Phenotypic Mutation 'souris'

• Allele: souris
• Mutation Type: unclassified (2 bp from exon)
• Chromosome: 13
• Coordinate: 13,857,808 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Lyst
• Gene Name: lysosomal trafficking regulator
• Synonym(s): D13Sfk13
• Chromosomal Location: 13,764,982-13,953,388 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013] ; PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000106188; Gene: ENSMUSG00000019726

Domain	Start	End	E-Value	Type
low complexity region	26	36	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	2295	2307	N/A	INTRINSIC
low complexity region	2427	2445	N/A	INTRINSIC
low complexity region	2534	2546	N/A	INTRINSIC
Pfam:PH_BEACH	3006	3101	5.8e-25	PFAM
Beach	3118	3408	1.25e-193	SMART
Blast:Beach	3441	3478	9e-13	BLAST
WD40	3539	3579	5.75e-1	SMART
WD40	3591	3630	2.89e-5	SMART
WD40	3633	3676	1.38e0	SMART
WD40	3724	3765	1.27e-1	SMART

• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Possibly nonessential (E-score: 0.414)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, Sperm, gDNA
• MMRRC Submission: 010470-UCD
• Last Updated: 2018-08-02 11:40 AM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2007-10-10
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Sophie Rutschmann, Celine Eidenschenk, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010748; MGI: 107448

Alleles Listed at MGI

All alleles(45) : Gene trapped(30) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Phenotypic Description

The souris phenotype was identified in two ENU-induced G3 littermates. Souris mice have a uniform dark gray coat color. The ears, feet and tail have a light pink to white color. The souris mutation confers mouse cytomegalovirus (MCMV) susceptibility, with homozygotes exhibiting a high splenic viral titer 5 days post-infection (similar to MCMV-infected Balb/c mice) (MCMV Susceptibility and Resistance Screen). Souris mice are susceptible to infection with Listeria monocytogenes. NK cells from souris mice fail to degranulate after antibody stimulation of NKp46 or Ly49H receptors, or after exposure to YAC-1 cells or PMA/ionomycin. However, intracellular production of interferon (IFN)-γ is normal after PMA/ionomycin stimulation.

 

Complementation testing demonstrated that the souris mutation is allelic with the beige locus, in which a Lyst mutation was identified (1;2).

Nature of Mutation

The souris mutation was mapped to Chromosome 13, and corresponds to a T to A transversion in the donor splice site of intron 27 (GTAAG -> GAAAG) of the Lyst gene (position 92815 in the Genbank genomic region NC_000079 for linear genomic DNA sequence of Lyst).  As Lyst cDNA from souris mice has not been sequenced, it is unknown how the mutation affects processing of the Lyst transcript.  The mutation likely results in skipping of the 167-nucleotide exon 27 (out of 53 total exons), destroying the reading frame (aberrant amino acids after position 2474), and creating a premature stop codon that would truncate the protein after amino acid 2482:

      <-- exon 26  <--exon 27 intron 27-->  exon 28-->
91104 TTAGAAAAGAA……AGGACACAAA GTAAGAATG……………ATATGGCTTTGGCCCTGCAGCTTAG 93574
2472  -L--E--K--N……-R--T--Q--               --Y--G--F--F--P--A--A--*  2482
       correct      deleted                         aberrant

The donor splice site of intron 27, which is destroyed by the souris mutation, is shown in blue; the mutated nucleotide is shown in red.

Protein Prediction

Figure 1. Domain structure of the Lyst protein. The Lyst protein is a 3788-amino acid protein whose biochemical functions remain unknown. The N-terminal portion of the protein contains approximately twenty repeats with homology to ARM  and HEAT repeat motifs and a perilipin domain (PD). The C-terminal portion of Lyst contains a BEACH  domain and seven WD40 motifs. The souris mutation occurs in intron 27 and results in eight aberrant amino acids after position 2474, followed by premature truncation of the protein after amino acid 2482. This image is interactive. This image is interactive. Click on the mutations (red) for more specific information.

