Phenotypic Mutation 'cartoon' (pdf version)
Gene Symbol Mmp14
Gene Name matrix metallopeptidase 14 (membrane-inserted)
Synonym(s) matrix metalloproteinase 14 (membrane-inserted), type 1 matrix metalloprotease 14, Membrane type 1-MMP, MT1-MMP, MT-MMP-1, AI325305
Accession Number

NCBI RefSeq: NM_008608; MGI: 101900

Allele cartoon
Institutional SourceBeutler Lab
Mapped Yes 
Chromosome 14
Chromosomal Location 54,431,604-54,441,258 bp (+)
Type of Mutation MISSENSE
DNA Base Change
(Sense Strand)
T to C at 54,439,999 bp (GRCm38)
Amino Acid Change Serine changed to Proline
Ref Sequences
S466P in NCBI: NP_032634.3 (fasta)
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PG_binding_1 36 88 9.4e-8 PFAM
ZnMc 115 285 6.01e-58 SMART
HX 323 366 3.97e-9 SMART
HX 368 412 1.42e-10 SMART
HX 415 461 4.45e-12 SMART
HX 463 508 1.61e-9 SMART
low complexity region 515 533 N/A INTRINSIC
transmembrane domain 540 562 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.93)
(Using NCBI: NP_032634.3)
Phenotypic Category craniofacial, growth/size, lethality-embryonic/perinatal, life span-post-weaning/aging, reproductive system, vision/eye
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(3) Chemically induced(1)

Lab Alleles APN: IGL01317:Mmp14
UTSW: R0053:Mmp14, R0538:Mmp14, R0612:Mmp14, X0064:Mmp14
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
Repository

MMRRC: 030391-UCD

 

Last Updated 12/12/2013 6:56 PM by Stephen Lyon
Record Created unknown
Record Posted 07/02/2012
Phenotypic Description
The cartoon mutation was recovered serendipitously in the course of confirming an immunological phenodeviant. Cartoon mice show craniofacial anomalies: a shortened head and snout, and very large-appearing eyes (Figure 1). The physical development of cartoon mice is retarded or arrested at an early stage. The average body weight of 7-week-old cartoon mice is 7.75±0.62g, compared to 20.56±2.38g for their wild type littermates.
 
The average life span of cartoon mice is approximately 3 months, and homozygotes do not breed. In heterozygote crosses, only half of the expected number of homozygotes are born, consistent with some degree of embryonic lethality.

 

 

Nature of Mutation
The cartoon mutation mapped to Chromosome 14, and corresponds to a T to C transition at position 1642 of the Mmp14 transcript, in exon 9 of 10 total exons.
 
1627 GAATCTCCCAGGGGGTCATTCATGGGCAGTGAT
461  -E--S--P--R--G--S--F--M--G--S--D-
 
The mutated nucleotide is indicated in red lettering, and causes a serine to proline substitution at residue 466 of the Mmp14 protein.
Protein Prediction

Figure 2. A 'typical' MMP and MMP14 have conserved domains. (A) The domains of a 'typical' released MMP family (e.g. MMP-1,-3,-8,-10,-12,-13,-18,-19, -20, -22, and -27). (B) The domains of membrane-bound mouse MMP14.  The cartoon mutation is a serine to proline change at amino acid 466 and is indicated by a red asterisk. Abbreviations: SP, signal peptide; Pro, propeptide region; Fr, furin cleavage site; IS, insertion site; Zn2+, zinc binding site; Hx, hemopexin-like repeat; T, transmembrane domain.  

Figure 3. Catalytic domain of human MMP14 (PDB: 1BQQ(10)). The catalytic domain of MMP14 is a spherical molecule with a catalytic binding site consistent with other MMP family members. There are four sites for the binding of two zinc and two calcium ions. The N-terminus is indicated in yellow. The C-terminal hemopexin-like domains are not solved in this structure. The truncated portion of the hinge domain is shown in blue. Model generated with UCSF Chimera.

