Phenotypic Mutation 'oblivious'

• Allele: oblivious
• Mutation Type: intron
• Chromosome: 5
• Coordinate: 17,874,966 bp (GRCm38)
• Base Change: A ⇒ T (forward strand)
• Gene: Cd36
• Gene Name: CD36 molecule
• Synonym(s): fatty acid translocase, FAT, Scarb3
• Chromosomal Location: 17,781,690-17,888,801 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014] ; PHENOTYPE: Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q08857
• SMART Domains: Protein: ENSMUSP00000131832; Gene: ENSMUSG00000002944

Domain	Start	End	E-Value	Type
Pfam:CD36	12	465	2.5e-149	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000143107; Gene: ENSMUSG00000002944

Domain	Start	End	E-Value	Type
Pfam:CD36	12	142	1.8e-36	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.128)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Embryos, Sperm, gDNA
• MMRRC Submission: 010471-UCD
• Last Updated: 2017-03-28 4:18 PM by Katherine Timer
• Record Created: unknown
• Record Posted: 2007-11-08
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Kasper Hoebe, Bruce Beutler

Accession Number

NCBI RefSeq: NM_007643; MGI: 107889

Alleles Listed at MGI

All alleles(3) : Targeted, knock-out(2) Chemically induced(1)

Phenotypic Description

Figure 1. Responses of oblivious macrophages to various TLR ligands. Wild-type (solid squares), obl /+ (solid triangle) and obl / obl (open circle) macrophages were incubated with various concentration of each ligand. Obl / obl macrophages did not respond normally to the TLR2/6 ligands PGN, MALP-2, but showed normal responses to the TLR2 ligands zymosan and Pam 3 CSK 4 , the TLR4 ligand LPS, the TLR7 ligand resiquimod, the TLR9 ligand CpG and the TLR3 ligand poly I:C. Figure reproduced from reference ( 1 ).

The oblivious phenotype was identified in a screen of G3 homozygous mutant mice for defective responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1). Peritoneal macrophages from oblivious mice produce reduced (but not absent) amounts of tumor necrosis factor (TNF)-α in response to Mycoplasma pneumoniae macrophage-activating lipopeptide 2 (MALP-2), Staphylococcus aureus lipoteichoic acid (LTA), and peptidoglycan (PGN). The reduced response to MALP-2 is specific for the R-enantiomer of the molecule. In contrast, TNF-α production stimulated by lipopolysaccharide (LPS, TLR4 ligand), resiquimod (TLR7 ligand), poly I:C (TLR3 ligand), CpG ODN (TLR9 ligand), and the TLR2 ligands zymosan, Pam₂CSK₄ and Pam₃CSK₄, is normal in oblivious macrophages (1) (Figure 1). Thus, the oblivious locus apparently contributes to (but is not absolutely required for) TLR2-dependent detection of certain lipopeptides, either delivered as pure preparations or present as contaminants in commercial preparations of LTA and PGN.

 

Oblivious mice, like TLR2-deficient mice, are highly susceptible to infection by Staphylococcus aureus (1;2). They accumulate higher levels of bacteria, and die more frequently than wild type mice when infected intravenously (1). By six-to-twelve months, oblivious homozygotes also develop an ocular pterygium (a wing-shaped thickening in the conjunctiva), probably due to an overgrowth of Gram-positive bacteria such as Staphylococcus lentus and Corynebacterium species. Occasionally this opportunistic colonization progresses to more serious infection of the eye (1).

 

Finally, CD4⁺ but not CD8⁺ T cell responses to apoptotic cells are abrogated in oblivious mice (3). In this assay, mice are immunized with apoptotic syngeneic cells expressing a membrane-associated ovalbumin peptide. After 8 days, splenocytes are isolated, restimulated with ovalbumin peptide, and antigen-specific CD8⁺ T cell numbers and CD4⁺ T cell proliferation are measured. While antigen-specific CD8⁺ T cell responses are normal, CD4⁺ T cell proliferation is absent in oblivious mice.

 

Nature of Mutation

The oblivious mutation was mapped to Chromosome 5, and corresponds to a T to A transversion at position 1283 of the Cd36 transcript, in exon 11 of 15 total exons.