The Lyst gene encodes the protein Lyst (also CHS/Beige), a 3788-amino acid protein whose biochemical functions remain unknown (Figure 1). A large N-terminal portion of the protein (amino acids 1-3132) contains approximately twenty repeats with homology to ARM (Armadillo) and HEAT (huntingtin, elongation factor 3, A subunit of protein phosphatase A, target of rapamycin) repeat motifs (3;4). ARM and HEAT motifs are α-helical domains of about 50 amino acids that pack together to form elongated “solenoids” (5); evidence suggests they mediate protein associations at the membrane (6), and vesicle transport (7), respectively. A perilipin domain (amino acids 1079-1313) may interact with lipids, as has been suggested for several other proteins (8). A 674-amino acid construct containing the perilipin domain can function as a dominant negative peptide that causes enlarged lysosomes when overexpressed in Cos-7 or HeLa cells (9). The C-terminus of Lyst contains two distinct domains, a BEACH (beige and chediak) domain (amino acids 3132-3472) and seven WD40 motifs (3). The BEACH domain is a 345-amino acid region of unknown function (3), and WD40 motifs are protein interaction motifs that typically form β sheets arranged in a 7-bladed β propeller fold (10). Database searches have identified one or more proteins in each of S. cerevisiae, C. elegans, D. discoideum, D. melanogaster, mice and humans that contain both BEACH and WD40 domains (3;4). So far, these proteins appear to have diverse functions [reviewed in (4)]. Notably, a C-terminal fragment of Lyst containing the BEACH and WD40 domains can act dominant negatively to cause enlarged lysosomes when expressed in Cos-7 or HeLa cells (9).

 

In addition to these protein domains, Lyst also contains potential phosphorylation sites for protein kinase C (PKC), casein kinase II (CKII), c-AMP-dependent protein kinase, and a tyrosine kinase (1).

 

The souris mutation results in eight aberrant amino acids after position 2474, followed by premature truncation of the protein.  This would delete four of the ARM/HEAT motifs, the BEACH domain and the WD40 motifs.  Expression of the mutated Lyst protein has not been tested.

Expression/Localization

Lyst transcripts are expressed ubiquitously in both mouse and human tissues (1;2). Several alternative transcripts are detected in various tissues, but their functional differences are unknown (1;11). The Lyst protein is localized in the cytoplasm (9;12).

Background

Figure 2. Biogenesis of lysosomes and lysosome-relateded organelles (LORs). Lysosomes are cytoplasmic organelles responsible for degradation within a cell. LROs share some features with lysosomes but have distinct morphologies and functions.

In humans, mutations in the Lyst gene cause Chediak-Higashi Syndrome (CHS, OMIM #214500), a rare autosomal recessive disorder characterized by oculocutaneous albinism, severe immune deficiency, bleeding tendency, recurrent pyogenic infection, progressive neurologic defects and a lymphoproliferative syndrome [(1;2), reviewed in (4)]. These defects are caused by the aberrant formation of giant granules within a variety of cell types, and disrupted intracellular protein trafficking (4;13;14). The enlarged granules consist of organelles such as lysosomes, melanosomes, cytolytic granules and platelet dense bodies, and it is thought that the increased size of these organelles inhibits their migration and fusion at the cell surface and/or organelle-organelle fusion (Figure 2). For example, CHS melanocytes produce normal amounts of melanin, the pigment for skin, hair and eyes, but melanosomes are abnormally large and fail to release their contents for absorption by keratinocytes (15). Secretion of abnormally large platelet dense bodies is delayed in CHS platelets, resulting in defective platelet coagulation and the bleeding tendency of CHS patients (16;17).

 

Defective lysosome-related functions in immune cells lead to immune deficiency, recurrent bacterial infections and lymphoproliferative disorder in CHS patients. CHS macrophages and polymorphonuclear leukocytes have normal phagocytic ability, but delayed fusion of phagosomes with lysosomes, allowing bacterial replication and escape and leading to persistent infections (4). Cytolytic T cells (CTLs) from CHS patients also fail to kill target cells recognized by the T cell receptor (TCR) due to an inability to secrete granules containing lytic proteins (18). Although these granules are abnormally large in CHS CTLs, they contain normal levels of properly processed lytic proteins (18;19). CHS patients also have impaired NK cell function, presumably due to defective degranulation of the single large granule, rather than the normal multiple small granules, present in these cells (20;21). Patients may also display an ‘accelerated phase’ of the disease, in which activated T cells infiltrate the major organs of the body; this phase may be associated with viral infection (22).

