Phenotypic Mutation 'Punk'

• Allele: Punk
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 72,152,902 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Slc13a5
• Gene Name: solute carrier family 13 (sodium-dependent citrate transporter), member 5
• Synonym(s): Nact, Indy, NaC2/NaCT, mINDY
• Chromosomal Location: 72,132,815-72,158,048 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014] ; PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000021161] [ENSMUSP00000119417] [ENSMUSP00000119822] [ENSMUSP00000146922] [ENSMUSP00000146762]
• AlphaFold: Q67BT3
• SMART Domains: Protein: ENSMUSP00000021161; Gene: ENSMUSG00000020805; AA Change: S60P

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	8	558	1.3e-121	PFAM
Pfam:CitMHS	13	172	1.6e-14	PFAM
Pfam:CitMHS	202	498	6.4e-24	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
  (Using ENSMUST00000021161)
• SMART Domains: Protein: ENSMUSP00000119417; Gene: ENSMUSG00000020805; AA Change: S60P

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	7	115	1.3e-24	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000137701)
• SMART Domains: Protein: ENSMUSP00000119822; Gene: ENSMUSG00000020805

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	6	102	7.9e-20	PFAM

• Predicted Effect: probably benign
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000208056)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.6301
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:44 PM by Diantha La Vine
• Record Created: 2015-08-04 3:24 PM by Bruce Beutler
• Record Posted: 2016-09-19
• Science Writers: Anne Murray
• Illustrators: Peter Jurek, Katherine Timer
• Authors: Zhe Chen and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001004148; MGI:1919003

Alleles Listed at MGI

All Mutations and Alleles(8) : Chemically induced (other)(1) Targeted(7)

Phenotypic Description

Figure 1. Punk mice exhibited reduced body weight compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Punk phenotype was identified among G3 mice of the pedigree R2408, some of which exhibited reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 36 mutations (X-axis) identified in the G1 male of pedigree R2408. Scaled body weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 36 mutations. The body weight phenotype was linked to a mutation in Slc13a5: a T to C transition at base pair 72,262,076 (v38) on chromosome 11, or base pair 4,957 in the GenBank genomic region NC_000077 encoding Slc13a5. Linkage was found with an additive model of inheritance (P = 7.115 x 10^-6), wherein 10 variant homozygotes and 23 heterozygotes departed phenotypically from nine homozygous reference mice (Figure 2).

The mutation corresponds to residue 217 in the mRNA sequence NM_001004148 within exon 2 of 12 total exons.

202 CCAGTGGCTGTTACCTCCCTCCTGCCTGTCTTA 55  -P--V--A--V--T--S--L--L--P--V--L-

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to proline (P) substitution at position 60 (S60P) in the SLC13A5 (NaCT) protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.996).

Protein Prediction

Figure 3. Domain organization and topology of NaCT. NaCT has 11 putative transmembrane domains (SMART). The location of the Punk mutation results in a serine to proline substitution at position 60. Other mutations found in NaCT are noted. Click on each mutation to view more information. The topology of mouse NaCT was modeled after that of the Vibrio cholerae homolog of mouse NaCT (termed VcINDY); see Figure 4, PDB:4F35, and (2) for more information.

Slc13a5 encodes NaCT (Na⁺/citrate transporter; alternatively, mINDY (mouse I’m not dead yet) or NaC2), a member of the solute carrier (SLC) family of anion transporters. The SLC superfamily encodes intrinsic membrane transporters comprising 55 gene families and 362 putatively functional protein-coding genes. The gene products include passive transporters, symporters and antiporters that transport a wide variety of substrates including amino acids and oligopeptides, glucose and other sugars, inorganic cations and anions, bile salts, carboxylate and other organic anions, acetyl coenzyme A, essential metals, biogenic amines, neurotransmitters, vitamins, fatty acids and lipids, nucleosides, ammonium, choline, thyroid hormone and urea (1).