 

1266 GAAGGAAAGCCTGTGTATATTTCGCTTCCACAT

335  -E--G--K--P--V--Y--I--S--L--P--H-

 

The mutation creates a premature stop codon at codon 340, resulting in deletion of 133 amino acids from the C terminus of the protein.

Protein Prediction

Figure 2. Domain structure of CD36. The oblivious mutation creates a premature stop codon in place of tyrosine at amino acid 340. The positions of cysteines are indicated (C); those in the extracellular domain are labeled C1-C6. Predicted N-linked glycosylation sites are noted with yellow circles. TM, transmembrane domain. This image is interactive; click to view other mutations in Cd36.

There are several alternative CD36 transcripts in which at least six alternative first exons and promoters may be utilized (4;5), in which 5’- and 3’-untranslated exons are alternatively spliced (6;7), or in which middle exons may be skipped (8). Alternative splicing of the first exon is differentially regulated in different tissues (4), but exactly how any of the alternative transcripts are regulated is unknown.

 

The scavenger receptors, named for their involvement in removing foreign or waste molecules from the body, are grouped into classes based on their structure. Class B scavenger receptors, of which the 472 amino acid CD36 is a member, contain two transmembrane domains (Figure 2). The CD36 transmembrane domains (amino acids 7-28 and 439-460) are located at the two termini of the protein, with the ends of the protein (amino acids 1-6 and 461-472) facing inside the cell (9-11). One extracellular loop, 412 amino acids in length, connects the two transmembrane domains, and is predicted to contain ten N-linked glycosylation sites (11;12). Glycosylation at these sites accounts for the discrepancy between the predicted (53 kd) and actual (88 kd) molecular weight of the protein (11;12). The extracellular domain also contains six cysteine residues (C1 to C6) (11). In bovine CD36, these conserved cysteines form disulfide bonds with each other in a 1-3, 2-6, 4-5 arrangement (13). Additionally, two cysteines close to the membrane in each of the cytoplasmic domains may be palmitoylated (14). A putative protein kinase C (PKC) phosphorylation site exists at threonine 92 (in the extracellular domain), and is thought to differentially regulate adhesion to collagen or thrombospondin depending on phosphorylation status (15).

 

The oblivious mutation results in the generation of a stop codon in place of tyrosine 340 that truncates the protein 133 amino acids before the C terminus. The truncation occurs in the extracellular loop. No mutant protein is expressed in homozygous oblivious tissues.

Expression/Localization

Rat Cd36 transcript is detected in most tissues including heart muscle, intestine, spleen, skeletal muscle, adipose tissue and testis, but not in kidney or liver (12). In humans, CD36 is expressed in platelets, monocytes, endothelial cells (including capillary, venular and arteriolar), macrophages (both blood and tissue macrophages), dendritic cells, adipocytes, erythrocytes and some tumor cell lines (11;16-19). Subcellularly, Cd36 is found in caveolae, specialized membrane microdomains that interact with the actin cytoskeleton and concentrate signaling molecules (20).

Background

CD36 (originally called glycoprotein IV) was identified more than 30 years ago as the fourth major glycoprotein of the carbohydrate-rich outer coat of platelets (16). Since then, study has revealed its diverse range of functions and binding partners. These include cell adhesion (via thrombospondin and collagen), fatty acid and lipid transport (by binding long-chain fatty acids and oxidized LDL), clearance of apoptotic cells and antigen presentation. Some of these are discussed below.

 

CD36 was identified as a receptor for thrombospondin-1 (TSP-1) (21;22), an adhesive glycoprotein made and secreted by various cell types and involved in processes including cell adhesion, platelet aggregation, angiogenesis, tumor metastasis and tissue repair (23). Several reports have identified different extracellular regions on CD36 as binding regions for TSP-1 (15;24;25). However, using platelets from patients lacking CD36 (so-called Nak(a)-negative platelets), it was shown that TSP-1 binds to control and Nak(a)-negative platelets similarly (26). It has been postulated that another receptor in close proximity to CD36 is the TSP-1 receptor.

 

CD36 was also found to be a platelet collagen receptor (27). A polyclonal anti-CD36 antibody inhibited platelet adhesion to collagen at early timepoints (0-10 minutes), but not at later times (27). This suggested that CD36 contributes to the initial phase of a biphasic adhesion process. Nak(a)-negative platelets bind to collagen at a slower rate than control platelets in a static setting or in a flowing whole blood system (26;28). However, this result has been disputed by another report in which Nak(a)-negative platelets bound to collagen type I, III or IV with the same rate and magnitude as control platelets (29). It may be that differing experimental conditions (use of collagen from different species, different blood flow rates) contribute to different results, or that Nak(a)-negative platelets can compensate for CD36 deficiency.

