 |
missense |
probably damaging |
1.00 |
R5523:Pparg
|
UTSW |
6 |
115467032 |
missense |
probably damaging |
1.00 |
R6900:Pparg
|
UTSW |
6 |
115449949 |
missense |
possibly damaging |
0.87 |
R6994:Pparg
|
UTSW |
6 |
115428011 |
missense |
probably benign |
0.36 |
R7177:Pparg
|
UTSW |
6 |
115418581 |
missense |
probably benign |
0.40 |
R7755:Pparg
|
UTSW |
6 |
115440067 |
missense |
probably damaging |
1.00 |
R8103:Pparg
|
UTSW |
6 |
115450102 |
missense |
possibly damaging |
0.91 |
R8496:Pparg
|
UTSW |
6 |
115440112 |
missense |
probably benign |
0.00 |
R8914:Pparg
|
UTSW |
6 |
115440133 |
missense |
probably benign |
0.00 |
R8953:Pparg
|
UTSW |
6 |
115418507 |
missense |
possibly damaging |
0.86 |
X0064:Pparg
|
UTSW |
6 |
115416875 |
missense |
probably benign |
0.01 |
|
Mode of Inheritance |
Autosomal Dominant |
Local Stock | |
Repository | |
Last Updated |
2019-11-06 4:51 PM
by Bruce Beutler
|
Record Created |
2015-07-08 10:24 AM
by Zhe Chen
|
Record Posted |
2018-04-11 |
Phenotypic Description |
The Energy phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2339 in which some mice showed reduced body weights compared to wild-type littermates (Figure 1).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 34 mutations. The body weight phenotype was linked to a mutation in Pparg: a G to T transversion at base pair 115,451,044 (v38) on chromosome 6, or base pair 90,168 in the GenBank genomic region NC_000072 encoding Pparg. Linkage was found with a dominant/additive model of inheritance, wherein nine heterozygous mice departed phenotypically from 28 homozygous reference mice with a P value of 6.68 x 10-5 (Figure 2); no homozygous variant mice were observed in the pedigree. The mutation corresponds to residue 626 in the mRNA sequence NM_011146 within exon 4 of 7 total exons.
610 AAATGTCAGTACTGTCGGTTTCAGAAGTGCCTT
189 -K--C--Q--Y--C--R--F--Q--K--C--L-
|
The mutated nucleotide is indicated in red. The mutation results in an arginine (R) to leucine (L) substitution at residue 194 (R194L) in the PPARγ protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Pparg encodes PPARγ, a peroxisome proliferator-activated receptor (PPAR). The PPARs are ligand-activated nuclear hormone receptors (NRs) of the steroid receptor superfamily. PPARγ has an N-terminal ligand-independent activation domain (LAD), two C4-type zinc fingers within a DNA-binding domain, a hinge region, and a ligand-binding domain (LBD) (Figure 3) (1). A portion of the LAD contains a ligand-independent activation function-1 [AF-1] (2). AF-1 is one of at least two activation domains found in NRs (3). Synergism between the AF domain is required for full transcriptional activity of an NR. The zinc fingers promote PPARγ binding to the promoters of target genes. The hinge region contains a nuclear localization signal and a region that is required for an interaction with FAM120B (4). The LBD binds specific ligands and promotes PPAR binding to target genes. A portion of the LBD comprises the ligand-dependent AF-2 domain, which recruits PPAR cofactors that assist in target gene transcription (5).The LBD has a four-stranded β-sheet and 12 α-helices, which fold to create a hydrophobic ligand-binding pocket [Figure 4; PDB:3PRG; (6;7)]. Helix 12, which contains the AF-2 core, closes the ligand-binding site in response to a ligand, leading to formation of an active form of the receptor (8). There are four isoforms of PPARG in humans: PPARγ-1, PPARγ-2, PPARγ-3, and PPARγ-4 (9-12). The isoforms result from the use of different promoters and alternative splicing of the 5’ end (9). Although human PPARG encodes four mRNA variants, there are only two PPARγ protein isoforms PPARγ-1 and PPARγ-2. The PPARγ-1, PPARγ-3, and PPARγ-4 mRNAs encode the PPARγ-1 protein and the PPARγ-2 mRNA encodes the PPARγ-2 protein. The PPARγ-2 protein has 30 additional N-terminal amino acids compared to PPARγ-1. The Energy mutation results in an arginine (R) to leucine (L) substitution at residue 194 (R194L) in the PPARγ protein; amino acid 194 is within the second zinc finger domain.