The members of the SLC13 family are divalent anion sodium symporters, which mediate sodium-coupled anion cotransport at the plasma membrane of epithelial cells of the kidney, small intestine, placenta, and liver. The SLC13 proteins can be grouped into two subfamilies based on different anion specificities: Na⁺-carboxylate (NaC; alternatively, Na⁺-dicarboxylate [NaDC]) cotransporters and Na⁺-sulfate (NaS) cotransporters. The NaC/NaDC cotransporters include SLC13A2 (NaC1; NaDC-1/SDCT1), SCL13A3 (NaC3; NaDC-3/SDCT2), and NaCT, while the NaS cotransporters are SLC13A1 (NaS1; NaSi-1) and SLC13A4 (NaS2; SUT-1). The NaC proteins mediate the transportation of tricaboxylic acid (TCA) cycle (alternatively, Krebs cycle or citric acid cycle) intermediates succinate citrate, succinate, and α-ketoglutarate, while the NaS proteins mediate the transportation of sulfate, selenite, and thiosulfate.

Mouse NaCT has 11 putative transmembrane domains (Figure 3; SMART). Each of the SLC13 proteins has a sodium:sulfate symporter family signature (TSFAFLLPVANPPNAIV); the function of this motif is unknown. The SLC13 proteins have consensus sites for protein kinase C, cAMP/cGMP, casein kinase II, tyrosine kinase phosphorylation as well as N-myristoylation sites; the functional significance of phosphorylation and myristoylation of NaCT are unknown. There are two putative N-linked glycosylation sites on NaCT at Asn382 and Asn566.

Figure 4. Crystal structure of the bacterial homolog of NaCT from Vibrio cholerae, VcINDY. Figure is modeled by UCSF Chimera using PDB:4F35.

The structure of the Vibrio cholerae homolog of mouse NaCT (termed VcINDY) has been solved by X-ray crystallography [PDB:4F35; (2); Figure 4]; one citrate and one sodium ion were bound to the peptide. VcINDY has 11 transmembrane domains (TM) and two opposing hairpin structures designated HP_in and HP_out. TM4, 5, 9, and 10 of VcINDY are each broken into two segments within the membrane; each pair are named “a” and “b”. The loops that connect TM5a and TM5b as well as the loop that connects TM10a and TM10b are eight amino acids long. VcINDY crystallized as a homodimer with contacts between one protomer at TM3, 4a, and 9b interacting with the other protomer at TM4b, 8, and 9a (2). The N-terminus of VcINDY is cytosolic, while the C-terminus is extracellular (3). The HP_in structure inserts into the membrane from the cytosolic side and connects to TM4; the HP_out structure inserts into the protein from the periplasm connecting to TM9. The substrate and cation binding sites of VcINDY are comprised of amino acids from the tips of the two opposing hairpin loops and portions of TM5 and 10 (2). The N- and C-terminal halves of VcINDY (TM2-6 and 7-11, respectively) have 26.2% identity and consist of a two-fold repeat (2).

The Slc13a5 mutation in the Punk mice results in a serine (S) to proline (P) substitution at position 60 (S60P) in NaCT. Ser60 is in putative TM2.

Expression/Localization

The members of the SLC13 family are ubiquitously expressed, with predominant expression in the kidney, small intestine, liver, placenta, testis and brain (4-7). In the mouse, NaCT is also expressed in the adipose tissue, skeletal muscle, and pancreas (6). In the liver, NaCT is expressed in the sinusoidal membrane of hepatocytes (8). In the brain, Slc13a5 is expressed in the cerebral cortex, cerebellum, hippocampus, and olfactory bulb (5). NaCT is expressed in mouse cerebrocortical neurons, but not in astrocytes (7). NaCT (and the other members of the SLC13 family) are located in the plasma membrane of epithelial cells. Slc13a5 mRNA expression levels are reduced during starvation in rat hepatocytes and mice liver (6).

Background

Figure 5. NaCT mediates the transport of TCA cycle intermediates. NaCT facilitates citrate (and other TCA intermediates) uptake from the circulation. Citrate is a carbon source for the TCA cycle, fatty acid synthesis, cholesterol synthesis, glycolysis, neurotransmitter production, and gluconeogenesis.

Citrate is the major carbon source for several processes including energy production via the TCA cycle, fatty acid synthesis, cholesterol synthesis, glycolysis, neurotransmitter production, and gluconeogenesis (4;5;9). During fatty acid biosynthesis, citrate generated in the mitochondria by the TCA cycle enters the cytoplasm whereby it is converted to acetyl-CoA and oxaloacetate by ATP-citrate lyase. Conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase is the first committed step in fatty acid synthesis.

