Phenotypic Mutation 'eel'

• Allele: eel
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 11,858,733 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Npr3
• Gene Name: natriuretic peptide receptor 3
• Synonym(s): lgj, Nppc receptor, B430320C24Rik, NPR-C, longjohn
• Chromosomal Location: 11,839,982-11,907,287 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011] ; PHENOTYPE: Homozygous inactivation of this gene leads to partial postnatal lethality, altered blood homeostasis, polyuria, hypovolemia, hypotension, increased bone turnover, skeletal deformities and altered adipose morphology. Spontaneous and ENU-induced mutations cause a skeletal-overgrowth phenotype. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Phenylalanine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P70180
• SMART Domains: Protein: ENSMUSP00000066737; Gene: ENSMUSG00000022206; AA Change: I384F

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:ANF_receptor	66	417	1e-59	PFAM
transmembrane domain	477	499	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000066529)
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
  (Using ENSMUST00000228489)
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
  (Using ENSMUST00000228603)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Possibly essential (E-score: 0.541)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2012-02-07
• Science Writers: Eva Marie Y. Moresco
• Authors: Xin Du, Koichi Tabeta, Bruce Beutler

Accession Number

NCBI RefSeq: NM_008728; MGI: 97373

Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Spontaneous(4) Chemically induced(2)

Repository

none

Phenotypic Description

The eel phenotype was identified among G3 mice with ENU-induced mutations. Eel mice have an elongated body and tail detectable by 2 weeks of age (Figure 1). Eel mice develop thoracic kyphosis by 1 year of age.

Nature of Mutation

The eel mutation was mapped to Chromosome 15, and corresponds to an A to T transversion at position 1185 of the Npr3 transcript, in exon 4 of 8 total exons.

 

1170 GATGGGGGGAAAATCATCCAGCAGACTTGGAAC

379  -D--G--G--K--I--I--Q--Q--T--W--N-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of isoleucine to phenylalanine at residue 384 of the NPR3 protein.

Protein Prediction

Figure 2. Protein Structure of mouse NPR3. The majority of the protein consists of a large extracellular ligand-binding domain that contains a proximal and distal lobe (see Figure 3 for a schematic illustration of NPR3). The extracellular domain contains two disulfide bonds (103 ⇔ 131; 208 ⇔ 256) that facilitate the structure of the lobes (red bars); a interchain disulfide bond forms at aa 468 (not shown). The protein is N-glycosylated (G) at three sites and has three chloride binding sites (Ch) within the extracellular domain. Abbreviations: SP, signal peptide domain; TM, single pass transmembrane helix; CYTO, cytoplasmic domain; G, N-linked glycosylation; Ch, Chloride binding site. The eel mutation (I384F) is denoted by a red asterisk.

Figure 3. Schematic illustration of the NPR3 dimer in the membrane. The colors of the domains coordinate to the NPR3 protein structure in Figure 2 . The large extracellular regions (lobes) of the protein are thought to be supported by disulfide bonds, and possibly further stabilized by N-linked glycosylation (shown in green). The ligand binding site is indicated by pale blue between the axis of symmetry between the dimers. Of the natriuretic peptide receptors, NPR3 is unique in its ability to bind all three peptide hormones: ANP, BNP and CNP, see the text for further details. The eel mutation (I384F) is denoted by a red asterisk.

Figure 4. Crystal structure of NPR3. The dimer interface of NPR3 is shown in red. The linkage region between the proximal and distal lobes is shown in cyan. The NPR3 receptor is shown binding BNP,  one of the three complementary ligands for the receptor. This structure is based on PDB: 1YK1, (He X.L. et. al, J. Mol. Biol. 361:698-714 (2006)).  The molecular model was generated with the PyMOL Molecular Graphics System, Version 1.3, Schrödinger, LLC.

Npr3 encodes a 536-amino acid transmembrane protein (Figure 2). NPR3 has a single transmembrane domain near its C terminus, an approximately 440-amino acid extracellular domain, and a 37-amino acid cytoplasmic domain (Figure 3) (1;2). The extracellular domain of NPR3 contains three N-linked glycosylation sites (1). NPR3 proteins form homodimers mediated by their N-termini.