Figure 4. Crystal structure of human MMP14 (orange) bound to bovine tissue inhibitor of metalloproteinases-2 (TIMP2) (cyan). This crystal structure (based on PDB: 1BQQ(10)) contains only the catalytic domain of MMP14; the hinge and hemopexin-like domains were not solved. See Figure 3 and the text for more details.  Model generated with UCSF Chimera. 

Figure 5. Full length MMP1. This porcine MMP1 structure demonstrates the hemopexin-like domains common to members of the MMP family of proteinases. The four hemopexin-like repeats take the form of a four-bladed β-propeller. As MMP1 is a released MMP, it does not contain the transmembrane domain like MMP14. The hinge region between the catalytic domain and hemopexin domains is shown in blue.  The catalytic domain is highly similar to other MMPs. (See Figure 6 for an alignment of the catalytic domain of MMP14 and MMP1). This model is based on PDB : 1FBL; (17). The Zn2+ and Ca2+ sites as well as the C- and N-termini are indicated.  Roman numerals indicate the four blades of the propeller. Model generated with UCSF Chimera. 

Figure 6. Alignment of the catalytic domains of human MMP14 and porcine MMP1. Structural homology between the catalytic domains of MMP1 (white) and MMP14 (orange) are demonstrated by approximate alignment of the two structures. Model generated with UCSF Chimera, which calculated the structural homology as 43.1%. The catalytic domain of MMP14 is based on PDB: 1BQQ; the MMP1 structure is based on PDB:1FBL. The Zn2+ and Ca2+ sites as well as the C- and N- termini are indicated. 

MMP14 (matrix metallopeptidase 14; also MT1-MMP, membrane type 1- matrix metalloproteinase) is a 582 amino acid membrane-type metalloproteinase, one of six members of this subclass of metalloproteinases [reviewed in (1)]. Like other metalloproteinases (Figure 2A), at its N terminus MMP14 contains a signal peptide with a hydrophobic core (amino acids 1-20) followed by a propeptide domain (Figure 2B) (2;3). The propeptide domain, and specifically four amino acids (YGYL) within it, functions as an “intramolecular chaperone” for MMP14; i.e. deletion of the entire propeptide or mutation of these four amino acids results in a membrane-bound but nonfunctional protein, and expression of the propeptide in trans restores proteolytic activity (4;5). The bulk of the protein then consists of the core enzyme catalytic domain containing a Zn2+-binding site. A hinge region follows, and a hemopexin-like domain that contains several hemopexin-like repeats (2;3).

 

Three conserved insertion sequences (IS-1, IS-2 and IS-3) distinguish the membrane-type MMPs from MMPs, which are secreted proteins. IS-1 is an eleven amino acid insertion containing a proprotein convertase cleavage sequence recognized by furin-like proteins, and located between the propeptide domain and the catalytic domain of MMP14 (2;3). Cleavage of this sequence activates MMP14 (6). IS-2 is an eight amino acid insertion in the catalytic domain which may influence proteolytic function toward the substrate proMMP2 (3). Near the C-terminus and within the hemopexin domain of MMP14, IS-3 is an approximately 60 amino acid insertion containing a stretch of 24 hydrophobic amino acids that form a transmembrane domain, as well as a short cytoplasmic tail (2;3). IS-3 is required for proper localization to the cell membrane (7;8). The cytoplasmic tail is predicted to serve a cell signaling role, and contains three putative phosphorylation sites (S577, Y573, T567) with unknown function (9).

 

The cartoon mutation results in substitution of a proline for serine 466, which lies near the center of the hemopexin-like domain.

 

The crystal structure of a recombinant MMP14 catalytic domain (Figure 3) in a 1:1 complex with bovine tissue inhibitor of metalloproteinases-2 (TIMP-2) has been solved [Figure 4 (PDB:1BQQ); (10)].  MMP14 and TIMP-2 interact through six sequentially separated segments. TIMPs not only inhibit MMPs, they are also known to exhibit growth factor-like activity and inhibit angiogenesis (reviewed in (11;12)).  TIMP-2 in complex with MMP14 assists in the processing of progelatinase A (13-15), a process necessary for remodeling processes and degenerative diseases as well as tumor invasion and metastasis (reviewed in (10)).  The catalytic domain of MMP14 is a spherical molecule that contains an active-site cleft.  The body of the molecule is a five-stranded mixed β-pleated sheet with three surface loops on the convex side and two α-helices on the concave side.  The active site of MMP14 contains four metal sites that bind two zinc and two calcium ions, similar to other MMPs.    MMP14 has a uniqe conformation and length of the N-terminal segment, a MT-loop, and the sV-hB loop similar to other solved MMP-TIMP structures (16). In addition, the substrate binding region of MMP14 looks similar to other MMPs (10).  

