Phenotypic Mutation 'goofy' (pdf version)
Allelegoofy
Mutation Type missense
Chromosome2
Coordinate93,675,369 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Alx4
Gene Name aristaless-like homeobox 4
Synonym(s) Aristaless-like 4
Chromosomal Location 93,642,384-93,681,339 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a paired-like homeodomain transcription factor expressed in the mesenchyme of developing bones, limbs, hair, teeth, and mammary tissue. Mutations in this gene cause parietal foramina 2 (PFM2); an autosomal dominant disease characterized by deficient ossification of the parietal bones. Mutations in this gene also cause a form of frontonasal dysplasia with alopecia and hypogonadism; suggesting a role for this gene in craniofacial development, mesenchymal-epithelial communication, and hair follicle development. Deletion of a segment of chromosome 11 containing this gene, del(11)(p11p12), causes Potocki-Shaffer syndrome (PSS); a syndrome characterized by craniofacial anomalies, mental retardation, multiple exostoses, and genital abnormalities in males. In mouse, this gene has been shown to use dual translation initiation sites located 16 codons apart. [provided by RefSeq, Oct 2009]
PHENOTYPE: Depending on genetic background mutant mice may show preaxial polydactyly and other skeletal alterations, transitory alopecia, ventral body wall defects and male sterility. Homozygous mice of one allele die prenatally. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007442; MGI: 108359

MappedYes 
Amino Acid Change Histidine changed to Arginine
Institutional SourceBeutler Lab
Gene Model not available
AlphaFold O35137
SMART Domains Protein: ENSMUSP00000047962
Gene: ENSMUSG00000040310
AA Change: H272R

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
low complexity region 302 319 N/A INTRINSIC
Pfam:OAR 375 393 1.5e-12 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000042078)
SMART Domains Protein: ENSMUSP00000106885
Gene: ENSMUSG00000040310
AA Change: H272R

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
(Using ENSMUST00000111254)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Phenotypic Category
Phenotype question? Literature verified References
craniofacial
limbs/digits/tail phenotype
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% for general appearance; approximately 90% for polydactyly 
Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(1) Spontaneous(1) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:Alx4 APN 2 93677473 missense probably benign 0.10
PIT4519001:Alx4 UTSW 2 93675428 missense probably benign 0.00
R0367:Alx4 UTSW 2 93668608 missense probably damaging 1.00
R0436:Alx4 UTSW 2 93668357 nonsense probably null
R0864:Alx4 UTSW 2 93642855 missense probably damaging 1.00
R1913:Alx4 UTSW 2 93675387 missense probably damaging 1.00
R3712:Alx4 UTSW 2 93642789 missense possibly damaging 0.87
R4619:Alx4 UTSW 2 93642761 missense probably damaging 1.00
R5018:Alx4 UTSW 2 93677419 missense probably damaging 0.99
R5227:Alx4 UTSW 2 93677380 missense probably damaging 1.00
R6505:Alx4 UTSW 2 93668559 missense probably damaging 1.00
R7173:Alx4 UTSW 2 93642857 missense possibly damaging 0.82
R7792:Alx4 UTSW 2 93642711 missense probably damaging 1.00
R8209:Alx4 UTSW 2 93675351 missense possibly damaging 0.68
R8424:Alx4 UTSW 2 93677469 missense probably benign
R8697:Alx4 UTSW 2 93675312 missense probably damaging 1.00
R8884:Alx4 UTSW 2 93643010 missense possibly damaging 0.69
Z1177:Alx4 UTSW 2 93642656 start gained probably benign
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
MMRRC Submission 030202-UCD
Last Updated 2021-11-17 4:21 PM by Diantha La Vine
Record Created unknown
Record Posted 2007-08-24
Phenotypic Description

The goofy phenotype was detected among G3 mice homozygous for ENU-induced mutations. Homozygous goofy mice are viable and exhibit delayed or absent fur growth on the back and a snout that is shorter and slightly curved (upturned) (Figure 1A). Except for one out of more than a dozen, goofy mice display preaxial polydactyly (formation of one or more extra anterior digits) in the hind limbs, with an extra toe that is either a duplication of digit I (big toe) or a mirror image of digit II (Figure 1B). The forelimbs appear normal. Homozygous animals are fertile.

Nature of Mutation
The goofy mutation was mapped to Chromosome 2, and corresponds to an A to G transition at position ­1010 of the Alx4 transcript, in exon 4 of 5 total exons.
 
994 CAGCAGGTCCGGACCCACTTCTCCACGGCCTAT
267 -Q--Q--V--R--T--H--F--S--T--A--Y-
 
The mutated nucleotide is indicated in red lettering, and results in the amino acid substitution H272R.
Illustration of Mutations in
Gene & Protein
Protein Prediction
 

Figure 3. Crystallographic structure of ALX4. The paired homeodomain is bound to DNA as a cooperative paired (Pax) class homeodomain. The recogition helix is inserted into the major groove of the DNA, and achieves cooperative binding without the assistance of other domains. Structure is derived from PDB structure 1FJL (1). Structure generated with The PyMOL Molecular Graphics System, Version 1.3, Schrödinger, LLC.