 

The crystal structure of NPR3 reveals that its extracellular domain has 2 lobes, designated the membrane-distal or proximal lobes (Figure 4) (3). The dimer interface consists of a complementary hydrophobic four-helix bundle formed by the membrane-distal lobes, which results in a vertical axis of symmetry running between the 2 molecules. This dimer places the ligand-binding site within the interdimer interface, such that a single natriuretic peptide (NP) may bind at one time. Binding of NP ligands occurs through contact primarily with C-terminal membrane-proximal lobes, with each member of the receptor dimer making distinct contacts with the ligand while the dimeric interface remains unchanged. This conformation is in contrast to that of the 2 other NP receptors (NPRs), which dimerize via their C-terminal domains and bind ligand with a 2:2 ligand:receptor stoichiometry. The short cytoplasmic domain of NPR3 contains several binding/activation sites for the inhibitory heterotrimeric G protein (Gi) (4).

The eel mutation results in an isoleucine to phenylalanine change at position 384 (I384F) of NPR3. I384 resides in exon 4, which forms part of the extracellular membrane-proximal domain. How the eel mutation affects protein expression or ligand binding is unknown.

Expression/Localization

NPR3 is widely expressed in the mouse, including in vascular smooth muscle cells, kidney glomeruli, pituitary glands, adrenal glands, cerebral cortex, striatum, and platelets (2). Of the 3 NPRs, NPR3 is the most widely and abundantly expressed, accounting for over 95% of all NPRs in vivo (3). NPR3 is localized to the plasma membrane.

Background

The family of natriuretic peptides consists of 3 peptide hormones called atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), and C-type natriuretic peptide (CNP) [reviewed in (2)]. ANP is mainly produced in cardiac atria, and BNP in ventricles; both are found in the circulation. CNP is most strongly expressed in the brain, but is also produced in vascular endothelial cells; its presence in the circulation is low. These 3 peptides play important and well- studied roles in the maintenance of cardiovascular homeostasis, blood pressure and body fluid regulation (5).

 

The function of the NPs is mediated by the NP receptors (NPRs): NPRA, NPRB and NPRC (here called NPR3). NPRA and NPRB respond preferentially to ANP and CNP, respectively, and both receptors transduce signals by activating their guanylyl cyclase domains to produce the intracellular second messenger cyclic GMP (cGMP). In contrast, NPR3 binds equally well to all 3 NPs (6) and does not possess guanylyl cyclase activity (7). Ligand binding to NPR3 results in internalization and degradation of NPs, thus removing them from the circulation (7;8). NPR3 can also mediate ligand-dependent signaling by inhibiting adenylyl cyclase through the activation of Gi, and promoting phospholipase C (PLC)-β-dependent phosphoinositide hydrolysis (2).

 

There are 4 hypomorphic alleles of Npr3 which provide insight into the physiological functions of the receptor. Three of these alleles (Npr3^lgj-2J, Npr3^lgj, Npr3^stri), like eel, contain mutations in the NPR3 extracellular domain, while Npr3^tm1Unc is a targeted mutant that expresses no NPR3 protein. All 4 mutants display elongated bodies and tails, with longer femurs, tibias, metatarsal and digital bones, and all develop thoracic kyphosis (9;10). The skeletal overgrowth of NPR3 mutants is due to delayed endochondral ossification (9), the process by which cartilage is replaced by bone tissue during development, and may also be affected by the 2-3 fold increased bone metabolism in these mutants (10). During endochondral ossification, chondrocytes in the growth plates located near the ends of long bones progress through developmental stages characterized by proliferation, maturation to become spherical cells, and differentiation into hypertrophic cells with very large cell volumes that provide for longitudinal bone growth [reviewed in (11)]. As cells pass the hypertrophic stage, they begin to produce large amounts of extracellular matrix that hardens the bones. The specific developmental stage at which NPR3 chondrocytes are delayed is yet unknown.