 

Human patients with CHS usually die during childhood from the immunologic complications of the disease. Bone marrow transplantation is an effective treatment to extend the lifespan of patients (23;24), although it does not prevent the extrahematopoietic symptoms of CHS. Humans with CHS that receive bone marrow transplant and live into adulthood develop neurologic defects including ataxia, sensory deficits and neurodegeneration (25). These are thought to result from accumulation of cytoplasmic inclusions in neurons that may prevent normal synaptic transmission (26).

 

In mice, mutations in Lyst cause the beige phenotype (1;2). As in humans, beige mice exhibit hypopigmentation, bleeding tendency, and defective immune cell function resulting from the formation of giant granules in melanosomes, lymphocytes, neutrophils, and other cell types (14;27;28). Beige mice have defective NK cell (29) and CTL function (30), and increased susceptibility to infections (31;32). However, beige mice do not develop lymphoproliferative disorder, even after challenge with infection (31).

Putative Mechanism

There is no clear understanding of the molecular mechanisms of Lyst protein function, or how its loss leads to the formation of enlarged lysosomes and lysosome-related organelles. Overexpression of Lyst in cultured mouse fibroblasts results in reduced lysosome size, suggesting that Lyst is important for vesicle fission (12). On the other hand, a yeast-two hybrid screen of cDNA libraries from human heart, keratinocyte, fetal brain, fetal liver and fetal kidney identified Lyst interactions with several regulators of the SNARE [SNAP (soluble NSF attachment protein) receptor] complex, which mediates vesicle fusion with the cell membrane or with target compartments such as lysosomes (33). Although the interactions were tested in vitro and have yet to be confirmed genetically, they raise the possibility that Lyst regulates SNARE-mediated membrane fusion. In support of this hypothesis, lysosomal exocytosis and membrane resealing are impaired after membrane wounding in CHS or beige fibroblasts (34). Lysosomal exocytosis contributes to the repair of plasma membrane lesions in a Ca²⁺-dependent manner. Furthermore, survival of membrane-wounded CHS and beige fibroblasts is reduced compared to wild type, and correlates with levels of lysosomal exocytosis (34). Thus, these data suggest that Lyst promotes both the processes of vesicle budding and vesicle fusion.

 

Unfortunately, studies of related proteins from other species containing both BEACH and WD40 domains do not shed much light on the function of Lyst. The functions of such proteins appear to be quite diverse (4). Studies of the LvsB protein of D. Discoideum, the closest BEACH- and WD40-containing homolog of Lyst in this species, indicate that LvsB in fact negatively regulates lysosome fusion (35;36). LvsB-null mutants contain enlarged vesicles that appear to be acidic lysosomes, and display increased fusion rates (35). A common mechanism or function shared by all BEACH- and WD40-containing proteins remains to be discovered.

 

Reports suggest that Lyst may regulate protein kinase C (PKC) activity. Membrane-bound PKC activity is reportedly abnormally downregulated in beige fibroblasts, macrophages and polymorphonuclear leukocytes after phorbol ester treatment (37). This aberrant PKC downregulation, and the formation of giant granules, can be inhibited by treatment with the thiol proteinase inhibitor E-64-d, a calpain inhibitor (38). The authors suggest that inhibition of calpain-mediated PKC proteolysis prevents giant granule formation (38). The mechanism of PKC regulation of lysosomes is unknown.

 

The souris mutation may result in expression of a significantly truncated protein missing four of the ARM/HEAT motifs, as well as the BEACH and WD40 domains.  Although the exact function of these domains remain to be discovered, it is likely that the souris mutation results in a protein with severely affected function.

Primers

Primers cannot be located by automatic search.