|
Expression/Localization | PPARγ is predominantly expressed in adipose tissue and large intestine, with lower expression in bone marrow, spleen, testis, brain, skeletal muscle, liver, kidney, and small intestine (10;13). The PPARγ-1 isoform is widely expressed, with highest expression in adipose tissue and the large intestine (11). PPARγ-2 and PPARγ-4 are predominantly expressed in adipose tissue, and PPARγ-4 is expressed in endothelial cells (14). PPARγ-3 is expressed in white adipose tissue, the large intestine, and macrophages (12;15;16).
|
Background |
PPARs bind chemicals that promote the proliferation of peroxisomes, which are organelles that function in H2O2-based respiration, β-oxidation of fatty acids (FAs), and cholesterol metabolism. The PPARs also promote the transcription of genes associated with glucose and lipid metabolism by functioning as lipid sensors that can redirect metabolism once activated. There are three members of the PPAR family: PPARα, PPARβ/δ, and PPARγ. Each member of the PPAR family exhibits unique tissue expression patterns and functions. PPARα is predominantly expressed in the liver and skeletal muscles and functions in fatty-acid catabolism (17), while PPARβ is ubiquitously expressed and is predicted to function in glucose and lipid metabolism (18;19). PPARγ is a transcriptional regulator during adipogenesis, lipogenesis, and glucose homeostasis. PPARγ functions in adipocyte differentiation from pre-adipocyte precursor cells into mature white or brown adipocytes (20;21). PPARs form heterodimers with retinoid X receptors (RXRs; see the record pinkie for information about RXRα), which subsequently bind to retinoic acid (RA) response elements (RARE; alternatively, peroxisome proliferator response elements [PPREs]) to regulate the transcription of target genes (Figure 5) (22;23). PPARγ/RXRα can be activated by several factors, including polyunsaturated fatty acids (24;25), prostaglandin J2 derivatives (26;27), and oxidized fatty acids (28). PPARγ activates the transcription of several adipose markers, including adipocyte fatty acid binding protein (aP2) (29), phosphoenolpyruvate carboxykinase (PEPCK) (30), lipoprotein lipase (LPL) (31), and C/EBP-α (32). PPARγ also promotes mature adipocyte apoptosis (33). PPARγ also functions in lipid uptake and cholesterol efflux (34;35). After treatment with the synthetic ligand thiazolidinedione, activated PPARγ inhibits leptin production (36). Mutations in PPARG are associated with carotid intimal medial thickness-1 (carotid intimal medial thickness is a measure of atherosclerosis; OMIM: #609338), severe digenic insulin resistance [OMIM: #604367; (37;38)], partial familial lipodystrophy type-3 [OMIM: #604367; (39;40)], severe obesity [OMIM: 601665; (41)], and type 2 diabetes [OMIM: #125853; (38)]. Pparg-deficient mice exhibit embryonic lethality between embryonic day (E) 9.5 and E10.5 (21;42-46). Heterozygous mice exhibited increased insulin sensitivity, decreased levels of circulating insulin and leptin, reduced susceptibility to diet-induced obesity, postnatal growth retardation, and reduced total body fat amount (44;45;47). Heterozygous mice also exhibited increased B cell proliferation, increased levels of IgM and IgG, increased secretion of interferon-gamma and interleukin-2, and increased susceptibility to antigen-induced arthritis (44). Homozygous mice expressing a hypomorphic Pparg allele exhibited increased rates of lethality (24% died within one week of birth, and more than 40% died by weaning), reduced amounts of brown adipose tissue, absence of white adipose tissue, reduced body weights, reduced growth rates, hyperlipidemia, reduced body temperatures, impaired glucose tolerance, and insulin resistance (48). Homozygous mice with PPARγ-2-specific deletion exhibited a significant decrease in life span, but were not lipodystrophic or insulin resistant (49). The PPARγ-2 knockout mice exhibited reduced body weights, reduced levels of circulating leptin and adiponectin, and reduced white adipose tissue amounts (50;51). Adipocyte-specific deletion of Pparg resulted in apoptosis of both white and brown adipocytes (21). Homozygous mice expressing a missense Pparg mutation (P465L) also exhibited preweaning lethality (52). Mice heterozygous for the P465L mutation exhibited reduced adiponectin levels, increased circulating triglyceride levels, increased liver weight, and hepatic steatosis (52). Homozygous mice expressing a missense dominant-negative Pparg mutation (L466A) exhibited embryonic lethality by E10.5 (53). Mice heterozygous for the L466A mutation exhibited reduced fat mass, lipodystrophy, reduced body weights, insulin resistance, hypertension, hepatic steatosis, and increased levels of circulating insulin, free fatty acids, and liver triglyceride (53). Homozgyous mice expressing a knock-in Pparg allele exhibited lower blood pressure as well as slower glucose clearance following a glucose load compared to wild-type mice (54). Homozygous mice expressing a knock-in Pparg allele (S122A; nonphosphorylatable) that has more biological activity than wild-type exhibited reduced circulating levels of leptin, free fatty acids, and triglycerides (55). The mice also exhibited improved glucose tolerance and increased insulin sensitivity compared to wild-type mice (55).