Alx4 encodes a 399-amino acid transcription factor whose major features are a paired-type homeodomain near the center of the protein (nucleotides 799 to 978; amino acids 196 to 261), and a conserved sequence near the C terminus called a paired tail (also OAR/aristaless domain) (Figure 2).
 
Crystallographic and biochemical studies have shown that paired-type homeodomains bind as homo- or heterodimers to palindromic DNA sequences separated by 3 bp (Figure 3) (1;2). Unlike homeoproteins outside the paired-type class, which require domains outside the homeodomain for cooperative DNA binding and dimerization, the 60-amino acid paired-type homeodomain binds DNA cooperatively without the need for other sequences (2). Thus, Alx4 binds DNA using its single paired-type homeodomain

 

The goofy mutation replaces histidine with arginine at position 272 of Alx4. This position of this residue is 11 amino acids away from the end of the paired-type homeodomain, raising the possibility that such a mutation would impair the DNA binding ability of the protein. The expression level of Alx4 in goofy mutants has not been tested.

Expression/Localization
Alx4 mRNA is first detected in embryos at day 8.25 (E8.25) of gestation, in the cephalic mesenchyme (6). Expression continues to be associated predominantly with cells of mesenchymal origin, being found most strongly in developing bones of the craniofacial region, and there in the frontonasal mass (6;7). Alx4 is found in the anterior aspect of limb buds in 9.5-10.5 embryos, and at distal tips of extremities at later time points (6;7). Body hair follicles, vibrissae follicles, and dental papillae of developing teeth, all of mesenchymal origin, also strongly express Alx4 transcripts embryonically (7).
 
Alx4 is localized to the nucleus (7).
Background
Vertebrate limb development occurs through a process involving stages of limb bud initiation, early limb patterning, and late limb morphogenesis (Figure 4) (8). Once the limb bud has initiated, patterning depends on cues from three signaling centers which specify the proximal-distal, anterior-posterior and dorsal-ventral axes. These signaling centers are the apical ectoderm ridge (AER), a region of specialized epithelial cells at the dorsal-ventral border of the limb bud distal tip; the zone of polarizing activity (ZPA), a group of posterior mesenchymal cells; and the non-AER dorsal ectoderm, respectively.
 
The ZPA is the organizer of the anterior-posterior polarity of the limb bud. Grafting experiments demonstrate that ectopic transfer of ZPA tissue to a host anterior limb bud results in a mirror-image duplication of digits such that anterior digits adopt inappropriate posterior characteristics (9;10). Thus, the ZPA provides signals promoting posterior fates. The key ZPA signal is the secreted protein Sonic hedgehog (Shh) (11). It is produced by ZPA cells and is so far the only known factor capable of mediating the polarizing activity of the ZPA. Ectopic expression of Shh in the anterior limb bud mimics the mirror-image duplications of digits caused by ZPA grafting (11)

Figure 4. Normal embryologic limb pattering. The animation above depicts simplified images of early limb patterning. The growing limb bud is shown from the dorsal surface. For clarity, only selected signaling centers, transcription factors, and proteins are shown. The interaction between ZPA, Shh, and Alx4 is highlighted. Please refer to the text for further details on limb development.

The regulation of Shh expression and activity involves the function of several factors, including the zinc finger transcription factor Gli3 (Gli-Kruppel family member 3) (12), the bHLH transcription factor dHAND (Heart- and Neural Crest Derivatives-expressed 2) (13), and the secreted growth factor Wnt7a (14). Several Hox genes, such as Hoxb8, Hoxd11 and Hoxd12, also regulate Shh function by delimiting the region of the limb bud mesenchyme where Shh will be transcribed (15). For example, Hoxb8 expression follows the same pattern as polarizing activity in the chick flank and early forelimbs (16;17), and can induce ectopic expression of Shh in the anterior mouse limb bud (18). However, on its own, it is not required for AP polarity (17), and likely interacts with other Hox genes to exert its function. Finally, retinoic acid signaling is required for Shh expression and ZPA activity (16;19).
 
Defects in anterior-posterior patterning controlled by the ZPA may also manifest as preaxial polydactyly. Abnormal expression of a small anterior ZPA is observed in several mouse strains exhibiting heritable preaxial polydactyly, suggesting that these strains possess genetic defects in the components of a pathway to suppress inappropriate formation of anterior ZPAs (20-22). One such strain is Strong’s luxoid (lst), now known to contain a mutation in Alx4 (23).
 
lst mice (originally called Springville mice) were first observed in 1946 by Leonnel Strong, during 3-methylcholanthrene mutagenesis experiments investigating chemical induction of mammary tumors (24). A second allele, lstJ, arose spontaneously at The Jackson Laboratory (25). Both lst alleles are semidominant, with heterozygotes exhibiting either a broadened digit 1 or a single extra anterior triphalangeal digit (digit II or III) on the hindlimb (26). Homozygous lst mice display more severe defects, including extensive preaxial polydactyly of all four limbs (up to nine digits), absence of the tibia, craniofacial defects, dorsal alopecia, and a weakness of the ventral body wall (26;27). Recently, targeted Alx4 null mutants were generated, and these mice display a recessive phenotype of preaxial polydactyly of all four limbs, decreased size of the parietal plate of the skull, and ventral body wall defects (6). The extra digits of Alx4-/- mice possess posterior qualities, such as the presence of three phalanges, indicative of abnormal anterior-posterior patterning.
 