 

The human malaria parasite Plasmodium falciparum multiplies within erythrocytes, evading elimination by the spleen by facilitating erythrocyte sequestration in small blood vessels. Infected erythrocytes use the CD36 receptor to bind to endothelial cells of blood vessels, protecting them from circulation and elimination (17;30). Nak(a)-negative platelets do not support adherence of P. falciparum-infected erythrocytes (26). The molecule sequestrin is expressed on malaria-infected cells and has been postulated to mediate binding to endothelial CD36 (31).

 

The fatty acid transporter identified in rat is now known to be CD36, and contributes to long-chain fatty acid (LCFA) transport (12). This has been confirmed by study of the spontaneously hypertensive rat (SHR), for which hypertension, hypertriglyceridemia, reduced HDL phospholipid and defective adipocyte metabolism have been attributed to mutation of CD36 (32). Transgenic overexpression of CD36 in mice reduces blood triglycerides and fatty acids (32), while mice with a targeted deletion of Cd36 have increased levels of cholesterol, fatty acids and triacylglycerol (33). Cd36^-/- adipocytes have a decreased ability to transport LCFA (33). CD36 is also a receptor for oxidatively modified LDL (oxLDL) (34), a finding supported by the impaired ability of Cd36^-/- peritoneal macrophages to bind and take up oxLDL (33). LDL contributes to the development of atherosclerotic lesions, and Cd36 deficiency protects against these lesions (35).

 

Several human diseases are associated with mutations in CD36 (OMIM 173510, #608404). Interestingly, mutations in CD36 have been found to both protect against (36) and increase susceptibility (37) to malaria. Prader-Willi syndrome (PWS), characterized by an insatiable hunger that results in life-threatening obesity, is correlated with reduced CD36 expression (38). The mechanism by which CD36 contributes to PWS is unknown, but may involve impaired lipid and glucose homeostasis. Finally, similar to Cd36^-/- mice, humans with CD36 deficiency also have insulin resistance, hypertriglyceridemia, increased serum LDL cholesterol, and decreased capacity for fatty acid uptake (39-41).

Putative Mechanism

Figure 3. CD36 augments TLR2-mediated ligand recognition. Toll-like receptor 2 (TLR2) signaling pathways. TLR2 associates with TLR6 and TLR1 (not shown) to initiate a MyD88-dependent response that produces proinflammatory cytokines. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information. LTA, lipoteichoic acid; LP2, lipopeptide 2.

Recently, the scavenger receptors, known primarily for their role in binding and internalizing lipoproteins, have received renewed attention for their ability to recognize microbial molecules and thereby contribute to the innate immune response [reviewed in (42)]. Like the TLRs, scavenger receptors bind with high affinity to a diverse range of ligands, and are expressed throughout the body and notably in antigen presenting cells (Figure 3). Several class A scavenger receptors have been shown to bind surface components of Gram-negative and Gram-positive bacteria, and trigger phagocytosis (42). In addition, scavenger receptors, including CD36, have been implicated in clearance of apoptotic cells during development and infection (43). The phagocytosis of apoptotic cells, and consequently cross-presentation, by human immature dendritic cells (iDC) and macrophages in vitro is inhibited by antibodies directed against CD36 (and integrin α_vβ₅ in the case of iDC), indicating that these receptors play a role in the trafficking of exogenous antigen (44). In Drosophila, the CD36 homologue Croquemort is expressed on macrophages and hemocytes, where it is required for phagocytosis of apoptotic cells (45). However, mouse DC do not use CD36 to mediate cross-presentation, since Cd36^-/- DC still cross-present antigen and stimulate antigen-specific CD8⁺ T cell responses in vivo (46). These data suggest that at least in the mouse, CD36 is not required for uptake of apoptotic cells by DC.