 

Crystallization of full-length porcine MMP1, a "typical" MMP, shows a catalytic domain, hemopexin-like domain, and hinge domain similar to those found in MMP14 [Figure 5 (PDB:1FBL); (17)].  Similar to MMP14, a linker connects the tightly packed N-terminal catalytic domain and the C-terminal hemopexin-like domains.  Examination of the C-terminal hemopexin-like-containing structure revealed that each of the hemopexin-like domains contains a sheet of four antiparallel β-strands to form a four-bladed propeller structure.  Alignment of the catalytic domains of porcine MMP1 with human MMP14 reveals the structural similarities between typical and membrane-bound MMPs (Figure 6).

 

Expression/Localization
Northern blot analysis detected Mmp14 transcript in most tissues examined, including heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas (3). Several cancer cell lines (squamous cell carcinoma OSC-19, bladder carcinoma T24, osteosarcoma SK-ES-1) also express Mmp14 transcript (3). MMP14 is localized at the cell membrane (2;3).
Background

The extracellular matrix (ECM) is a dense three-dimensional mesh of proteins (e.g. collagen, fibronectin) and proteoglycans (e.g. heparan sulfate, chondroitin sulfate proteoglycans) secreted by cells, and surrounding and supporting the cells of the body. ECM serves both structural and signaling roles, providing anchorage for cells, regulating cell migration and sequestering/releasing growth factors and cytokines. Cells express receptors for distinct components of the ECM, and receptor engagement activates multiple signaling pathways regulating development, morphogenesis and homeostasis. The MMPs are zinc endopeptidases capable of degrading structural components of the ECM, and contribute to these processes by modifying the cell-ECM interface and releasing sequestered molecules (18). Conversely, cancer cells can activate MMPs in order to break down basement membranes during metastasis.

 

Figure 7. The roles of MMPs in cancer. Matrix metalloproteases (MMPs) play a variety of roles in cancer including remodelling of the cellular matrix and proccessing growth factors and receptors as well as interacting with several factors involved in apoptosis, inflammation, angiogenesis, cell migration, and malignant metastasis. Adapted from Hua, H., et al., 2011.

Tumor tissues express a variety of MMPs with several functions (Figure 7); MMP inhibitors have received much attention as potential cancer therapeutics (19). MMP14 was first identified as a proteinase and activator of proMMP2 (2;13), a significant finding due to the association of MMP2 (also gelatinase A) with tumor invasion. MMP2 can degrade type IV collagen, a major component of the basement membrane, and is found in activated form in carcinomas with lymph node or distant metastasis (20;21). In addition, MMP2-deficient mice have significantly reduced tumor invasion, metastasis and angiogenesis in tumor models (22). Transgenic overexpression of MMP14 in mouse mammary glands results in increased MMP2 activation, lymphocytic infiltration, fibrosis, hyperplasia, dysplasia and adenocarcinoma (23). Recently, MMP14 has been shown to directly promote tumor cell growth in a three dimensional matrix by proteolysis of type I collagen (24). Thus, MMP14 is thought promote tumor invasion by both activating MMP2 in tumors and degrading the physical ECM barrier to tumor cell penetration.

 

MMPs may help tumor cells escape from immune surveillance (19). Some MMPs cleave receptors and chemokines that promote the development, proliferation or chemotaxis of tumor-fighting T lymphocytes, natural killer cells, neutrophils and macrophages. For example, MMP9 can cleave and inactivate interleukin-2 receptor-α (IL-2Rα), a positive regulator of T cell development and proliferation (25). Cervical cancer cells can induce release of IL-2Rα on encountered T cells via MMP9 in vitro (25). A similar role for MMP14 is unconfirmed, but MMP14 is positioned ideally to function in this manner. However, in a situation contrary to this hypothesis, MMP14 can cleave CXCL12 (also stromal-cell-derived factor 1, SDF1), a ligand for CXCR4 (26). Inhibition of CXCL12 binding to CXCR4 has been shown to reduce breast cancer cell metastasis to lung and lymph nodes (27). Thus, cleavage of CXCL12 may prevent its association with CXCR4 and inhibit metastasis.