Genotyping

Souris genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  

 

Primers for PCR amplification

Souris(F): 5’- TCACCCTTCATGTAGACCAGGAACC -3’

Souris(R): 5’- TGCAGGGCCAAAGCCATATCTAAAC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Souris_seq(F): 5’- CAGAAGTCAATGTGCCTTACTTGC -3’

Souris_seq(R): 5’- GATGACCTTGAAATTCTGACCATCC -3’

 

The following sequence of 1228 nucleotides (from Genbank genomic region NC_000079 for linear genomic sequence of Lyst) is amplified:

 

92341 tcacccttca tgtagaccag gaacctgtgt gagtgttctc tgtgtatctt gtgttaatct

92401 ctagctgttg tttatgttgc tctcttaacc tgtatctttc tctacaagac tgtattttca

92461 acagaagtca atgtgcctta cttgcattcc tagtgggcag ggtatattgc ttgctgtata

92521 gagtaaacat gaacagttct taaatcattg catgctggta gcgtagagtt taaccagttc

92581 tttgtctttt aatttttcgg ctgttttgct tatagtatct tctgttttgt tttggactca

92641 ctttagcatt cctgtgaacg aatacaaatt gctcgcatgt gatatacagc agcttttcat

92701 agcagttaca attcatgctt gcagttcctc aggcacacag tattttagag tgattgaaga

92761 ccttattgta cttcttggat atcttcataa tagcaaaaac aagaggacac aaagtaagaa

92821 tggattttaa tggaattttt ctcataactt ttactgaaga tttaaagtta attatgtgtt

92881 ggtattaatt ggtatttaaa gcaaccttta aattgttgaa aatagagtga ttgatggttt

92941 gatgtaatta gtagttggca atacatcact ggcagaaact agtaattttt tttaccaagt

93001 agaatacaaa ggcatatgtt ggaagaataa tgggaatgct agcgtgactc atgagtgaaa

93061 gcgtgtaggg tattggagct tttgctttat acaaagttat tggtttttga aacagtcatt

93121 taaagtgaaa tcagtttagg atttatcatt ttttctattc aaatttttat agttgtagct

93181 agatatggtg atacatattc aagagatgga ggcaggatgg tcagaatttc aaggtcatct

93241 tcagctacat agcaggctaa cctgggctac aggaaacatg tctcaaaaat atcaaaaaat

93301 ttgtagtgac catatgggaa tttattttaa cattattttt aaatgtagct tagaaacact

93361 aacatcaaga acccatgttg atgaaacaat tttaacttgt gtctaaggcc ttttcattta

93421 gatattgaat attatagctt gaatattagg ttatatgcct tagatgttag ataatatatt

93481 aaataagttt agttaaaaga gttaaacaat tatgatagct tgaaaacatt ctagtctctt

93541 tgggtttaga tatggctttg gccctgca

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red.

 

References

   1.  Barbosa, M. D., Nguyen, Q. A., Tchernev, V. T., Ashley, J. A., Detter, J. C., Blaydes, S. M., Brandt, S. J., Chotai, D., Hodgman, C., Solari, R. C., Lovett, M., and Kingsmore, S. F. (1996) Identification of the homologous beige and Chediak-Higashi syndrome genes, Nature 382, 262-265.

   2.  Perou, C. M., Moore, K. J., Nagle, D. L., Misumi, D. J., Woolf, E. A., McGrail, S. H., Holmgren, L., Brody, T. H., Dussault, B. J., Jr., Monroe, C. A., Duyk, G. M., Pryor, R. J., Li, L., Justice, M. J., and Kaplan, J. (1996) Identification of the murine beige gene by YAC complementation and positional cloning, Nat. Genet. 13, 303-308.

   3.  Nagle, D. L., Karim, M. A., Woolf, E. A., Holmgren, L., Bork, P., Misumi, D. J., McGrail, S. H., Dussault, B. J., Jr., Perou, C. M., Boissy, R. E., Duyk, G. M., Spritz, R. A., and Moore, K. J. (1996) Identification and mutation analysis of the complete gene for Chediak-Higashi syndrome, Nat. Genet. 14, 307-311.

   4.  Shiflett, S. L., Kaplan, J., and Ward, D. M. (2002) Chediak-Higashi Syndrome: a rare disorder of lysosomes and lysosome related organelles, Pigment Cell Res. 15, 251-257.

   5.  Andrade, M. A., Petosa, C., O'Donoghue, S. I., Muller, C. W., and Bork, P. (2001) Comparison of ARM and HEAT protein repeats, J Mol. Biol. 309, 1-18.

   6.  Peifer, M., Berg, S., and Reynolds, A. B. (1994) A repeating amino acid motif shared by proteins with diverse cellular roles, Cell 76, 789-791.