|
Putative Mechanism | Activation of PPARγ increases expression of genes involved in fatty acid transport and oxidation. The reduced body weight phenotype of the Energy mice mimics that of mice expressing Pparg mutant alleles (44;45;47;48;53), indicating loss of PPARγEnergy.
|
Primers |
PCR Primer
Energy_pcr_F: ATCCACTTTTGCTGATGTCCAAG
Energy_pcr_R: ACACGAAGAAGCTCTCATCAGG
Sequencing Primer
Energy_seq_F: CTGATGTCCAAGTCAATGAGTGTC
Energy_seq_R: GAAGCTCTCATCAGGATGACTTTG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 400 nucleotides is amplified (chromosome 6, + strand):
1 atccactttt gctgatgtcc aagtcaatga gtgtctttat ccacaggttg ctgcttctat 61 gtatcacata gacttaaaaa ttgtttattt tccatatcct tttgcagggt tttttccgaa 121 gaaccatccg attgaagctt atttatgata ggtgtgatct taactgccgg atccacaaaa 181 aaagtagaaa taaatgtcag tactgtcggt ttcagaagtg ccttgctgtg gggatgtctc 241 acaatggtaa gtggatactg agagccatgt gtacatcttg taactctcct ggccaatgcc 301 aggtccaggt cagtaggcac taggacaact aatggaagcg agtaaattct tctaaagagc 361 attaagtttc aaagtcatcc tgatgagagc ttcttcgtgt
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References |
2. Werman, A., Hollenberg, A., Solanes, G., Bjorbaek, C., Vidal-Puig, A. J., and Flier, J. S. (1997) Ligand-Independent Activation Domain in the N Terminus of Peroxisome Proliferator-Activated Receptor Gamma (PPARgamma). Differential Activity of PPARgamma1 and -2 Isoforms and Influence of Insulin. J Biol Chem. 272, 20230-20235.
6. Nolte, R. T., Wisely, G. B., Westin, S., Cobb, J. E., Lambert, M. H., Kurokawa, R., Rosenfeld, M. G., Willson, T. M., Glass, C. K., and Milburn, M. V. (1998) Ligand Binding and Co-Activator Assembly of the Peroxisome Proliferator-Activated Receptor-Gamma. Nature. 395, 137-143.
7. Uppenberg, J., Svensson, C., Jaki, M., Bertilsson, G., Jendeberg, L., and Berkenstam, A. (1998) Crystal Structure of the Ligand Binding Domain of the Human Nuclear Receptor PPARgamma. J Biol Chem. 273, 31108-31112.
8. Renaud, J. P., Rochel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H., and Moras, D. (1995) Crystal Structure of the RAR-Gamma Ligand-Binding Domain Bound to all-Trans Retinoic Acid. Nature. 378, 681-689.
9. Tontonoz, P., Hu, E., Graves, R. A., Budavari, A. I., and Spiegelman, B. M. (1994) MPPAR Gamma 2: Tissue-Specific Regulator of an Adipocyte Enhancer. Genes Dev. 8, 1224-1234.
10. Elbrecht, A., Chen, Y., Cullinan, C. A., Hayes, N., Leibowitz, M., Moller, D. E., and Berger, J. (1996) Molecular Cloning, Expression and Characterization of Human Peroxisome Proliferator Activated Receptors Gamma 1 and Gamma 2. Biochem Biophys Res Commun. 224, 431-437.
11. Fajas, L., Auboeuf, D., Raspe, E., Schoonjans, K., Lefebvre, A. M., Saladin, R., Najib, J., Laville, M., Fruchart, J. C., Deeb, S., Vidal-Puig, A., Flier, J., Briggs, M. R., Staels, B., Vidal, H., and Auwerx, J. (1997) The Organization, Promoter Analysis, and Expression of the Human PPARgamma Gene. J Biol Chem. 272, 18779-18789.