 

In addition to MMP2, substrates for MMP14 include a wide variety of ECM proteins such as fibronectin, proteoglycans, laminin, and collagens (6;28;29). This broad substrate specificity suggests that MMP14 may contribute to numerous biological events that rely on structural remodeling of the ECM, particularly during development. Targeted deletion of MMP14 confirmed that MMP14 functions in very many developmental processes (30). MMP14-deficient mice develop a severe skeletal and soft connective tissue phenotype characterized by craniofacial dysmorphism, arthritis, osteopenia and fibrosis of soft tissues (30). Interestingly, although MMP14-/- mice appear normal at birth, growth impairment becomes evident by 5 days of age and continues throughout life, with animals dying between days 50 and 90 (30). Thus, collagen remodeling only relies on MMP14 postnatally, and an MMP14-independent mechanism holds this function during prenatal development.

 

Figure 8. Function of MT1-MMP in FGFR signaling. MT1-MMP has been demonstrated to form a complex with FGFR and a member of the ADAM family of metalloproteases, ADAM9. MT1-MMP is involved in the shedding of ADAM9 catalytic domains on the surface of osteoblasts. A recent study (32) has demonstrated that MT1-MMP is crucial for downstream signaling from FGFR involved in normal calvarial bone development through signaling via the fibroblast growth factor receptor substrate 2 (Frs2) docking protein. ERK1/2 is subsequently activated and signaling through mitogen-activated protein kinases 1 and 3 (ERK1/2) phosphorylates target transcription factors (TFs).  Blue spheres indicate Ca2+ ions, and red spheres indicate Zn2+ ions. Schematic illustations of surface proteins are based on the following PDB ID entries: PDB:2ERO; FGFR1/FGF2/18, PDB:1FQ9, MT1-MMP, PDB:1FBL. Models generated with both PyMol and UCSF Chimera. Figure adapted from (32).

All of the MMP14-/- mouse phenotypes recognized to date are caused by a generalized deficiency of cellular collagenolytic activity (30). MMP14-/- skin or bone marrow-derived fibroblasts are unable to degrade type I collagen fibrils in vitro (30). As a result, mutant mice develop severe and progressive fibrosis in many tissues. Bone formation and growth are severely impaired in MMP14-/- mice, for example in the skull and long bones, and may also be attributed to defective collagen degradation, because proper bone growth requires the coordinated remodeling of bone and adjacent soft connective tissues. MMP14-/- osteogenic progenitor cells cannot degrade a type I collagen matrix. Likely as a compensatory mechanism for loss of the ability to remodel connective tissue, bone remodeling appears to be accelerated in MMP14-deficient mice. Excessive bone resorption occurs in MMP14-/- mice, particularly at bone/soft tissue interfaces (30). This defect is compounded by the progressive entrapment of osteogenic cells in the ECM of the periosteum, preventing them from reaching the bone surface where bone matrix deposition occurs (30). Together, these effects cause a net bone resorption, contributing (along with defective formation of secondary ossification centers) to dwarfed stature, cranial dysmorphism, and progressive osteopenia (30;31).