   7.  Andrade, M. A. and Bork, P. (1995) HEAT repeats in the Huntington's disease protein, Nat. Genet. 11, 115-116.

   8.  Miura, S., Gan, J. W., Brzostowski, J., Parisi, M. J., Schultz, C. J., Londos, C., Oliver, B., and Kimmel, A. R. (2002) Functional conservation for lipid storage droplet association among Perilipin, ADRP, and TIP47 (PAT)-related proteins in mammals, Drosophila, and Dictyostelium, J Biol. Chem. 277, 32253-32257.

   9.  Ward, D. M., Shiflett, S. L., Huynh, D., Vaughn, M. B., Prestwich, G., and Kaplan, J. (2003) Use of expression constructs to dissect the functional domains of the CHS/beige protein: identification of multiple phenotypes, Traffic. 4, 403-415.

 10.  Sondek, J., Bohm, A., Lambright, D. G., Hamm, H. E., and Sigler, P. B. (1996) Crystal structure of a G-protein beta gamma dimer at 2.1A resolution, Nature 379, 369-374.

 11.  Barbosa, M. D., Barrat, F. J., Tchernev, V. T., Nguyen, Q. A., Mishra, V. S., Colman, S. D., Pastural, E., Dufourcq-Lagelouse, R., Fischer, A., Holcombe, R. F., Wallace, M. R., Brandt, S. J., de Saint, B. G., and Kingsmore, S. F. (1997) Identification of mutations in two major mRNA isoforms of the Chediak-Higashi syndrome gene in human and mouse, Hum. Mol. Genet. 6, 1091-1098.

 12.  Perou, C. M., Leslie, J. D., Green, W., Li, L., Ward, D. M., and Kaplan, J. (1997) The Beige/Chediak-Higashi syndrome gene encodes a widely expressed cytosolic protein, J Biol. Chem. 272, 29790-29794.

 13.  Faigle, W., Raposo, G., Tenza, D., Pinet, V., Vogt, A. B., Kropshofer, H., Fischer, A., de Saint-Basile, G., and Amigorena, S. (1998) Deficient peptide loading and MHC class II endosomal sorting in a human genetic immunodeficiency disease: the Chediak-Higashi syndrome, J Cell Biol. 141, 1121-1134.

 14.  Burkhardt, J. K., Wiebel, F. A., Hester, S., and Argon, Y. (1993) The giant organelles in beige and Chediak-Higashi fibroblasts are derived from late endosomes and mature lysosomes, J Exp. Med. 178, 1845-1856.

 15.  Zhao, H., Boissy, Y. L., bdel-Malek, Z., King, R. A., Nordlund, J. J., and Boissy, R. E. (1994) On the analysis of the pathophysiology of Chediak-Higashi syndrome. Defects expressed by cultured melanocytes, Lab Invest 71, 25-34.

 16.  Buchanan, G. R. and Handin, R. I. (1976) Platelet function in the Chediak-Higashi syndrome, Blood 47, 941-948.

 17.  White, J. G. (1978) Platelet microtubules and giant granules in the Chediak-Higashi syndrome, Am. J Med. Technol. 44, 273-278.

 18.  Baetz, K., Isaaz, S., and Griffiths, G. M. (1995) Loss of cytotoxic T lymphocyte function in Chediak-Higashi syndrome arises from a secretory defect that prevents lytic granule exocytosis, J Immunol. 154, 6122-6131.

 19.  Stinchcombe, J. C., Page, L. J., and Griffiths, G. M. (2000) Secretory lysosome biogenesis in cytotoxic T lymphocytes from normal and Chediak Higashi syndrome patients, Traffic. 1, 435-444.

 20.  Abo, T., Roder, J. C., Abo, W., Cooper, M. D., and Balch, C. M. (1982) Natural killer (HNK-1+) cells in Chediak-Higashi patients are present in normal numbers but are abnormal in function and morphology, J Clin. Invest 70, 193-197.

 21.  Roder, J. C., Haliotis, T., Klein, M., Korec, S., Jett, J. R., Ortaldo, J., Heberman, R. B., Katz, P., and Fauci, A. S. (1980) A new immunodeficiency disorder in humans involving NK cells, Nature 284, 553-555.