13. Fajas, L., Auboeuf, D., Raspe, E., Schoonjans, K., Lefebvre, A. M., Saladin, R., Najib, J., Laville, M., Fruchart, J. C., Deeb, S., Vidal-Puig, A., Flier, J., Briggs, M. R., Staels, B., Vidal, H., and Auwerx, J. (1997) The Organization, Promoter Analysis, and Expression of the Human PPARgamma Gene. J Biol Chem. 272, 18779-18789.
15. Ricote, M., Huang, J., Fajas, L., Li, A., Welch, J., Najib, J., Witztum, J. L., Auwerx, J., Palinski, W., and Glass, C. K. (1998) Expression of the Peroxisome Proliferator-Activated Receptor Gamma (PPARgamma) in Human Atherosclerosis and Regulation in Macrophages by Colony Stimulating Factors and Oxidized Low Density Lipoprotein. Proc Natl Acad Sci U S A. 95, 7614-7619.
16. Braissant, O., Foufelle, F., Scotto, C., Dauca, M., and Wahli, W. (1996) Differential Expression of Peroxisome Proliferator-Activated Receptors (PPARs): Tissue Distribution of PPAR-Alpha, -Beta, and -Gamma in the Adult Rat. Endocrinology. 137, 354-366.
18. Dressel, U., Allen, T. L., Pippal, J. B., Rohde, P. R., Lau, P., and Muscat, G. E. (2003) The Peroxisome Proliferator-Activated Receptor beta/delta Agonist, GW501516, Regulates the Expression of Genes Involved in Lipid Catabolism and Energy Uncoupling in Skeletal Muscle Cells. Mol Endocrinol. 17, 2477-2493.
19. Tanaka, T., Yamamoto, J., Iwasaki, S., Asaba, H., Hamura, H., Ikeda, Y., Watanabe, M., Magoori, K., Ioka, R. X., Tachibana, K., Watanabe, Y., Uchiyama, Y., Sumi, K., Iguchi, H., Ito, S., Doi, T., Hamakubo, T., Naito, M., Auwerx, J., Yanagisawa, M., Kodama, T., and Sakai, J. (2003) Activation of Peroxisome Proliferator-Activated Receptor Delta Induces Fatty Acid Beta-Oxidation in Skeletal Muscle and Attenuates Metabolic Syndrome. Proc Natl Acad Sci U S A. 100, 15924-15929.
21. Imai, T., Takakuwa, R., Marchand, S., Dentz, E., Bornert, J. M., Messaddeq, N., Wendling, O., Mark, M., Desvergne, B., Wahli, W., Chambon, P., and Metzger, D. (2004) Peroxisome Proliferator-Activated Receptor Gamma is Required in Mature White and Brown Adipocytes for their Survival in the Mouse. Proc Natl Acad Sci U S A. 101, 4543-4547.
22. Kliewer, S. A., Umesono, K., Noonan, D. J., Heyman, R. A., and Evans, R. M. (1992) Convergence of 9-Cis Retinoic Acid and Peroxisome Proliferator Signalling Pathways through Heterodimer Formation of their Receptors. Nature. 358, 771-774.
24. Kliewer, S. A., Sundseth, S. S., Jones, S. A., Brown, P. J., Wisely, G. B., Koble, C. S., Devchand, P., Wahli, W., Willson, T. M., Lenhard, J. M., and Lehmann, J. M. (1997) Fatty Acids and Eicosanoids Regulate Gene Expression through Direct Interactions with Peroxisome Proliferator-Activated Receptors Alpha and Gamma. Proc Natl Acad Sci U S A. 94, 4318-4323.
26. Kliewer, S. A., Lenhard, J. M., Willson, T. M., Patel, I., Morris, D. C., and Lehmann, J. M. (1995) A Prostaglandin J2 Metabolite Binds Peroxisome Proliferator-Activated Receptor Gamma and Promotes Adipocyte Differentiation. Cell. 83, 813-819.
27. Forman, B. M., Tontonoz, P., Chen, J., Brun, R. P., Spiegelman, B. M., and Evans, R. M. (1995) 15-Deoxy-Delta 12, 14-Prostaglandin J2 is a Ligand for the Adipocyte Determination Factor PPAR Gamma. Cell. 83, 803-812.
28. Nagy, L., Tontonoz, P., Alvarez, J. G., Chen, H., and Evans, R. M. (1998) Oxidized LDL Regulates Macrophage Gene Expression through Ligand Activation of PPARgamma. Cell. 93, 229-240.