 

In addition to defects in bone development and homeostasis, NPR3 mutants also exhibit circulatory and renal defects (10). The blood pressure of Npr3^-/- mice is 8 mmHg lower compared to that of wild type mice. Npr3^-/- mice appear dehydrated, and display a substantial progressive increase in total daily urine output and water intake (10). This is combined with reduced urine osmolality, indicating that Npr3-/- mice have a progressively impaired ability to concentrate urine (10). Red blood cell numbers and hemoglobin levels also increased over time, indicating a decreased intravascular volume. Npr3^-/- mice have normal levels of ANP and BNP in the systemic circulation, and normal levels of the guanylyl cyclase-containing NPRA and NPRB receptors in the kidney, suggesting that the renal and hypotensive phenotypes are due to localized increases in the concentration of NPs (10).

Putative Mechanism

The contribution of NPs to bone morphogenesis is supported by the finding of NPRA, NPRB (12) and CNP (13) expression in the growth plate of mouse tibias. CNP is also detected in chondrocytes, osteoclasts and osteoblast-like cells (14-16). In vitro, CNP stimulates the longitudinal growth of mouse tibias (12), and CNP-deficient (13) or NPRB mutant mice (17) develop dwarfism due to impaired endochondral ossification. In addition, transgenic mice overexpressing BNP exhibit skeletal overgrowth and kyphosis (12). Together with the phenotypes of NPR3 mutants, these data implicate BNP, CNP, NPRB and NPR3 in bone morphogenesis. In particular, they suggest that the combined actions of BNP and CNP on NPRB and NPR3 receptors control bone growth. Human patients with mutations in NPRB develop Acromesomelic dysplasia Maroteaux type (AMDM), characterized by dwarfism (18).

 

As discussed above, ligand binding to NPRB stimulates it to produce cGMP by activating its guanylyl cyclase activity. In BNP-overexpressing transgenic mice which develop elongated bodies and thoracic kyphosis, cGMP production is increased in the tibia, suggesting that activation of a cGMP-dependent signaling pathway results in increased chondrocyte proliferation. This hypothesis is supported by the finding that cGMP accelerates rat metatarsal bone growth in organ culture (19), and that mice deficient in type II cGMP-dependent protein kinase (a major signal transduction mechanism of cGMP) exhibit dwarfism due to impaired endochondral ossification (20). Interestingly, CNP treatment of tibia cultures increases bone growth more potently than BNP (12), and CNP but not BNP is found in chondrocytes, suggesting that CNP is the physiological ligand for NPRB in the regulation of bone growth, activating it to produce cGMP. The skeletal overgrowth phenotype observed in BNP-overexpressing mice may be attributed to cross-reactivity of BNP with NPRB due to a greater than 200-fold overexpression of BNP in plasma (<0.06 pmol/ml in wild type versus 12.2 ± 1.2 pmol/ml in BNP-transgenic mice) (12).

 

NPR3 lacks a guanylyl cyclase domain, and is therefore often referred to as a “biologically silent” receptor. However, the obvious phenotype of NPR3 mutants clearly demonstrates that it is a biologically relevant and functional receptor strongly influencing bone morphogenesis. NPR3 functions as a clearance receptor for NPs, internalizing and degrading them before returning to the plasma membrane (7). Consistent with this function, the half-life of [¹²⁵I]ANP introduced into the circulation of Npr3^-/- mice is two thirds longer than in wild type mice (10). However, blood plasma levels of ANP and BNP are similar between Npr3-/- and wild type mice (10). These data suggest NPR3 may exert its effects on bone growth by dynamically regulating cGMP production by NPRB through localized control of CNP levels in the circulation. Whether circulating CNP levels are increased (systemically or locally) in NPR3 mutants is unknown, as is the molecular mechanism of NPR3-mediated CNP internalization.

Primers

Primers cannot be located by automatic search.

Genotyping

Eel genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.