 

The oblivious phenotype supports the contribution of scavenger receptors to the innate immune response, and provides the first evidence that CD36 functions with a TLR to detect microbial molecules. In this context, CD36 is not absolutely required, but augments TLR2-mediated ligand recognition. Mouse Cd36 has been shown to bind to S. aureus and its component LTA, and is required for full phagocytic activity toward the bacterium and subsequent inflammatory cytokine production (47). In agreement with previous reports (46), experiments using oblivious mice indicate that mouse Cd36 is not required for uptake and cross-presentation of apoptotic cell antigens to CD8⁺ T cells, although distinct DC subsets may have different receptor requirements that remain untested.

Primers

Primers cannot be located by automatic search.

Genotyping

Oblivious genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

PCR Primer Sequences

Oblvious_PCR_F: 5'-ACAGACCTCAGAGTCCTCCTTGTTG-3'

Oblvious_PCR_R: 5'-GCCATCATTTGGAAGAGAGACCCC-3'

 

Sequencing Primers

Oblivious_Seq_F: 5'-CTGGCTGCTTAAAATGTCACAGAG-3'

Oblivious_Seq_R: 5'-AAGAGAGACCCCTTGGTCTTC-3'

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7)  4°C              ∞

 

The following sequence of 1052 nucleotides (from Genbank genomic region NC_000071.6 for linear genomic sequence of Cd36) is amplified:

92713              acagacct cagagtcctc cttgttgtgt ttgtatttac tgtagaataa
92761 ggaggataag gaatagcaaa ctatgagatg ttcagtgtag ttgtatcatc acttgaagtt
92821 tgaacatgtt ctaatttggt tcaacagtga acatttgaat tctagaaatt agtatgaaga
92881 aataaaaact ggctgcttaa aatgtcacag agttttatgt tattttgcat aataataacc
92941 acatgtaatg ctcttatcag catttctttt tgtttgtttg tttgtttttg tttttgtttt
93001 ttgagacagg gtttctctgt atagccctgg ctatcctgga actcactctg tagaccaggc
93061 tggcctcgaa ctcagaaatc tgcctgcctc tgcctcccta atgctgggat taaaggcatg
93121 caccaccaag cttggcttta tcagcatttc aaaaacaact atatcttaat ctacaaaagc
93181 ttcacacttt agtaaatatt ttaaataatt tatgagtgat aaaataatcc atttccaatt
93241 gtcttttaaa atgtgtcttc aggaaagcct gtgtatattt cgcttccaca tttcctacat
93301 gcaagtccag atgtttcaga acctattgaa ggcttacatc caaatgaaga tgagcatagg
93361 acatacttag atgtggaacc cgtaagtcac tctcttattg atgaatttag ttaatattct
93421 tctaaaataa aaaatatata tacattcttg gatcatatcc ttaatatgag tgaaactatc
93481 aaggagaata aaacttattt cttcctattc tgatggataa atggcatgaa attcagattt
93541 ggtttcaata caaggaactt cataaatttt tttcttttct ttttttttaa attaggtatt
93601 ttcttcattt acatttcaaa tgctatccca aaagtccccc ataccctacc cccccacaca
93661 cacactcccc taactaccca ctctcacttc ttggccctgg cattcccctg tactgaggca
93721 tttaaagttt ggaagaccaa ggggtctctc ttccaaatga tggc

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

---

Oblivious mice can also be phenotyped to assess homozygosity by measuring CD36 expression on platelets or monocytes collected from blood (1). Homozygote animals show a complete lack of CD36 expression, whereas heterozygotes show a reduced expression relative to wildtype expression and isotype background staining. The protocol involves a two-step antibody detection of CD36 on the surface of monocytes or platelets; analysis is performed using flow cytometry.

 

First antibody: mouse anti-mouse CD36 (Chemicon, Mab1258) 1:100 dilution.

 

Secondary antibody; PE-conjugated anti-mouse IgA (e-Bioscience, San Diego)   1:100 dilution (can use any fluorescent label).

 

Optional: specific antibodies can be used to detect platelets/or monocytes.

 

Example:

References

   1.  Hoebe, K., Georgel, P., Rutschmann, S., Du, X., Mudd, S., Crozat, K., Sovath, S., Shamel, L., Hartung, T., Zahringer, U., and Beutler, B. (2005) CD36 is a sensor of diacylglycerides, Nature 433, 523-527.

