Phenotypic Mutation 'gansu' (pdf version)
Allelegansu
Mutation Type missense
Chromosome7
Coordinate30,870,105 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Cd22
Gene Name CD22 antigen
Synonym(s) Lyb-8, Lyb8
Chromosomal Location 30,865,402-30,880,342 bp (-)
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001043317 (variant 1), NM_009845 (variant 2); MGI:88322

Mapped Yes 
Amino Acid Change Valine changed to Methionine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000019248] [ENSMUSP00000103760] [ENSMUSP00000139685] [ENSMUSP00000141178] [ENSMUSP00000140521] [ENSMUSP00000139871] [ENSMUSP00000140528] [ENSMUSP00000150025]
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: V529M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000019248)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: V529M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000108125)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: V529M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000186154)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: V529M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000189718)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: V529M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000190617)
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect probably benign
Predicted Effect probably damaging

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
(Using ENSMUST00000214289)
Meta Mutation Damage Score 0.7721 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased 15378059
FACS B:T cells - decreased
FACS B1a cells - increased
FACS B1a cells in B1 cells - increased
FACS B2 cells - decreased
FACS IgD+ B cell percentage - decreased 15378059
FACS IgM+ B cells - decreased 15378059
Candidate Explorer Status CE: excellent candidate; human score: 3; ML prob: 0.892
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(17) : Chemically induced (ENU)(4) Targeted(13)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30876147 missense probably benign 0.01
IGL02236:Cd22 APN 7 30867468 missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30869883 missense probably damaging 1.00
IGL02335:Cd22 APN 7 30876134 missense probably damaging 1.00
IGL02397:Cd22 APN 7 30877625 missense probably benign
IGL02402:Cd22 APN 7 30877530 missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30877560 missense probably benign 0.40
IGL02736:Cd22 APN 7 30878045 splice site probably null
crullers UTSW 7 30869883 missense probably damaging 1.00
lacrima UTSW 7 30876153 missense probably damaging 1.00
Lluvia UTSW 7 30870487 missense possibly damaging 0.48
Mist UTSW 7 30866658 missense probably damaging 1.00
rain UTSW 7 30877534 missense probably damaging 1.00
well UTSW 7 30877787 nonsense probably null
Yosemite UTSW 7 30869509 critical splice donor site probably null
FR4304:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30877799 missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30867108 splice site probably benign
R0130:Cd22 UTSW 7 30869964 missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30869509 critical splice donor site probably null
R1245:Cd22 UTSW 7 30869883 missense probably damaging 1.00
R1332:Cd22 UTSW 7 30870487 missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30873170 missense probably benign 0.07
R1716:Cd22 UTSW 7 30877678 missense probably damaging 1.00
R1980:Cd22 UTSW 7 30873233 missense probably damaging 1.00
R2017:Cd22 UTSW 7 30872780 missense probably damaging 0.99
R2061:Cd22 UTSW 7 30870105 missense probably damaging 1.00
R2061:Cd22 UTSW 7 30876156 missense probably benign 0.03
R2075:Cd22 UTSW 7 30869698 missense probably damaging 1.00
R2216:Cd22 UTSW 7 30867046 missense probably damaging 1.00
R3886:Cd22 UTSW 7 30870107 missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30875900 missense probably damaging 0.98
R4701:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R4796:Cd22 UTSW 7 30872956 synonymous probably null
R5179:Cd22 UTSW 7 30875874 missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30877534 missense probably damaging 1.00
R5456:Cd22 UTSW 7 30876039 missense probably benign 0.02
R5511:Cd22 UTSW 7 30870071 missense probably damaging 1.00
R5513:Cd22 UTSW 7 30867025 missense probably damaging 0.99
R5611:Cd22 UTSW 7 30878150 unclassified probably benign
R5656:Cd22 UTSW 7 30869773 missense probably damaging 1.00
R5966:Cd22 UTSW 7 30866658 missense probably damaging 1.00
R6329:Cd22 UTSW 7 30877768 missense probably damaging 0.99
R6356:Cd22 UTSW 7 30877702 missense probably damaging 1.00
R6455:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R6550:Cd22 UTSW 7 30877552 missense probably benign 0.00
R6656:Cd22 UTSW 7 30877757 missense probably benign 0.11
R6688:Cd22 UTSW 7 30872964 missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30873431 splice site probably null
R6957:Cd22 UTSW 7 30867574 missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30878079 missense probably benign 0.03
R7083:Cd22 UTSW 7 30868048 missense probably damaging 0.99
R7225:Cd22 UTSW 7 30877634 missense not run
R7732:Cd22 UTSW 7 30870057 missense probably damaging 1.00
X0025:Cd22 UTSW 7 30873419 unclassified probably null
Z1176:Cd22 UTSW 7 30867963 missense probably benign 0.03
Z1176:Cd22 UTSW 7 30869530 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 038209-MU
Last Updated 2019-09-04 9:45 PM by Diantha La Vine
Record Created 2015-07-30 10:00 PM by Ming Zeng
Record Posted 2015-08-05
Phenotypic Description