 

Primers for PCR amplification

Eel(F): 5’- TGTCCAACTCTGTCGTGGGTCTCT -3’

Eel(R): 5’- ACATGCATTGCATTGTTTGGCCTT -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Eel_seq(F): 5’- AGACTCAGGCTGGACCATTTTG -3’

Eel_seq(R): 5’- AAGCCTCTCCGATGTAGATTG -3’

 

The following sequence of 998 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Npr3) is amplified:

 

46799                                                                tg
46801 tccaactctg tcgtgggtct ctcagacttc cagactcagg ctggaccatt ttgcctgctt
46861 gtatcacttg atgaacagga atcatcaggg tctcagactc acccaatggg tttcctttgc
46921 aggtgaacat gtttgttgaa gggttccatg acgccatcct cctctacgtt ctggctttac
46981 atgaagtact cagagctggc tacagcaaga aggatggggg gaaaatcatc cagcagactt
47041 ggaacaggac atttgaaggt agggattcgg tttccatggt agcagcacag cggccaaata
47101 agctgttgct tctgtgattg ctatctcctg gaacgaagaa ccgttctaga gtctttcttt
47161 ctccattaaa aaaaaatgtc tcatatatat tatatcccaa ccacagtttt ttccctcctt
47221 ccctcccagt tcctgtcccc acctcccttc ttcctccaat ccactcctcc atttcccttc
47281 caaaaagggc aggcctctca gagatgcctc tcaacatggt atattaagtt gcaataagac
47341 tagtcacctc ccctcatatt taaggctgca caaggcctta atagggcaaa aagggtacca
47401 acaacaggca aaagagtcat agacagcccc cacttctacc gttagtagtc ctaaagaaga
47461 ccaatctaca tcggagaggc ttcacccagc aactgatatg gagaaccaca gccaaacgtt
47521 aggaggagct cagagaatcc tatggaagcg gggaaggaag aattgaaggt gccagagggg
47581 tcaatgacac cacaagaaaa cacacagatt caactaacct gggttcatag ggacccaaag
47641 agacagaacc aacaatcagg gagccggtct aagtttgacc taggccctct ctgtatgcta
47701 cagttgtgta gctttctcta tttttaaagt atggataata agtcaattca agtcacaaag
47761 tcttgggaaa ataaggccaa acaatgcaat gcatgt                                                          

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.

References

   1.  Fuller, F., Porter, J. G., Arfsten, A. E., Miller, J., Schilling, J. W., Scarborough, R. M., Lewicki, J. A., and Schenk, D. B. (1988) Atrial natriuretic peptide clearance receptor. Complete sequence and functional expression of cDNA clones, J. Biol. Chem. 263, 9395-9401.

   2.  Anand-Srivastava, M. B. (2005) Natriuretic peptide receptor-C signaling and regulation, Peptides 26, 1044-1059.

   3.  He, X., Chow, D., Martick, M. M., and Garcia, K. C. (2001) Allosteric activation of a spring-loaded natriuretic peptide receptor dimer by hormone, Science 293, 1657-1662.

   4.  Pagano, M. and nand-Srivastava, M. B. (2001) Cytoplasmic domain of natriuretic peptide receptor C constitutes Gi activator sequences that inhibit adenylyl cyclase activity, J. Biol. Chem. 276, 22064-22070.

   5.  Kuhn, M. (2003) Structure, regulation, and function of mammalian membrane guanylyl cyclase receptors, with a focus on guanylyl cyclase-A, Circ. Res. 93, 700-709.

   6.  Bennett, B. D., Bennett, G. L., Vitangcol, R. V., Jewett, J. R., Burnier, J., Henzel, W., and Lowe, D. G. (1991) Extracellular domain-IgG fusion proteins for three human natriuretic peptide receptors. Hormone pharmacology and application to solid phase screening of synthetic peptide antisera, J. Biol. Chem. 266, 23060-23067.

   7.  Almeida, F. A., Suzuki, M., Scarborough, R. M., Lewicki, J. A., and Maack, T. (1989) Clearance function of type C receptors of atrial natriuretic factor in rats, Am. J. Physiol 256, R469-R475.

   8.  Maack, T., Suzuki, M., Almeida, F. A., Nussenzveig, D., Scarborough, R. M., McEnroe, G. A., and Lewicki, J. A. (1987) Physiological role of silent receptors of atrial natriuretic factor, Science 238, 675-678.