 

A recent study found that MMP14 forms a complex with fibroblast growth factor receptor 2 (FGFR2) and ADAM9 in osteoblasts (Figure 8) (32).  FGFRs are essential for ossification during skull development (33).  Furthermore, mutations that activate FGFR1 and FGFR2 result in several human craniofacial diseases (e.g. Crouzon syndrome (OMIM: #123500) and Apert syndrome (OMIM: #101200)) (34). This study found that the formation of the FGF2-MMP14-ADAM9 complex protects FGFR2 from ADAM9-mediated ectodomain shedding on the cell surface (32).  Analysis of Mmp14-/- osteoblasts found that FGF-induced proliferation was compromised with a concomitant upregulation in ADAM9 and FGFR2 shedding (32).  Interestingly, depletion of Adam9 can rescue FGFR2 signaling and restore skull bone growth in Mmp14-/- embryos.
Putative Mechanism

Figure 9. Upregulation of ADAM9 in the absence of MT1-MMP . Chan, et. al.  (32) demonstrated defective FGFR signaling, upregulation of ADAM9, and shedding of FGFR in Mmp14 -/- mice.  Schematic illustations of surface proteins are based on the following PDB ID entries: ADAM9, PDB: 2ERO; FGFR1/FGF2/18, PDB:1FQ9. Models generated with both PyMol and UCSF Chimera. Figure adapted from (32).

In most other MMP mouse mutants, embryonic and postnatal development occurs normally. In contrast, the severe phenotype observed in MMP14-deficient mice supports the conclusion that MMP14 is the major postnatal type I collagenolytic activity. Whether MMP14 activity towards other ECM substrates also contributes to development is unknown. MMP2 is thought to be an important substrate for MMP14 in cancer progression. However, MMP2-null mice have no developmental defects other than being slightly smaller than wild type mice, suggesting that MMP2 is not a predominant substrate for MMP14 during development (35).

 

Cartoon mice harbor a mutation in the center of the hemopexin-like domain. Using recombinant proteins and cultured cell lines, the hemopexin-like domain has been shown to mediate a variety of functions and protein interactions. It has been shown to be required for MMP14 processing to its mature, active form, and trafficking to the cell membrane (36). Domain swapping experiments demonstrated that the MMP14 hemopexin-like domain is required, independently of the catalytic domain, for cell migration (37). MMP14-induced cell migration activates the small Rho GTPase family member Rac, and dominant negative Rac blocks MMP14-induced migration (37). Thus, it is possible that mutation of the hemopexin-like domain completely inhibits MMP14 function (similar to a null mutation) by blocking its maturation and trafficking, and/or that cell migration is specifically impaired.

 

The hemopexin-like domain mediates MMP14 homodimer formation, postulated to promote localized concentrations of MMP14 to facilitate MMP2 activation (38). Since MMP2 is unlikely to be a developmentally important MMP14 substrate, homodimerization may serve some other function. The MMP14 hemopexin-like domain also mediates association with and cleavage of the hyaluronan receptor CD44 (39), which contributes to lymphocyte activation as well as metastatic potential in cancer cells.

 

In light of the recent findings by Chan et al. (32) as discussed in the "Background" section, it is probable that the craniofacial abnormalities observed in the cartoon mice are a result in defective FGFR2-mediated signaling following upregulated ADAM9 activity (Figure 9).

 

Genotyping
Cartoon genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
 
Primers
Car(F): 5’- ACGCCCAGTATCCAACCACTCC -3’
Car(R): 5’- TGGAAAGACTGAGGGTACTACACATG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 58°C             0:20
4) 72°C             1:00
5) repeat steps (2-4) 35X
6) 72°C             5:00
7) 4°C               ∞
 
The following sequence of 320 nucleotides (from Genbank genomic region NC_000080 for linear genomic sequence of Mmp14) is amplified:
 
8244                          acgccca gtatccaacc actccccttt ccttcccctc
8281 ccccaggtac taccggttca atgaagaatt cagggcagtg gacagcgagt accctaaaaa
8341 catcaaagtc tgggaaggaa tccctgaatc tcccaggggg tcattcatgg gcagtgatga
8401 aggtgagtga agcaaaggaa actatagaga agggcaagct tggggagcca aggaaaagca
8461 gaaaggcagg tcttgtggaa agcattgatg gtgtagcagt gggggctggg ggcttgccag
8521 gaaagagcca agtgttttca tgtgtagtac cctcagtctt tcca
 
Primer binding sites are underlined; the mutated T is highlighted in red.
References
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Victoria Webster
AuthorsXin Du, Bruce Beutler
Edit History
02/01/2011 1:49 PM (current)
10/08/2010 1:15 PM
02/03/2010 5:32 PM