   2.  Takeuchi, O., Hoshino, K., and Akira, S. (2000) Cutting Edge: TLR2-Deficient and MyD88-Deficient Mice Are Highly Susceptible to Staphylococcus aureus Infection, J. Immunol. 165, 5392-5396.

   3.  Janssen, E., Tabeta, K., Barnes, M. J., Rutschmann, S., McBride, S., Bahjat, K. S., Schoenberger, S. P., Theofilopoulos, A. N., Beutler, B., and Hoebe, K. (2006) Efficient T cell activation via a Toll-Interleukin 1 Receptor-independent pathway, Immunity 24, 787-799.

   4.  Andersen, M., Lenhard, B., Whatling, C., Eriksson, P., and Odeberg, J. (2006) Alternative promoter usage of the membrane glycoprotein CD36, BMC. Mol. Biol. 7, 8.

   5.  Sato, O., Takanashi, N., and Motojima, K. (2007) Third promoter and differential regulation of mouse and human fatty acid translocase/CD36 genes, Mol. Cell Biochem. 299, 37-43.

   6.  Noguchi, K., Naito, M., Tezuka, K., Ishii, S., Seimiya, H., Sugimoto, Y., Amann, E., and Tsuruo, T. (1993) cDNA expression cloning of the 85-kDa protein overexpressed in adriamycin-resistant cells, Biochem. Biophys. Res. Commun. 192, 88-95.

   7.  Taylor, K. T., Tang, Y., Sobieski, D. A., and Lipsky, R. H. (1993) Characterization of two alternatively spliced 5'-untranslated exons of the human CD36 gene in different cell types, Gene 133, 205-212.

   8.  Tang, Y., Taylor, K. T., Sobieski, D. A., Medved, E. S., and Lipsky, R. H. (1994) Identification of a human CD36 isoform produced by exon skipping. Conservation of exon organization and pre-mRNA splicing patterns with a CD36 gene family member, CLA-1, J Biol. Chem. 269, 6011-6015.

   9.  Armesilla, A. L. and Vega, M. A. (1994) Structural organization of the gene for human CD36 glycoprotein, J Biol. Chem. 269, 18985-18991.

 10.  Tandon, N. N., Lipsky, R. H., Burgess, W. H., and Jamieson, G. A. (1989) Isolation and characterization of platelet glycoprotein IV (CD36), J Biol. Chem. 264, 7570-7575.

 11.  Oquendo, P., Hundt, E., Lawler, J., and Seed, B. (1989) CD36 directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes, Cell 58, 95-101.

 12.  Abumrad, N. A., el-Maghrabi, M. R., Amri, E. Z., Lopez, E., and Grimaldi, P. A. (1993) Cloning of a rat adipocyte membrane protein implicated in binding or transport of long-chain fatty acids that is induced during preadipocyte differentiation. Homology with human CD36, J Biol. Chem. 268, 17665-17668.

 13.  Rasmussen, J. T., Berglund, L., Rasmussen, M. S., and Petersen, T. E. (1998) Assignment of disulfide bridges in bovine CD36, Eur. J Biochem. 257, 488-494.

 14.  Tao, N., Wagner, S. J., and Lublin, D. M. (1996) CD36 is palmitoylated on both N- and C-terminal cytoplasmic tails, J Biol. Chem. 271, 22315-22320.

 15.  Asch, A. S., Liu, I., Briccetti, F. M., Barnwell, J. W., Kwakye-Berko, F., Dokun, A., Goldberger, J., and Pernambuco, M. (1993) Analysis of CD36 binding domains: ligand specificity controlled by dephosphorylation of an ectodomain, Science 262, 1436-1440.

 16.  Okumura, T. and Jamieson, G. A. (1976) Platelet glycocalicin. I. Orientation of glycoproteins of the human platelet surface, J Biol. Chem. 251, 5944-5949.

 17.  Barnwell, J. W., Ockenhouse, C. F., and Knowles, D. M. (1985) Monoclonal antibody OKM5 inhibits the in vitro binding of Plasmodium falciparum-infected erythrocytes to monocytes, endothelial, and C32 melanoma cells, J Immunol. 135, 3494-3497.

 18.  Knowles, D. M., Tolidjian, B., Marboe, C., D'Agati, V., Grimes, M., and Chess, L. (1984) Monoclonal anti-human monocyte antibodies OKM1 and OKM5 possess distinctive tissue distributions including differential reactivity with vascular endothelium, J Immunol. 132, 2170-2173.