   9.  Jaubert, J., Jaubert, F., Martin, N., Washburn, L. L., Lee, B. K., Eicher, E. M., and Guenet, J. L. (1999) Three new allelic mouse mutations that cause skeletal overgrowth involve the natriuretic peptide receptor C gene (Npr3), Proc. Natl. Acad. Sci. U. S. A 96, 10278-10283.

 10.  Matsukawa, N., Grzesik, W. J., Takahashi, N., Pandey, K. N., Pang, S., Yamauchi, M., and Smithies, O. (1999) The natriuretic peptide clearance receptor locally modulates the physiological effects of the natriuretic peptide system, Proc. Natl. Acad. Sci. U. S. A 96, 7403-7408.

 11.  Newman, B. and Wallis, G. A. (2003) Skeletal dysplasias caused by a disruption of skeletal patterning and endochondral ossification, Clin. Genet. 63, 241-251.

 12.  Suda, M., Ogawa, Y., Tanaka, K., Tamura, N., Yasoda, A., Takigawa, T., Uehira, M., Nishimoto, H., Itoh, H., Saito, Y., Shiota, K., and Nakao, K. (1998) Skeletal overgrowth in transgenic mice that overexpress brain natriuretic peptide, Proc. Natl. Acad. Sci. U. S. A 95, 2337-2342.

 13.  Chusho, H., Tamura, N., Ogawa, Y., Yasoda, A., Suda, M., Miyazawa, T., Nakamura, K., Nakao, K., Kurihara, T., Komatsu, Y., Itoh, H., Tanaka, K., Saito, Y., Katsuki, M., and Nakao, K. (2001) Dwarfism and early death in mice lacking C-type natriuretic peptide, Proc. Natl. Acad. Sci. U. S. A 98, 4016-4021.

 14.  Hagiwara, H., Sakaguchi, H., Itakura, M., Yoshimoto, T., Furuya, M., Tanaka, S., and Hirose, S. (1994) Autocrine regulation of rat chondrocyte proliferation by natriuretic peptide C and its receptor, natriuretic peptide receptor-B, J. Biol. Chem. 269, 10729-10733.

 15.  Holliday, L. S., Dean, A. D., Greenwald, J. E., and Glucks, S. L. (1995) C-type natriuretic peptide increases bone resorption in 1,25-dihydroxyvitamin D3-stimulated mouse bone marrow cultures, J. Biol. Chem. 270, 18983-18989.

 16.  Inoue, A., Hiruma, Y., Hirose, S., Yamaguchi, A., Furuya, M., Tanaka, S., and Hagiwara, H. (1996) Stimulation by C-type natriuretic peptide of the differentiation of clonal osteoblastic MC3T3-E1 cells, Biochem. Biophys. Res. Commun. 221, 703-707.

 17.  Tsuji, T. and Kunieda, T. (2005) A loss-of-function mutation in natriuretic peptide receptor 2 (Npr2) gene is responsible for disproportionate dwarfism in cn/cn mouse, J. Biol. Chem. 280, 14288-14292.

 18.  Bartels, C. F., Bukulmez, H., Padayatti, P., Rhee, D. K., van Ravenswaaij-Arts, C., Pauli, R. M., Mundlos, S., Chitayat, D., Shih, L. Y., Al-Gazali, L. I., Kant, S., Cole, T., Morton, J., Cormier-Daire, V., Faivre, L., Lees, M., Kirk, J., Mortier, G. R., Leroy, J., Zabel, B., Kim, C. A., Crow, Y., Braverman, N. E., van den, A. F., and Warman, M. L. (2004) Mutations in the transmembrane natriuretic peptide receptor NPR-B impair skeletal growth and cause acromesomelic dysplasia, type Maroteaux, Am. J. Hum. Genet. 75, 27-34.

 19.  Mericq, V., Uyeda, J. A., Barnes, K. M., De, L. F., and Baron, J. (2000) Regulation of fetal rat bone growth by C-type natriuretic peptide and cGMP, Pediatr. Res. 47, 189-193.

 20.  Pfeifer, A., Aszodi, A., Seidler, U., Ruth, P., Hofmann, F., and Fassler, R. (1996) Intestinal secretory defects and dwarfism in mice lacking cGMP-dependent protein kinase II, Science 274, 2082-2086.