The TCA cycle is a set of chemical reactions within the mitochondria that mediate aerobic respiration in cells. The steps of the TCA are as follows: (i) pyruvate is transported into the mitochondria whereby it loses carbon dioxide to form acetyl-CoA. (ii) Citrate synthase mediates the combining of acetyl-CoA with oxaloacetate, which produces citrate. (iii) The citrate is converted into isocitrate by aconitase. (iv) Isocitrate is oxidized into alpha-ketogluterate by isocitrate dehydrogenase; byproducts of this reaction are NADH and CO₂. (v) Alpha-ketogluterate is oxidized into succinyl-CoA by alpha-ketogluterate dehydrogenase; NADH and CO₂ are products of this reaction. (vi) Succinyl-CoA is converted into succinate by succinyl-CoA synthetase, which yields one ATP/GTP. (vii) The enzyme succinate dehydrogenase converts succinate into fumerate; this reaction produces FADH₂. (viii) Water is added to fumerate via fumerase to form malate. (ix) Malate is oxidized by malate dehydrogenase to form oxaloacetate; the byproduct of the reaction is NADH. In total, two carbons enter the cycle, two molecules of CO₂ are released, three molecules of NADH and one of FADH₂ are generated, and one molecule of ATP or GTP is produced.

NaCT mediates the transport of TCA cycle intermediates citrate, succinate, malate, and formate from the circulation (Figure 5). NaCT exhibits highest affinity for citrate (8;10), and has lower affinity for succinate, malate, and formate (4;5;8). NaCT exhibits the pH-sensitive cotransport of citrate, but pH-independent cotransport of succinate, and Li⁺-sensitive cotransport [reviewed in (11)]. Maximum NaCT activity is at pH 7.0-7.5; NaCT function is inhibited in acidic and alkaline pH (8). Species differences in the function of NaCT have been observed. Substrate sensitivity and cation dependence are reported to be different between mouse and human NaCT (12). For example, mouse NaCT has a higher affinity to citric acid intermediates than that of human NaCT (12). Also, mouse NaCT was fully active at physiologic levels of citrate, but human NaCT was not (12). Furthermore, human NaCT is less dependent on extracellular sodium than mouse NaCT (12). Human, chimpanzee, and monkey NaCT are stimulated by Li⁺ (9), while rat, mouse, dog, and zebrafish NaCT are inhibited by Li⁺ (13).

In Drosophila and C. elegans, the reduced expression of the NaCT homolog Indy (cdNAC-2 in C. elegans) promotes a prolonged life span with a concomitant reduction in whole body fat stores (10;14). Indy-deficient flies also exhibited reduced expression of insulin-like proteins compared to levels in calorically-restricted wild-type files (14).

Slc13a5-deficient (Slc13a5^-/-) mice exhibit metabolic defects and changes in energy balance-regulating pathways. The Slc13a5^-/- mice were smaller in size, have lower plasma glucose levels than wild-type mice, and are resistant to the effects (i.e., weight gain and insulin resistance) of high fat feeding (6). Citrate and malate levels in the plasma of Slc13a5^-/- mice are slightly increased compared to that in wild-type mice; the levels of succinate or fumarate were not significantly changed upon loss of Slc13a5. The Slc13a5^-/- mice exhibited reduced uptake of citrate from the circulation into the liver, but not the kidney or adipose tissue (6). The Slc13a5^-/- mice also exhibited increased oxygen consumption, carbon dioxide generation, and resting energy expenditure. After a glucose tolerance test, plasma glucose and insulin concentrations were reduced in the Slc13a5^-/- mice. The Slc13a5^-/- mice had improved insulin sensitivity after hyperinsulinemic euglycemic clamp with reduced basal hepatic glucose production. The resistance to diet-induced obesity and insulin resistance is mediated by the function of NaCT on mitochondrial metabolism as the hepatocellular ATP/ADP ratio was reduced and induction of PGC-1α, inhibition of ACC-2, and reduction of SREBP-1c levels were observed (6).