29. Tontonoz, P., Hu, E., Graves, R. A., Budavari, A. I., and Spiegelman, B. M. (1994) MPPAR Gamma 2: Tissue-Specific Regulator of an Adipocyte Enhancer. Genes Dev. 8, 1224-1234.
30. Tontonoz, P., Hu, E., Devine, J., Beale, E. G., and Spiegelman, B. M. (1995) PPAR Gamma 2 Regulates Adipose Expression of the Phosphoenolpyruvate Carboxykinase Gene. Mol Cell Biol. 15, 351-357.
31. Schoonjans, K., Peinado-Onsurbe, J., Lefebvre, A. M., Heyman, R. A., Briggs, M., Deeb, S., Staels, B., and Auwerx, J. (1996) PPARalpha and PPARgamma Activators Direct a Distinct Tissue-Specific Transcriptional Response Via a PPRE in the Lipoprotein Lipase Gene. EMBO J. 15, 5336-5348.
33. Okuno, A., Tamemoto, H., Tobe, K., Ueki, K., Mori, Y., Iwamoto, K., Umesono, K., Akanuma, Y., Fujiwara, T., Horikoshi, H., Yazaki, Y., and Kadowaki, T. (1998) Troglitazone Increases the Number of Small Adipocytes without the Change of White Adipose Tissue Mass in Obese Zucker Rats. J Clin Invest. 101, 1354-1361.
34. Chawla, A., Boisvert, W. A., Lee, C. H., Laffitte, B. A., Barak, Y., Joseph, S. B., Liao, D., Nagy, L., Edwards, P. A., Curtiss, L. K., Evans, R. M., and Tontonoz, P. (2001) A PPAR Gamma-LXR-ABCA1 Pathway in Macrophages is Involved in Cholesterol Efflux and Atherogenesis. Mol Cell. 7, 161-171.
35. Akiyama, T. E., Sakai, S., Lambert, G., Nicol, C. J., Matsusue, K., Pimprale, S., Lee, Y. H., Ricote, M., Glass, C. K., Brewer, H. B.,Jr, and Gonzalez, F. J. (2002) Conditional Disruption of the Peroxisome Proliferator-Activated Receptor Gamma Gene in Mice Results in Lowered Expression of ABCA1, ABCG1, and apoE in Macrophages and Reduced Cholesterol Efflux. Mol Cell Biol. 22, 2607-2619.
37. Barroso, I., Gurnell, M., Crowley, V. E., Agostini, M., Schwabe, J. W., Soos, M. A., Maslen, G. L., Williams, T. D., Lewis, H., Schafer, A. J., Chatterjee, V. K., and O'Rahilly, S. (1999) Dominant Negative Mutations in Human PPARgamma Associated with Severe Insulin Resistance, Diabetes Mellitus and Hypertension. Nature. 402, 880-883.
38. Savage, D. B., Agostini, M., Barroso, I., Gurnell, M., Luan, J., Meirhaeghe, A., Harding, A. H., Ihrke, G., Rajanayagam, O., Soos, M. A., George, S., Berger, D., Thomas, E. L., Bell, J. D., Meeran, K., Ross, R. J., Vidal-Puig, A., Wareham, N. J., O'Rahilly, S., Chatterjee, V. K., and Schafer, A. J. (2002) Digenic Inheritance of Severe Insulin Resistance in a Human Pedigree. Nat Genet. 31, 379-384.
40. Hegele, R. A., Cao, H., Frankowski, C., Mathews, S. T., and Leff, T. (2002) PPARG F388L, a Transactivation-Deficient Mutant, in Familial Partial Lipodystrophy. Diabetes. 51, 3586-3590.
41. Ristow, M., Muller-Wieland, D., Pfeiffer, A., Krone, W., and Kahn, C. R. (1998) Obesity Associated with a Mutation in a Genetic Regulator of Adipocyte Differentiation. N Engl J Med. 339, 953-959.
42. Jones, J. R., Shelton, K. D., Guan, Y., Breyer, M. D., and Magnuson, M. A. (2002) Generation and Functional Confirmation of a Conditional Null PPARgamma Allele in Mice. Genesis. 32, 134-137.
43. Barak, Y., Nelson, M. C., Ong, E. S., Jones, Y. Z., Ruiz-Lozano, P., Chien, K. R., Koder, A., and Evans, R. M. (1999) PPAR Gamma is Required for Placental, Cardiac, and Adipose Tissue Development. Mol Cell. 4, 585-595.