 22.  Rubin, C. M., Burke, B. A., McKenna, R. W., McClain, K. L., White, J. G., Nesbit, M. E., Jr., and Filipovich, A. H. (1985) The accelerated phase of Chediak-Higashi syndrome. An expression of the virus-associated hemophagocytic syndrome? Cancer 56, 524-530.

 23.  Haddad, E., Le, D. F., Blanche, S., Benkerrou, M., Rohrlich, P., Vilmer, E., Griscelli, C., and Fischer, A. (1995) Treatment of Chediak-Higashi syndrome by allogenic bone marrow transplantation: report of 10 cases, Blood 85, 3328-3333.

 24.  Kazmierowski, J. A., Elin, R. J., Reynolds, H. Y., Durbin, W. A., and Wolff, S. M. (1976) Chediak-Higashi syndrome: reversal of increased susceptibility to infection by bone marrow transplantation, Blood 47, 555-559.

 25.  Sung, J. H., Meyers, J. P., Stadlan, E. M., Cowen, D., and Wolf, A. (1969) Neuropathological changes in Chediak-Higashi disease, J Neuropathol. Exp. Neurol. 28, 86-118.

 26.  Hirano, A., Zimmerman, H. M., Levine, S., and Padgett, G. A. (1971) Cytoplasmic inclusions in Chediak-Higashi and Wobbler mink. An electron microscopic study of the nervous system, J Neuropathol. Exp. Neurol. 30, 470-487.

 27.  Kelly, E. M. (1957) Beige, bg, Mouse News Lett 16, 36.

 28.  Lutzner, M. A., Lowrie, C. T., and Jordan, H. W. (1967) Giant granules in leukocytes of the beige mouse, J Hered 58, 299-300.

 29.  Roder, J. C. (1979) The beige mutation in the mouse. I. A stem cell predetermined impairment in natural killer cell function, J Immunol. 123, 2168-2173.

 30.  Saxena, R. K., Saxena, Q. B., and Adler, W. H. (1982) Defective T-cell response in beige mutant mice, Nature 295, 240-241.

 31.  Shellam, G. R., Allan, J. E., Papadimitriou, J. M., and Bancroft, G. J. (1981) Increased susceptibility to cytomegalovirus infection in beige mutant mice, Proc. Natl Acad. Sci. U. S. A 78, 5104-5108.

 32.  Kirkpatrick, C. E. and Farrell, J. P. (1982) Leishmaniasis in beige mice, Infect. Immun. 38, 1208-1216.

 33.  Tchernev, V. T., Mansfield, T. A., Giot, L., Kumar, A. M., Nandabalan, K., Li, Y., Mishra, V. S., Detter, J. C., Rothberg, J. M., Wallace, M. R., Southwick, F. S., and Kingsmore, S. F. (2002) The Chediak-Higashi protein interacts with SNARE complex and signal transduction proteins, Mol. Med. 8, 56-64.

 34.  Huynh, C., Roth, D., Ward, D. M., Kaplan, J., and Andrews, N. W. (2004) Defective lysosomal exocytosis and plasma membrane repair in Chediak-Higashi/beige cells, Proc. Natl. Acad. Sci. U. S. A 101, 16795-16800.

 35.  Harris, E., Wang, N., Wu Wl, W. L., Weatherford, A., De, L. A., and Cardelli, J. (2002) Dictyostelium LvsB mutants model the lysosomal defects associated with Chediak-Higashi syndrome, Mol. Biol. Cell 13, 656-669.

 36.  Kypri, E., Schmauch, C., Maniak, M., and De, L. A. (2007) The BEACH protein LvsB is localized on lysosomes and postlysosomes and limits their fusion with early endosomes, Traffic. 8, 774-783.

 37.  Ito, M., Tanabe, F., Takami, Y., Sato, A., and Shigeta, S. (1988) Rapid down-regulation of protein kinase C in (Chediak-Higashi syndrome) beige mouse by phorbol ester, Biochem. Biophys. Res. Commun. 153, 648-656.

 38.  Tanabe, F., Cui, S. H., and Ito, M. (2000) Abnormal down-regulation of PKC is responsible for giant granule formation in fibroblasts from CHS (beige) mice--a thiol proteinase inhibitor, E-64-d, prevents giant granule formation in beige fibroblasts, J Leukoc. Biol. 67, 749-755.