Allele | languid | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 83,837,315 bp (GRCm38) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Tlr2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | toll-like receptor 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Ly105 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 83,836,272-83,841,767 bp (-) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016] PHENOTYPE: Homozygous null mice demonstrate abnormal responses to bacterial and viral infections. Mice homozygous for a knock-out allele also exhibit disruption in circadian active and inactive state consolidation. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Asparagine changed to Isoleucine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000029623 Gene: ENSMUSG00000027995 AA Change: N487I
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) ![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | CE: no linkage results | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | Tlr2tm1Aki, Tlr2tm1Dgen, Tlr2tm1Kir (Allele List at MGI) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Live Mice, Embryos, gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 012838-UCD | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-12-14 11:06 AM by Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2007-10-30 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description | The languid phenotype was identified in a G3 screen for mutants with altered response to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from homozygous languid mice fail to produce tumor necrosis factor (TNF)-α in response to the lipopeptides Pam3CSK4 (triacyl lipopeptide), Pam2CSK4 (diacyl lipopeptide), MALP-2 (macrophage-activating lipopeptide-2; diacyl lipopeptide) and peptidoglycan (all TLR2 ligands). The deficit in TNF-α production by languid cells mirrors that of Tlr2-null cells. Languid cells produce normal levels of TNF-α in response to lipopolysaccharide (LPS; TLR4 ligand). Heterozygous languid macrophages behave as wild type.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | ![]() 1955 CTCTATATTTCCAGAAATAAGCTGAAAACACTC
482 -L--Y--I--S--R--N--K--L--K--T--L-
The mutated nucleotide is indicated in red lettering, and results in an asparagine to isoleucine change at position 487 of the TLR2 protein.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction | TLR2 is a 784-amino acid type 1 transmembrane glycoprotein receptor, with regions of hydrophobicity corresponding to a signal peptide at its N-terminus and a transmembrane domain near the middle of the protein (1;2). Like the other TLRs, its cytoplasmic domain shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (1;2), which mediates homo- and heterotypic protein interactions in signal transduction. TIR domains in TLRs and in IL receptors contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (3). In addition, TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (2;4). The crystal structures of the TLR1 and TLR2 TIR domains revealed that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (4) (Figure 1; PDB ID 1FYW). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4, which abolishes MyD88 binding (5) and LPS-induced signaling in mice (6).
The extracellular domains of TLRs, unlike those of the interleukin receptors, contain multiple leucine-rich repeats (LRRs), each of which consists of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) and XØXXØX4FXXLX (variable in length, sequence and structure), where X is any amino acid and Ø is a hydrophobic amino acid [discussed in (7)]. The XLXXLXLXX sequence folds into a β-strand. TLR2 has 20 such LRRs (2;8). Each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (7). While “typical” LRR family proteins normally bind ligands on the concave surfaces of the horseshoe, the crystal structure of a TLR1-TLR2-Pam3CSK4 complex (ectodomains of the TLRs fused to the hagfish Variable Lymphocyte Receptor VLRB.61) revealed that ligand binding to TLR2 occurs in a crevice on the convex side of the horseshoe (8) (Figure 2; PDB ID 2Z7X). The surface of this crevice is completely lined with hydrophobic resides from LRR modules 9-12 (8). Crystallization of the complex also revealed that the Pam3CSK4 ligand is indispensable for heterodimerization of TLR1 and TLR2, because the ligand bridges the two proteins with its lipid chains (8). In addition, Pam2CSK4, a diacylated peptide, could not induce heterodimerization of TLR1 and TLR2 (8).
The conserved asparagine residues at the end of XLXXLXLXXN consensus sequences of the LRRs create an “asparagine ladder” in which a continuous network of hydrogen bonds forms between the asparagines and neighboring backbone oxygens (8). Since the β strands form the inner core of the ectodomain, disruption of the ladder is predicted to significantly affect the overall protein structure (9). The languid mutation results in an asparagine to isoleucine change at position 487 of the TLR2 protein, in the conserved asparagine residue of LRR module 18. An asparagine residue at this position is conserved in TLR2 orthologues from 14 mammalian species (10). Mutant protein expression has not been examined in languid cells. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Northern blot analysis of human tissues revealed strong Tlr2 expression in peripheral blood leukocytes (1). Tlr2 transcript is also detected in spleen, thymus, prostate, testis, ovary, small intestine, colon, lung, heart, brain and muscle (1;2). TLR2 is localized on the cell surface, but may be recruited to macrophage phagosomes where it can be activated by phagocytosed ligands (11).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
TLRs are type I transmembrane proteins that sense molecules of microbial origin and trigger host cell responses. There are 12 TLRs in mice, and 10 in humans, and each receptor recognizes a distinct microbial ligand. TLR2 recognizes microbial lipopeptides (12;13), lipoteichoic acid (LTA) (14) and zymosan (11). TLR2 forms heterodimers with TLR1 or TLR6, to detect triacyl lipopeptides or diacyl lipopeptides, respectively. The synthetic peptides Pam3CSK4 (tripalmitoyl-cysteinylseryl-(lysyl)3-lysine) and Pam2CSK4 (dipalmitoyl- cysteinylseryl-(lysyl)3-lysine) are commonly used as experimental ligands for TLR2. Interestingly, some diacyl lipopeptides, such as Pam2CSK4, are recognized by TLR6-deficient cells (in a TLR2-dependent manner), suggesting that a TLR2 homodimer or a new heterodimer may recognize some lipopeptide species (15). Upon ligand binding, the activated TLR2 heterodimer transduces the signal through the adapter proteins MyD88 and TIRAP (TIR-domain-containing adaptor protein), which recruit and activate several IRAKs (IL-1-receptor-associated kinases) and TRAF6 (tumor necrosis factor receptor-associated factor 6) [reviewed in (16;17)] (Figure 3) Their functions lead to the activation of the IKK (IκB kinase) complex, which phosphorylates IκB, leading to the liberation of NF-κB for translocation to the nucleus and transcriptional activation. MAP kinase may also be activated through TRAF6; it controls AP-1 regulated gene expression. Transcriptional activation of cytokines, including TNF and IL-6, results in the initiation of a local inflammatory response.
