Phenotypic Mutation 'runtish'

• Allele: runtish
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 3,481,326 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Smtn
• Gene Name: smoothelin
• Chromosomal Location: 3,467,522-3,489,337 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011] ; PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Alanine changed to Aspartic acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020718] [ENSMUSP00000020721] [ENSMUSP00000074621] [ENSMUSP00000105638] [ENSMUSP00000133155] [ENSMUSP00000118750] [ENSMUSP00000117307]
• AlphaFold: Q921U8
• SMART Domains: Protein: ENSMUSP00000020718; Gene: ENSMUSG00000020439

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
low complexity region	26	38	N/A	INTRINSIC
coiled coil region	41	74	N/A	INTRINSIC
low complexity region	75	100	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
Pfam:Smoothelin	154	208	1e-23	PFAM
low complexity region	212	236	N/A	INTRINSIC
CH	322	421	1.04e-22	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000020721; Gene: ENSMUSG00000020439; AA Change: A223D

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	1.7e-15	PFAM
Pfam:Smoothelin	68	122	6.8e-19	PFAM
low complexity region	159	180	N/A	INTRINSIC
low complexity region	192	205	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	366	391	N/A	INTRINSIC
Pfam:Smoothelin	563	617	2.7e-23	PFAM
low complexity region	697	721	N/A	INTRINSIC
CH	807	906	1.04e-22	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
  (Using ENSMUST00000020721)
• SMART Domains: Protein: ENSMUSP00000074621; Gene: ENSMUSG00000020439; AA Change: A223D

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	1.7e-15	PFAM
Pfam:Smoothelin	68	122	6.8e-19	PFAM
low complexity region	159	180	N/A	INTRINSIC
low complexity region	192	205	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	366	391	N/A	INTRINSIC
Pfam:Smoothelin	563	617	2.8e-23	PFAM
low complexity region	697	721	N/A	INTRINSIC
CH	807	907	9.51e-26	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
  (Using ENSMUST00000075118)
• SMART Domains: Protein: ENSMUSP00000105638; Gene: ENSMUSG00000020439; AA Change: A223D

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	2.5e-14	PFAM
Pfam:Smoothelin	72	122	8.5e-19	PFAM
low complexity region	159	180	N/A	INTRINSIC
low complexity region	192	205	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	366	391	N/A	INTRINSIC
Pfam:Smoothelin	568	617	6e-25	PFAM
low complexity region	697	721	N/A	INTRINSIC
CH	807	930	1.62e-19	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
  (Using ENSMUST00000110011)
• SMART Domains: Protein: ENSMUSP00000133155; Gene: ENSMUSG00000020439; AA Change: A223D

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	1.7e-15	PFAM
Pfam:Smoothelin	68	122	6.8e-19	PFAM
low complexity region	159	180	N/A	INTRINSIC
low complexity region	192	205	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	366	391	N/A	INTRINSIC
Pfam:Smoothelin	563	617	2.7e-23	PFAM
low complexity region	697	721	N/A	INTRINSIC
CH	807	906	1.04e-22	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
  (Using ENSMUST00000170588)
• SMART Domains: Protein: ENSMUSP00000118750; Gene: ENSMUSG00000020439

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	3.4e-13	PFAM
Pfam:Smoothelin	68	122	1e-16	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000117307; Gene: ENSMUSG00000020439

Domain	Start	End	E-Value	Type
Pfam:Smoothelin	1	41	2.3e-16	PFAM
Pfam:Smoothelin	68	122	6.7e-20	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.0907
• Is this an essential gene?: Possibly nonessential (E-score: 0.484)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-08-04 3:33 PM by Bruce Beutler
• Record Posted: 2016-11-08
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Bruce Beutler, Zhe Chen

Accession Number

NCBI RefSeq: NM_001159284 (variant 1; isoform b), NM_013870 (variant 2; isoform b), NM_001284427 (variant 3; isoform a), NM_001284428 (variant 4; isoform b), NM_001284429 (variant 5; isoform c); MGI:1354727

Alleles Listed at MGI

All Mutations and Alleles(8) : Gene trapped(4) Targeted(4)

Phenotypic Description

Figure 1. Runtish mice exhibit reduced body weights. Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The runtish phenotype was identified among G3 mice of the pedigree R1899, some of which showed reduced body weights compared to wild-type controls (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 101 mutations (X-axis) identified in the G1 male of pedigree R1899. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 101 mutations. The body weight phenotype was linked to a mutation in Smtn: a C to A transversion at base pair 3,531,326 (v38) on chromosome 11, or base pair 8,329 in the GenBank genomic region NC_000077 encoding Smtn. Linkage was found with a recessive model of inheritance (P = 8.654 x 10^-6), wherein 11 variant homozygotes departed phenotypically from 27 heterozygous and 21 homozygous reference mice (Figure 2). A substantial semidominant effect was also observed (P = 1.027 x 10^-5).