 19.  van Schravendijk, M. R., Handunnetti, S. M., Barnwell, J. W., and Howard, R. J. (1992) Normal human erythrocytes express CD36, an adhesion molecule of monocytes, platelets, and endothelial cells, Blood 80, 2105-2114.

 20.  Lisanti, M. P., Scherer, P. E., Vidugiriene, J., Tang, Z., Hermanowski-Vosatka, A., Tu, Y. H., Cook, R. F., and Sargiacomo, M. (1994) Characterization of caveolin-rich membrane domains isolated from an endothelial-rich source: implications for human disease, J Cell Biol. 126, 111-126.

 21.  Asch, A. S., Barnwell, J., Silverstein, R. L., and Nachman, R. L. (1987) Isolation of the thrombospondin membrane receptor, J Clin. Invest 79, 1054-1061.

 22.  Silverstein, R. L., Asch, A. S., and Nachman, R. L. (1989) Glycoprotein IV mediates thrombospondin-dependent platelet-monocyte and platelet-U937 cell adhesion, J Clin. Invest 84, 546-552.

 23.  Adams, J. C. (1997) Thrombospondin-1, Int. J Biochem. Cell Biol. 29, 861-865.

 24.  Leung, L. L., Li, W. X., McGregor, J. L., Albrecht, G., and Howard, R. J. (1992) CD36 peptides enhance or inhibit CD36-thrombospondin binding. A two-step process of ligand-receptor interaction, J Biol. Chem. 267, 18244-18250.

 25.  Frieda, S., Pearce, A., Wu, J., and Silverstein, R. L. (1995) Recombinant GST/CD36 fusion proteins define a thrombospondin binding domain. Evidence for a single calcium-dependent binding site on CD36, J Biol. Chem. 270, 2981-2986.

 26.  Tandon, N. N., Ockenhouse, C. F., Greco, N. J., and Jamieson, G. A. (1991) Adhesive functions of platelets lacking glycoprotein IV (CD36), Blood 78, 2809-2813.

 27.  Tandon, N. N., Kralisz, U., and Jamieson, G. A. (1989) Identification of glycoprotein IV (CD36) as a primary receptor for platelet-collagen adhesion, J Biol. Chem. 264, 7576-7583.

 28.  Diaz-Ricart, M., Tandon, N. N., Carretero, M., Ordinas, A., Bastida, E., and Jamieson, G. A. (1993) Platelets lacking functional CD36 (glycoprotein IV) show reduced adhesion to collagen in flowing whole blood, Blood 82, 491-496.

 29.  McKeown, L., Vail, M., Williams, S., Kramer, W., Hansmann, K., and Gralnick, H. (1994) Platelet adhesion to collagen in individuals lacking glycoprotein IV, Blood 83, 2866-2871.

 30.  Ockenhouse, C. F., Tandon, N. N., Magowan, C., Jamieson, G. A., and Chulay, J. D. (1989) Identification of a platelet membrane glycoprotein as a falciparum malaria sequestration receptor, Science 243, 1469-1471.

 31.  Ockenhouse, C. F., Klotz, F. W., Tandon, N. N., and Jamieson, G. A. (1991) Sequestrin, a CD36 recognition protein on Plasmodium falciparum malaria-infected erythrocytes identified by anti-idiotype antibodies, Proc. Natl. Acad. Sci. U. S. A 88, 3175-3179.

 32.  Aitman, T. J., Glazier, A. M., Wallace, C. A., Cooper, L. D., Norsworthy, P. J., Wahid, F. N., al Majali, K. M., Trembling, P. M., Mann, C. J., Shoulders, C. C., Graf, D., St Lezin, E., Kurtz, T. W., Kren, V., Pravenec, M., Ibrahimi, A., Abumrad, N. A., Stanton, L. W., and Scott, J. (1999) Identification of Cd36 (Fat) as an insulin-resistance gene causing defective fatty acid and glucose metabolism in hypertensive rats
9, Nat. Genet. 21, 76-83.

 33.  Febbraio, M., Abumrad, N. A., Hajjar, D. P., Sharma, K., Cheng, W., Pearce, S. F., and Silverstein, R. L. (1999) A null mutation in murine CD36 reveals an important role in fatty acid and lipoprotein metabolism, J. Biol. Chem. 274, 19055-19062.