In humans, mutations in SLC13A5 are linked to early-onset epileptic encephalopathy-25 (EOEE25; OMIM: #615905) (15;16). EOEE is a genetically heterogenous group of disorders. EOEE25 is an autosomal recessive condition marked by frequent tonic seizures or spasms starting in infancy. EOEE25 patients exhibit abnormal interictal (between seizures) electro-encephalogram, psychomotor delay, and/or cognitive deterioration. Approximately 75% of EOEE patients progress to West syndrome, which is a condition characterized by tonic spasms with clustering, arrest of psychomotor development, and hypsarrhythmia. The disease-causing SLC13A5 mutations in patients with EOEE25 are proposed to affect the ability of NaCT to transport citrate across the plasma membrane to the cytosol by preventing its ability to bind sodium (15).

Putative Mechanism

Similar to the Slc13a5^-/- mice, the Punk mice are smaller in size compared to their wild-type littermates, indicating that NaCT^Punk has lost citrate uptake function.

Primers

PCR Primer
Punk_pcr_F: TCCTTGAGGGATCCACTTCTGG
Punk_pcr_R: ACAACCAGGCTCTTCTTGG

Sequencing Primer
Punk_seq_F: GGATTTCTGTAGCTATCCCTAGGC
Punk_seq_R: TGTCCTGAGCCTTGGAAAGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 404 nucleotides is amplified (chromosome 11, - strand):

1   acaaccaggc tcttcttggc tgtcctgagc cttggaaagc caccctgccc aggagcagga
61  catagccttc ctcatcacag aggcagctgc cctgctatga ggttggtttg cagtgaagcc
121 tatggaacct cagaactgtt tcttcagttt gccaggtgtg cctatgttat agtcattatg
181 gctgtctact ggtgcacaga tgtcatccca gtggctgtta cctccctcct gcctgtctta
241 ctcttcccac ttttgaaggt tctggactcc aagcaggtga gtaagctgag cagggggctg
301 gtgacttccg ggtcctccca tgtacttcct tactcctctg agtccctctg agctgccgag
361 gcctagggat agctacagaa atccagaagt ggatccctca agga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. He, L., Vasiliou, K., and Nebert, D. W. (2009) Analysis and Update of the Human Solute Carrier (SLC) Gene Superfamily. Hum Genomics. 3, 195-206.

  2. Mancusso, R., Gregorio, G. G., Liu, Q., and Wang, D. N. (2012) Structure and Mechanism of a Bacterial Sodium-Dependent Dicarboxylate Transporter. Nature. 491, 622-626.

  3. Zhang, F. F., and Pajor, A. M. (2001) Topology of the Na(+)/dicarboxylate Cotransporter: The N-Terminus and Hydrophilic Loop 4 are Located Intracellularly. Biochim Biophys Acta. 1511, 80-89.

  4. Inoue, K., Zhuang, L., and Ganapathy, V. (2002) Human Na+ -Coupled Citrate Transporter: Primary Structure, Genomic Organization, and Transport Function. Biochem Biophys Res Commun. 299, 465-471.

  5. Inoue, K., Zhuang, L., Maddox, D. M., Smith, S. B., and Ganapathy, V. (2002) Structure, Function, and Expression Pattern of a Novel Sodium-Coupled Citrate Transporter (NaCT) Cloned from Mammalian Brain. J Biol Chem. 277, 39469-39476.

  6. Birkenfeld, A. L., Lee, H. Y., Guebre-Egziabher, F., Alves, T. C., Jurczak, M. J., Jornayvaz, F. R., Zhang, D., Hsiao, J. J., Martin-Montalvo, A., Fischer-Rosinsky, A., Spranger, J., Pfeiffer, A. F., Jordan, J., Fromm, M. F., Konig, J., Lieske, S., Carmean, C. M., Frederick, D. W., Weismann, D., Knauf, F., Irusta, P. M., De Cabo, R., Helfand, S. L., Samuel, V. T., and Shulman, G. I. (2011) Deletion of the Mammalian INDY Homolog Mimics Aspects of Dietary Restriction and Protects Against Adiposity and Insulin Resistance in Mice. Cell Metab. 14, 184-195.