44. Kubota, N., Terauchi, Y., Miki, H., Tamemoto, H., Yamauchi, T., Komeda, K., Satoh, S., Nakano, R., Ishii, C., Sugiyama, T., Eto, K., Tsubamoto, Y., Okuno, A., Murakami, K., Sekihara, H., Hasegawa, G., Naito, M., Toyoshima, Y., Tanaka, S., Shiota, K., Kitamura, T., Fujita, T., Ezaki, O., Aizawa, S., and Kadowaki, T. (1999) PPAR Gamma Mediates High-Fat Diet-Induced Adipocyte Hypertrophy and Insulin Resistance. Mol Cell. 4, 597-609.
45. Rieusset, J., Seydoux, J., Anghel, S. I., Escher, P., Michalik, L., Soon Tan, N., Metzger, D., Chambon, P., Wahli, W., and Desvergne, B. (2004) Altered Growth in Male Peroxisome Proliferator-Activated Receptor Gamma (PPARgamma) Heterozygous Mice: Involvement of PPARgamma in a Negative Feedback Regulation of Growth Hormone Action. Mol Endocrinol. 18, 2363-2377.
46. Michalik, L., Desvergne, B., Tan, N. S., Basu-Modak, S., Escher, P., Rieusset, J., Peters, J. M., Kaya, G., Gonzalez, F. J., Zakany, J., Metzger, D., Chambon, P., Duboule, D., and Wahli, W. (2001) Impaired Skin Wound Healing in Peroxisome Proliferator-Activated Receptor (PPAR)Alpha and PPARbeta Mutant Mice. J Cell Biol. 154, 799-814.
47. Miles, P. D., Barak, Y., He, W., Evans, R. M., and Olefsky, J. M. (2000) Improved Insulin-Sensitivity in Mice Heterozygous for PPAR-Gamma Deficiency. J Clin Invest. 105, 287-292.
48. Koutnikova, H., Cock, T. A., Watanabe, M., Houten, S. M., Champy, M. F., Dierich, A., and Auwerx, J. (2003) Compensation by the Muscle Limits the Metabolic Consequences of Lipodystrophy in PPAR Gamma Hypomorphic Mice. Proc Natl Acad Sci U S A. 100, 14457-14462.
49. Argmann, C., Dobrin, R., Heikkinen, S., Auburtin, A., Pouilly, L., Cock, T. A., Koutnikova, H., Zhu, J., Schadt, E. E., and Auwerx, J. (2009) Ppargamma2 is a Key Driver of Longevity in the Mouse. PLoS Genet. 5, e1000752.
50. Zhang, J., Fu, M., Cui, T., Xiong, C., Xu, K., Zhong, W., Xiao, Y., Floyd, D., Liang, J., Li, E., Song, Q., and Chen, Y. E. (2004) Selective Disruption of PPARgamma 2 Impairs the Development of Adipose Tissue and Insulin Sensitivity. Proc Natl Acad Sci U S A. 101, 10703-10708.
51. Medina-Gomez, G., Gray, S. L., Yetukuri, L., Shimomura, K., Virtue, S., Campbell, M., Curtis, R. K., Jimenez-Linan, M., Blount, M., Yeo, G. S., Lopez, M., Seppanen-Laakso, T., Ashcroft, F. M., Oresic, M., and Vidal-Puig, A. (2007) PPAR Gamma 2 Prevents Lipotoxicity by Controlling Adipose Tissue Expandability and Peripheral Lipid Metabolism. PLoS Genet. 3, e64.
52. Gray, S. L., Nora, E. D., Grosse, J., Manieri, M., Stoeger, T., Medina-Gomez, G., Burling, K., Wattler, S., Russ, A., Yeo, G. S., Chatterjee, V. K., O'Rahilly, S., Voshol, P. J., Cinti, S., and Vidal-Puig, A. (2006) Leptin Deficiency Unmasks the Deleterious Effects of Impaired Peroxisome Proliferator-Activated Receptor Gamma Function (P465L PPARgamma) in Mice. Diabetes. 55, 2669-2677.
55. Rangwala, S. M., Rhoades, B., Shapiro, J. S., Rich, A. S., Kim, J. K., Shulman, G. I., Kaestner, K. H., and Lazar, M. A. (2003) Genetic Modulation of PPARgamma Phosphorylation Regulates Insulin Sensitivity. Dev Cell. 5, 657-663.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine, Katherine Timer |
Authors | Zhe Chen, Jianhui Wang, Takuma Misawa, and Bruce Beutler |