The mutation corresponds to residue 963 in the mRNA sequence NM_001159284 within exon 8 of 22 total exons, residue 912 in the mRNA sequence NM_013870 within exon 7 of 21 total exons, residue 912 in the mRNA sequence NM_001284427 within exon 7 of 20 total exons, residue 1,020 in the mRNA sequence NM_001284428 within exon 7 of 21 total exons, and residue 965 in the mRNA sequence NM_001284429 within exon 7 of 21 total exons.

8313 CTGGAGCCTGCTGGAGCCCAGTGTCCTGCTGTG 218  -L--E--P--A--G--A--Q--C--P--A--V-

Genomic numbering corresponds to NC_000077. The mutated nucleotide is indicated in red.  The mutation results in an alanine (A) to aspartic acid (D) substitution at position 223 (A223D) in all variants of the smoothelin protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.532) (1).

Protein Prediction

Figure 3. Domain organization of smoothelin. The runtish mutation results in an alanine (A) to aspartic acid (D) substitution at position 223 (A223D) in all variants of the smoothelin protein. Abbreviations: CC, coiled-coil; CHD, calponin homology domain; TnT box, troponin T box.

Smtn encodes smoothelin, an actin-binding protein in contractile smooth muscle (Figure 3) (2-4). In humans, there are two smoothelin isoforms, smoothelin-A and smoothelin-B, resulting from alternative transcription start sites. Smoothelin-A is 59 kDa and corresponds to the C-terminus of the 110 kDa smoothelin-B; smoothelin-B has 542 additional amino acids at the N-terminus (5). Two additional variants are the product of alternative splicing and differ within the C-terminal spectrin family similarity (SFS) domains (6).

Smoothelin has a calponin homology domain (CHD; amino acids 805-908 in smoothelin-B) with high homology (~40%) to actin-binding domains in dystrophin, utrophin, beta-spectrin, and alpha-actinin (2;5). Similar to these proteins, the CHD mediates the interaction between smoothelin and actin. There are two additional regions that mediate actin filament association: amino acids 87-134 and amino acids 535-682 (designated as a troponin T (TnT) box) (7). In TnT, the highly conserved TnT box mediates the activation of actomyosin ATPase during heart and skeletal muscle contraction.

Smoothelin has two coiled-coils at amino acids 24-89 and 601-628. In addition, smoothelin has a proline-rich region (amino acids 194-272), two serine-rich regions (amino acids 367-391 and 697-740), and a threonine-rich region (amino acids 645-709). Smoothelin-B has four putative N-glycosylation sites (5).

The runtish mutation results in an alanine (A) to aspartic acid (D) substitution at position 223 (A223D). Amino acid 223 is within the proline-rich region.

Expression/Localization

Smoothelin proteins are expressed in the cytoskeleton of contractile smooth muscle cells (2). Smoothelin is not expressed in primary or long-term smooth muscle cell cultures (2), indicating that it is specific for the contractile phenotype of smooth muscle cells (see the Background section for more details).

Smoothelin-A is expressed in visceral smooth muscle of the intestine, stomach, digestive tract, bladder, and prostate (but not the brain), while smoothelin-B is expressed in vascular smooth muscle (3). Smoothelin-B is expressed at high levels in smooth muscle cells of arteries, but at lower levels in smooth muscle cells of veins (8). Furthermore, the percentage of smoothelin-expressing smooth muscle cells is lower than that in muscular arteries (9). During pregnancy in the mouse, smoothelin concentration decreases in the uterine artery during the first half of pregnancy, but rises after vessel expansion slows (10). Furthermore, smoothelin expression is reduced in the media below atherosclerotic lesions in humans and animal models (11;12). In restenosis and atherosclerotic plaques, smoothelin expression is reduced along with smooth muscle-myosin heavy chain and partly smooth muscle α-actin, indicating a direct relation with contractility.

Smoothelin associates to actin stress fibers in rat embryonic fibroblasts (REF52 cells) (13).

Background

Figure 4. Smoothelin is a marker of the contractile phenotype of smooth muscle. Smooth muscle cells maintain homeostasis through alterations in their contraction-relaxation cycle. The interaction between actin and myosin are the basis of contraction.