 34.  Endemann, G., Stanton, L. W., Madden, K. S., Bryant, C. M., White, R. T., and Protter, A. A. (1993) CD36 is a receptor for oxidized low density lipoprotein, J Biol. Chem. 268, 11811-11816.

 35.  Febbraio, M., Podrez, E. A., Smith, J. D., Hajjar, D. P., Hazen, S. L., Hoff, H. F., Sharma, K., and Silverstein, R. L. (2000) Targeted disruption of the class B scavenger receptor CD36 protects against atherosclerotic lesion development in mice, J Clin. Invest 105, 1049-1056.

 36.  Omi, K., Ohashi, J., Patarapotikul, J., Hananantachai, H., Naka, I., Looareesuwan, S., and Tokunaga, K. (2003) CD36 polymorphism is associated with protection from cerebral malaria, Am. J Hum. Genet. 72, 364-374.

 37.  Aitman, T. J., Cooper, L. D., Norsworthy, P. J., Wahid, F. N., Gray, J. K., Curtis, B. R., McKeigue, P. M., Kwiatkowski, D., Greenwood, B. M., Snow, R. W., Hill, A. V., and Scott, J. (2000) Malaria susceptibility and CD36 mutation, Nature 405, 1015-1016.

 38.  Webb, T., Whittington, J., Holland, A. J., Soni, S., Boer, H., Clarke, D., and Horsthemke, B. (2006) CD36 expression and its relationship with obesity in blood cells from people with and without Prader-Willi syndrome, Clin. Genet. 69, 26-32.

 39.  Miyaoka, K., Kuwasako, T., Hirano, K., Nozaki, S., Yamashita, S., and Matsuzawa, Y. (2001) CD36 deficiency associated with insulin resistance, Lancet 357, 686-687.

 40.  Yanai, H., Watanabe, I., Ishii, K., Morimoto, M., Fujiwara, H., Yoshida, S., Hui, S. P., Matsuno, K., and Chiba, H. (2007) Attenuated aerobic exercise capacity in CD36 deficiency, J Med. Genet. 44, 445-447.

 41.  Yanai, H., Chiba, H., Morimoto, M., Abe, K., Fujiwara, H., Fuda, H., Hui, S. P., Takahashi, Y., Akita, H., Jamieson, G. A., Kobayashi, K., and Matsuno, K. (2000) Human CD36 deficiency is associated with elevation in low-density lipoprotein-cholesterol, Am. J Med. Genet. 93, 299-304.

 42.  Gough, P. J. and Gordon, S. (2000) The role of scavenger receptors in the innate immune system, Microbes. Infect. 2, 305-311.

 43.  Savill, J., Hogg, N., and Haslett, C. (1991) Macrophage vitronectin receptor, CD36, and thrombospondin cooperate in recognition of neutrophils undergoing programmed cell death, CHEST 99, 6S-7S.

 44.  Albert, M. L., Pearce, S. F., Francisco, L. M., Sauter, B., Roy, P., Silverstein, R. L., and Bhardwaj, N. (1998) Immature dendritic cells phagocytose apoptotic cells via alphavbeta5 and CD36, and cross-present antigens to cytotoxic T lymphocytes, J Exp. Med. 188, 1359-1368.

 45.  Franc, N. C., Dimarcq, J. L., Lagueux, M., Hoffmann, J., and Ezekowitz, R. A. (1996) Croquemort, a novel Drosophila hemocyte/macrophage receptor that recognizes apoptotic cells, Immunity 4, 431-443.

 46.  Schulz, O., Pennington, D. J., Hodivala-Dilke, K., Febbraio, M., and Reis e Sousa (2002) CD36 or alphavbeta3 and alphavbeta5 integrins are not essential for MHC class I cross-presentation of cell-associated antigen by CD8 alpha+ murine dendritic cells, J Immunol. 168, 6057-6065.

 47.  Stuart, L. M., Deng, J., Silver, J. M., Takahashi, K., Tseng, A. A., Hennessy, E. J., Ezekowitz, R. A., and Moore, K. J. (2005) Response to Staphylococcus aureus requires CD36-mediated phagocytosis triggered by the COOH-terminal cytoplasmic domain, J Cell Biol. 170, 477-485.