Figure 1. Gansu mice exhibit a decrease in the B:T cell frequency in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Gansu mice exhibit a reduced frequency of B cells frequency in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Gansu mice exhibit a reduced frequency of IgM+ B cells frequency in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine IgM+ B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Gansu mice exhibit a reduced percentage of IgD+ B cells frequency in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine IgD+ B cell percentage. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Gansu mice exhibit a reduced frequency of B2 cells frequency in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Gansu mice exhibit an increased frequency of B1a cells frequency in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Gansu mice exhibit an increased frequency of B1a cells in B1 cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gansu phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2061, some of which showed a decreased in the B:T cell ratio (Figure 1) caused by a diminished frequency of B cells (Figure 2), a reduced frequency of IgM+ B cells (Figure 3), a decreased percentage of IgD+ B cells (Figure 4), a reduced frequency of B2 cells (Figure 5), an increased frequency of B1a cells (Figure 6), and an increased frequency of B1a cells in B1 cells (Figure 7), all in the peripheral blood.

Nature of Mutation

Figure 8. Linkage mapping of the reduced peripheral B1a cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 132 mutations (X-axis) identified in the G1 male of pedigree R2061. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 132 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd22: a G to A transition at base pair 30,870,105 (v38) on chromosome 7, or base pair 10,238 in the GenBank genomic region NC_000073. The strongest association was found with a recessive model of linkage to the normalized frequency of B1a cells in the peripheral blood, wherein six variant homozygotes departed phenotypically from five homozygous reference mice and six heterozygous mice with a P value of 6.881 x 10-8 (Figure 8).  A substantial semidominant effect was observed in several of the assays, but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 1,948 in the mRNA sequence NM_001043317 (variant 1) within exon 10 of 16 total exons and to residue 1,823 in the mRNA sequence NM_009845 (variant 2) within exon 8 of 14 total exons.

 

10224 TACGCCCCCAGAGACGTGAAGGTACTGAAGGTA

524   -Y--A--P--R--D--V--K--V--L--K--V-

 

Genomic DNA numbering corresponds to NC_000073. The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to methionine (M) substitution at position 529 (V529M) in both isoforms of the CD22 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 9. Domain structure of CD22. The gansu mutation results in a valine (V) to methionine (M) substitution at position 529 (V529M). Abbreviations: SP, signaling peptide; TM, transmembrane domain; ITIM, immunoreceptor tyrosine-based inhibitory motif. The image is interactive; click to view other mutations affecting CD22.