Smooth muscle cells are found in organs that function in breathing, reproduction, and transport of nutrients and oxygen. In contrast to striated muscle cell types (cardiac and skeletal muscle), smooth muscle cells are able to alternate between a contraction and a synthetic/proliferative phenotype, termed modulation (Figure 4) (14). Smooth muscle cells maintain homeostasis through alterations in their contraction-relaxation cycle. The interaction between actin and myosin are the basis of contraction. Defects in smooth muscle cell differentiation and dedifferentiation can lead to proliferative vascular diseases such as atherosclerosis.

Smoothelin is a marker of the smooth muscle cell contractile phenotype along with smooth muscle myosin heavy chain and SM22. Smoothelin is the sole marker that differentiates between smooth muscle cells and myofibroblasts (9;15). Smoothelin is a biomarker that allows for the delineation of the muscularis propria from the desmoplastic stromal reaction, which can assist in the staging of colonic adenocarcinoma (16). Proper staging of colonic adenocarcinoma is essential for subsequent patient care and may also determine patient survival. Loss of smoothelin expression in the longitudinal layer of the muscularis propia of the colon is proposed to promote the pathogenesis of colonic inertia, a motility disorder (17).

Genotyping of five single-nucleotide polymorphisms (rs2074738, rs5997872, rs56095120, rs9621187 and rs10304) determined that a G-C-A-C haplotype constructed with rs2074738-rs5997872-rs56095120-rs9621187 was a protective marker of essential hypertension (i.e., high blood pressure without a known secondary cause) in the Japanese population (18). Furthermore, genotyping of four single-nucleotide polymorphisms in SMTN (rs5997872, rs56095120, rs9621187 and rs10304) determined that a C-T-T-A haplotype is at a higher frequency in male Japanese cerebral infarction patients indicating that that haplotype is a genetic marker of cerebral infarction (19). In addition, genotyping of female Japanese myocardial infarction patients determined that the frequency of the C-T-T-G haplotype (established by rs5997872, rs56095120, rs9621187, and rs10304) was higher than that in a control group, indicating that that haplotype may be a marker of myocardial infarction (20).

Smtn (smoothelin-A/-B)-deficient (Smtn-A/B^-/-) mice were born at the expected Mendelian ratio (21). While the Smtn-A/B^-/- mice have normal body size and weights at birth, postnatal growth is retarded; the surviving mice (approximately half of the Smtn-A/B^-/- mice died before 3 weeks of age) only reach approximately 80% of normal body weights. Visceral and subcutaneous fat was not present in the Smtn-A/B^-/- mice (21). Adult Smtn-A/B^-/- mice were infertile. The Smtn-A/B^-/- mice have fragile and less flexible intestines, defective intestinal contraction, and reduced intestinal transit. As a result, the mice often had bowel obstructions, diverticulosis, and premature death resulting from starvation and/or bowel perforation (21). Heterozygous (Smtn-A/B^+/-) mice were overtly normal.

Smtn (smoothelin-B)-deficient (Smtn-B^-/-) mice developed hypertension (22). Although cardiac function was not changed, the proximal aorta was distended during the cardiac cycle (22). The saphenous and femoral arteries exhibit reduced contractile capacity in the Smtn-B^-/- mice compared to that in wild-type mice. The arteries from the Smtn-B^-/- mice had normal architecture. Smtn-B^-/- were viable and fertile (21;22).

Putative Mechanism

Smtn-A/B^-/- mice exhibit postnatal growth retardation and only reached approximately 80% of normal body weights (21). The body weight phenotype of the runtish mice indicates loss of function of smoothelin. However, the runtish mice survived past weaning age, indicating that some smoothelin function was retained.

Primers

PCR Primer
runtish_pcr_F: AAGGAACTCACCTGTCTGGC
runtish_pcr_R: AGAAACCTTGGTTGCGTCCTG

Sequencing Primer
runtish_seq_F: GAACTCACCTGTCTGGCATCCC
runtish_seq_R: TCTTCTGCAGGTGCCAGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 11, - strand):

1   agaaaccttg gttgcgtcct gtgtgtcttc tgcaggtgcc agagccagag cagcaggaac
61  agcagacaga agtactcgag ccaaccccaa ccccagagga caccagccag gatgtgacca
121 cagtgacact cctgctgagg gccccgcctg ggggcaggcc cagctcacct gcttcccccc
181 acaattcacc caccagtgcc tctccagagc ctctgctgga gcctgctgga gcccagtgtc
241 ctgctgtgga ggctccagtc agctctgagc cacttccaca cccttcagaa gctcctagcc
301 ctgagccccc catgtcgccg gtaccgtcca gctctcgggg gcgggtcatc agcaaggtga
361 gttgggcgag aggtggggat gccagacagg tgagttcctt 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. van der Loop, F. T., Schaart, G., Timmer, E. D., Ramaekers, F. C., and van Eys, G. J. (1996) Smoothelin, a Novel Cytoskeletal Protein Specific for Smooth Muscle Cells. J Cell Biol. 134, 401-411.