Mutations in human ALX4 are associated with parietal foramina-2 (PFM2) in Potocki-Schaffer syndrome (OMIM 609597) (28;29), a condition of symmetrical, paired radiolucencies (regions of thin skull) of the parietal bones typically round or oval in shape (30). Parietal foramina are caused by deficient ossification and leave the cerebral cortex unprotected. Normally there are no symptoms, but occasionally headaches, vomiting, or local pain accompany the condition (30).
Putative Mechanism
Anterior mesoderm from lst mutant limbs grafted onto host chicken limbs can induce the formation of an extra digit II, while wild type anterior mesoderm never induces extra digits. This demonstrates that lst anterior mesoderm has abnormal ZPA activity. Furthermore, this abnormal ZPA activity is likely mediated by Shh. In addition to normal expression in the posterior mesenchyme, ectopic anterior Shh expression is present in lst and Alx4-/- limb buds. This abnormal Shh expression in turn results in the ectopic anterior AER expression of FGF4 (6;20), a signal required together with FGF8 for successful limb development (31). FGF4 is normally restricted to the posterior AER and reinforced there by Shh in the ZPA, and vice versa (6;20). Thus, a mirror image of the normal posterior limb bud expression pattern of Shh and FGF4 is observed in the anterior limb bud of Alx4 mutants. Alx4 thus functions to repress Shh signaling and ZPA activity in the anterior limb bud.
 
A complex network of regulatory feedback mechanisms stimulate and reinforce the proper localized expression of transcription factors controlling and responsive to Shh. As mentioned above, transcription factors Gli3 and dHAND regulate Shh signaling. dHAND is required to establish Shh signaling in the limb bud posterior mesenchyme (13). Gli3 restricts dHAND expression to the posterior mesenchyme, and dHAND in turn excludes Gli3 and Alx4 from posterior mesenchyme, all prior to activation of Shh signaling (32). Gli3 also promotes full Alx4 expression in the posterior mesenchyme (32).
 
Alx4 interacts physically and genetically with Cart1, a closely related paired-type homeodomain transcription factor (33). Alx4 and Cart1 are 91% identical in their homeodomains, but highly divergent outside it (33). They show similar cooperative binding activity towards a palindromic DNA sequence, form heterodimeric DNA binding complexes, and activate transcription of a reporter to similar extents (33). During development, their expression patterns overlap substantially, although mice lacking these proteins exhibit distinct phenotypes. However, analysis of Alx4, Cart1 double mutants indicates that dose-dependent genetic interactions exist between these genes in limb patterning and craniofacial development (33). Together, these data support a subset of overlapping and cooperative activities for Alx4 and Cart1 in transcriptional regulation during embryonic development.
 
Finally, genetic interactions were recently reported between Alx4 and Lef1 in embryonic development (34). Alx4 likely interacts with a variety of partners in transcriptional regulation.
Primers Primers cannot be located by automatic search.
Genotyping
Goofy genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
 
Primers
Goofy(F): 5’- CCCTGACTTGTGGTGTCACTGCAGG -3’
Goofy(R): 5’- CCACTGTCCCAGCATTCTAGGTCTCC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:15
4) 72°C             0:30
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
The following sequence of 356 nucleotides (from Genbank genomic region NC_000068 for linear genomic sequence of Alx4) is amplified:
 
32775                ccctga cttgtggtgt cactgcagga gcagtgttcc ctgtctgaga
32821 gcaatgccta acccctgtga ccaccactgc tttgtcctgt aggtttggtt ccagaaccgg
32881 agggccaagt ggcgaaagag ggagcgcttt gggcagatgc agcaggtccg gacccacttc
32941 tccacggcct atgagttgcc cctcctcacc cgggctgaga actacgccca ggtatgtctc
33001 cttgcccatt ttgtcccctc tgaccctaga cctgagatga tgcaggggag gaggaggact
33061 aggctcacag aagccaggtg tgtgcttgtt tgtccctgac tgtgggagac ctagaatgct
33121 gggacagtgg
 
Primer binding sites are underlined; the mutated A is highlighted in red.
 
References
 24.  Strong, L. C. and Hardy, L. B. (1956) A new 'luxoid' mutant in mice, J. Hered. 47, 277-284.
 25.  Sweet H.O. and Davisson M.T. (1995) Remutations at The Jackson Laboratory (Update to Mouse Genome 1993; 91:862-5), Mouse Genome 93, 1030-1034.
Science Writers Eva Marie Y. Moresco
Illustrators Victoria Webster
AuthorsXin Du, Sophie Rutschmann, Bruce Beutler
Edit History
2011-01-07 9:12 AM (current)
2010-12-23 2:09 PM
2010-02-03 5:25 PM