Study of the Cd36obl/obl (oblivious) mouse mutant demonstrated that the Cd36 receptor is required for TLR2-dependent detection of certain lipopeptides (18). Oblivious macrophages exhibit reduced TNF-α production in response to MALP-2 and LTA, but normal TNF-α production stimulated by peptidoglycan, zymosan and Pam3CSK4 (18). Cd36obl/obl mice, like TLR2-deficient mice, are also highly susceptible to infection by Staphylococcus aureus (18;19). Thus, while the nature of their interaction is unknown, Cd36 is a co-receptor for TLR2 recognition of certain ligands.
The Cd14 receptor also enhances signaling through TLR2 upon stimulation by lipopeptides (23-25). Cd14 is a glycophosphatidylinositol-anchored LRR-containing protein found in proximity to TLR2 at the cell membrane, and proposed to facilitate the transfer of lipopeptide ligands to TLR2 complexes (23;24). This nature of this transient interaction is also unknown.
In humans, a TLR2 polymorphism resulting in substitution of arginine for tryptophan at position 677 of TLR2 is associated with lepromatous leprosy (20), a disease caused by Mycobacterium leprae invasion of the peripheral nerves that primarily causes skin lesions (OMIM #246300). TLR2 mediates innate immune recognition of M. leprae, and the Arg677Trp mutant fails to activate NF-κB in response to M. leprae when expressed in HEK293 cells (21).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The languid mutation replaces the conserved asparagine residue of LRR module 18 of TLR2 with an isoleucine. As mentioned above (Protein prediction), these conserved asparagines form an “asparagine ladder,” in which a continuous network of hydrogen bonds forms between the asparagines and neighboring backbone oxygens (8). The β strands form the inner core of the ectodomain, and disruption of the ladder is predicted to significantly affect the overall protein structure (9). Furthermore, LRR module 18 is near the end of the LRR series in TLR2, and would be positioned close to the C-terminal LRR (LRR-CT), whose sequence (and probably structure) is highly conserved both in Drosophila Toll and mammalian TLRs (7). The LRR-CT of TLRs lies only two to ten residues from the transmembrane domain, and is believed to constrain the position of the LRR-CT at the membrane, and in turn the entire TLR ectodomain relative to the cell surface (7). Mutations in the LRR-CT of Drosophila Toll can result in a constitutively active receptor (22). The proximity of the languid mutation to the LRR-CT suggests that it may disrupt the position and structure of the LRR-CT, and thereby the entire ectodomain. Consistent with this hypothesis, the languid phenotype closely resembles the phenotype of Tlr2-/- mice.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | The languid mutation introduces an Mse I restriction enzyme site in the Tlr2 genomic DNA sequence. Languid genotyping is performed by amplifying the region containing the mutation using PCR, followed by Mse I restriction enzyme digestion.
Primers
languid_F: 5’- CTCAGACGCTGGAGGTGTTGGATGTTAG -3’
languid_R: 5’- GCAGCCTGGTGACATTCCAAGACG -3’
PCR program
1) 94°C 5:00
2) 94°C 0:30
3) 55°C 0:30
4) 68°C 1:00
5) repeat steps (2-4) 39X
6) 68°C 10:00
7) 4°C ∞
The following sequence of 400 nucleotides (from Genbank genomic region NC_000069 for Tlr2 linear genomic sequence) is amplified:
4360 c tcagacgctg gaggtgttgg
4381 atgttagtaa caacaatctt gactcatttt ctttgttctt gcctcggctg caagagctct
4441 atatttccag aaataagctg aaaacactcc cagatgcttc gttgttccct gtgttgctgg
4501 tcatgaaaat cagagagaat gcagtaagta ctttctctaa agaccaactt ggttcttttc
4561 ccaaactgga gactctggaa gcaggcgaca accactttgt ttgctcctgc gaactcctat
4621 cctttactat ggagacgcca gctctggctc aaatcctggt tgactggcca gacagctacc
4681 tgtgtgactc tccgcctcgc ctgcacggcc acaggcttca ggatgcccgg ccctccgtct
4741 tggaatgtca ccaggctgc
Primer binding sites are underlined; the novel Mse I site is highlighted in gray; the mutated A is indicated in red.
Restriction Digest
Digest PCR reactions with Mse I. Run on 2% agarose gel with heterozygous and C57BL/6J controls.
Products: languid allele- 94 bp, 306 bp. Wild type allele- 400 bp.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Michael Berger, Bruce Beutler |