CD22 belongs to the Siglec (sialic acid-binding) family of adhesion molecules (1;2) (Figure 9). Siglecs are members of the immunoglobulin (Ig) superfamily, which specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates. Siglec proteins are type 1 transmembrane proteins with a sialic acid-binding N-terminal Ig-like V-type domain, variable numbers of Ig-like C2-type domains, a transmembrane region, and a cytoplasmic tail. CD22 contains seven Ig-like C2-type domains in its extracellular region at amino acids 31-147, 156-254, 269-337, 365-424, 448-523, 541-599, and 628-687 (1). The gansu mutation results in a valine (V) to methionine (M) substitution at position 529 (V529M) between the fifth and sixth Ig-like C2-type domains.

 

See the record well for more information about Cd22.

Putative Mechanism

CD22 is one of two Siglecs expressed by B cells (the other being Siglec-G), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [reviewed in (3;4)].  CD22 associates with a number of BCR signaling molecules including the BCR complex itself. Upon cross-linking of the BCR by antigen, associated CD22 is rapidly phosphorylated by Lyn (5-7).  The subsequent association of SHP1 with CD22 leads to the dephosphorylation of a number of BCR signaling components that dampens the BCR signal and Ca2+ mobilization such as Vav-1, CD19, and BLNK (8-10). In response to BCR stimulation, CD22-deficient B cells predominantly undergo apoptosis (11). Although CD22 appears to be dispensable for the differentiation of B cells to mature follicular cells, CD22-deficient B cells express less surface IgM, which may be a consequence of a faster and more complete maturation process. In addition, CD22-deficient mice have severely reduced numbers of marginal zone B (MZB) cells, and increased numbers of B-1 peritoneal cells was observed in two of the four knockout strains (12-15). The loss of MZB cells and increased B-1 cell numbers in these mice may be due to altered BCR signaling during development as maturation into the three mature B cell subsets is driven in part by differences in BCR signal strength, and a strong BCR signal disrupts MZB development and promotes B-1 differentiation [reviewed by (16;17)]. Due to the lack of MZB cells, these animals display impaired immune responses to T-independent antigens (12;15;18), while T-dependent immune responses remain intact and subsequent germinal center formation occurs normally (11). Mice carrying the gansu allele share several phenotypes with the Cd22 knockout mice including defects in peripheral B cell maturation that are likely caused by reduced MZB cell numbers. A defect in immune responses to T-dependent or T-independent antigens was not observed in the gansu mice indicating that some residual CD22 function may occur in the gansu mice.

Primers PCR Primer
gansu_pcr_F: GATGGAGTTGTTGACCATGCAG
gansu_pcr_R: AGGTCACATTGAGATCTGTGGG

Sequencing Primer
gansu_seq_F: GTTGACCATGCAGTTATAATTTCCAG
gansu_seq_R: CACATTGAGATCTGTGGGTGGGAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 424 nucleotides is amplified (chromosome 7, - strand):


1   aggtcacatt gagatctgtg ggtgggagag tgaggggagg ggatggggac tcgggccaca
61  ggccaaaaga gagggttgag ggaggacgca cagggctcag cgccaaggag acagggtgtc
121 ctaatcaagg ggacaggaaa ctttggggac atcaagaagg gaagaaaacc aaaacatcac
181 ctgaggctgt ggccctgcag acgcccccag agacgtgaag gtactgaagg taagccccgc
241 atcagagatc cgcgctgggc agcgtgtcct cctccaatgc gacttcgcag agagcaaccc
301 ggcagaggtc cgcttcttct ggaagaagaa tgggagtctc gtgcaggaag ggaggtacct
361 gagcttcggc tccgtctccc cagaagattc tggaaattat aactgcatgg tcaacaactc
421 catc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Torres, R. M., Law, C. L., Santos-Argumedo, L., Kirkham, P. A., Grabstein, K., Parkhouse, R. M., and Clark, E. A. (1992) Identification and Characterization of the Murine Homologue of CD22, a B Lymphocyte-Restricted Adhesion Molecule. J Immunol. 149, 2641-2649.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Xue Zhong, Bruce Beutler