  7. Wada, M., Shimada, A., and Fujita, T. (2006) Functional Characterization of Na+ -Coupled Citrate Transporter NaC2/NaCT Expressed in Primary Cultures of Neurons from Mouse Cerebral Cortex. Brain Res. 1081, 92-100.

  8. Inoue, K., Fei, Y. J., Zhuang, L., Gopal, E., Miyauchi, S., and Ganapathy, V. (2004) Functional Features and Genomic Organization of Mouse NaCT, a Sodium-Coupled Transporter for Tricarboxylic Acid Cycle Intermediates. Biochem J. 378, 949-957.

  9. Inoue, K., Zhuang, L., Maddox, D. M., Smith, S. B., and Ganapathy, V. (2003) Human Sodium-Coupled Citrate Transporter, the Orthologue of Drosophila Indy, as a Novel Target for Lithium Action. Biochem J. 374, 21-26.

  10. Knauf, F., Mohebbi, N., Teichert, C., Herold, D., Rogina, B., Helfand, S., Gollasch, M., Luft, F. C., and Aronson, P. S. (2006) The Life-Extending Gene Indy Encodes an Exchanger for Krebs-Cycle Intermediates. Biochem J. 397, 25-29.

  11. Bergeron, M. J., Clemencon, B., Hediger, M. A., and Markovich, D. (2013) SLC13 Family of Na(+)-Coupled Di- and Tri-carboxylate/sulfate Transporters. Mol Aspects Med. 34, 299-312.

  12. Zwart, R., Peeva, P. M., Rong, J. X., and Sher, E. (2015) Electrophysiological Characterization of Human and Mouse Sodium-Dependent Citrate Transporters (NaCT/SLC13A5) Reveal Species Differences with Respect to Substrate Sensitivity and Cation Dependence. J Pharmacol Exp Ther. 355, 247-254.

  13. Gopal, E., Babu, E., Ramachandran, S., Bhutia, Y. D., Prasad, P. D., and Ganapathy, V. (2015) Species-Specific Influence of Lithium on the Activity of SLC13A5 (NaCT): Lithium-Induced Activation is Specific for the Transporter in Primates. J Pharmacol Exp Ther. 353, 17-26.

  14. Wang, P. Y., Neretti, N., Whitaker, R., Hosier, S., Chang, C., Lu, D., Rogina, B., and Helfand, S. L. (2009) Long-Lived Indy and Calorie Restriction Interact to Extend Life Span. Proc Natl Acad Sci U S A. 106, 9262-9267.

  15. Thevenon, J., Milh, M., Feillet, F., St-Onge, J., Duffourd, Y., Juge, C., Roubertie, A., Heron, D., Mignot, C., Raffo, E., Isidor, B., Wahlen, S., Sanlaville, D., Villeneuve, N., Darmency-Stamboul, V., Toutain, A., Lefebvre, M., Chouchane, M., Huet, F., Lafon, A., de Saint Martin, A., Lesca, G., El Chehadeh, S., Thauvin-Robinet, C., Masurel-Paulet, A., Odent, S., Villard, L., Philippe, C., Faivre, L., and Riviere, J. B. (2014) Mutations in SLC13A5 Cause Autosomal-Recessive Epileptic Encephalopathy with Seizure Onset in the First Days of Life. Am J Hum Genet. 95, 113-120.

  16. Hardies, K., de Kovel, C. G., Weckhuysen, S., Asselbergh, B., Geuens, T., Deconinck, T., Azmi, A., May, P., Brilstra, E., Becker, F., Barisic, N., Craiu, D., Braun, K. P., Lal, D., Thiele, H., Schubert, J., Weber, Y., van 't Slot, R., Nurnberg, P., Balling, R., Timmerman, V., Lerche, H., Maudsley, S., Helbig, I., Suls, A., Koeleman, B. P., De Jonghe, P., and autosomal recessive working group of the EuroEPINOMICS RES Consortium. (2015) Recessive Mutations in SLC13A5 Result in a Loss of Citrate Transport and Cause Neonatal Epilepsy, Developmental Delay and Teeth Hypoplasia. Brain. 138, 3238-3250.