  3. van Eys, G. J., Voller, M. C., Timmer, E. D., Wehrens, X. H., Small, J. V., Schalken, J. A., Ramaekers, F. C., and van der Loop, F. T. (1997) Smoothelin Expression Characteristics: Development of a Smooth Muscle Cell in Vitro System and Identification of a Vascular Variant. Cell Struct Funct. 22, 65-72.

  4. Christen, T., Bochaton-Piallat, M. L., Neuville, P., Rensen, S., Redard, M., van Eys, G., and Gabbiani, G. (1999) Cultured Porcine Coronary Artery Smooth Muscle Cells. A New Model with Advanced Differentiation. Circ Res. 85, 99-107.

  5. Kramer, J., Aguirre-Arteta, A. M., Thiel, C., Gross, C. M., Dietz, R., Cardoso, M. C., and Leonhardt, H. (1999) A Novel Isoform of the Smooth Muscle Cell Differentiation Marker Smoothelin. J Mol Med (Berl). 77, 294-298.

  6. Kramer, J., Quensel, C., Meding, J., Cardoso, M. C., and Leonhardt, H. (2001) Identification and Characterization of Novel Smoothelin Isoforms in Vascular Smooth Muscle. J Vasc Res. 38, 120-132.

  7. Quensel, C., Kramer, J., Cardoso, M. C., and Leonhardt, H. (2002) Smoothelin Contains a Novel Actin Cytoskeleton Localization Sequence with Similarity to Troponin T. J Cell Biochem. 85, 403-409.

  8. van Eys, G. J., Niessen, P. M., and Rensen, S. S. (2007) Smoothelin in Vascular Smooth Muscle Cells. Trends Cardiovasc Med. 17, 26-30.

  9. van der Loop, F. T., Gabbiani, G., Kohnen, G., Ramaekers, F. C., and van Eys, G. J. (1997) Differentiation of Smooth Muscle Cells in Human Blood Vessels as Defined by Smoothelin, a Novel Marker for the Contractile Phenotype. Arterioscler Thromb Vasc Biol. 17, 665-671.

  10. van der Heijden, O. W., Essers, Y. P., Simkens, L. H., Teunissen, Q. G., Peeters, L. L., De Mey, J. G., and van Eys, G. J. (2004) Aging Blunts Remodeling of the Uterine Artery during Murine Pregnancy. J Soc Gynecol Investig. 11, 304-310.

  11. Tharp, D. L., Wamhoff, B. R., Turk, J. R., and Bowles, D. K. (2006) Upregulation of Intermediate-Conductance Ca2+-Activated K+ Channel (IKCa1) Mediates Phenotypic Modulation of Coronary Smooth Muscle. Am J Physiol Heart Circ Physiol. 291, H2493-503.

  12. Verhamme, P., Quarck, R., Hao, H., Knaapen, M., Dymarkowski, S., Bernar, H., Van Cleemput, J., Janssens, S., Vermylen, J., Gabbiani, G., Kockx, M., and Holvoet, P. (2002) Dietary Cholesterol Withdrawal Reduces Vascular Inflammation and Induces Coronary Plaque Stabilization in Miniature Pigs. Cardiovasc Res. 56, 135-144.

  13. Niessen, P., Clement, S., Fontao, L., Chaponnier, C., Teunissen, B., Rensen, S., van Eys, G., and Gabbiani, G. (2004) Biochemical Evidence for Interaction between Smoothelin and Filamentous Actin. Exp Cell Res. 292, 170-178.

  14. Campbell, G. R., and Chamley-Campbell, J. H. (1981) Smooth Muscle Phenotypic Modulation: Role in Atherogenesis. Med Hypotheses. 7, 729-735.

  15. Maeng, M., Mertz, H., Nielsen, S., van Eys, G. J., Rasmussen, K., and Espersen, G. T. (2003) Adventitial Myofibroblasts Play no Major Role in Neointima Formation After Angioplasty. Scand Cardiovasc J. 37, 34-42.

  16. Roberts, J. A., Waters, L., Ro, J. Y., and Zhai, Q. J. (2014) Smoothelin and Caldesmon are Reliable Markers for Distinguishing Muscularis Propria from Desmoplasia: A Critical Distinction for Accurate Staging Colorectal Adenocarcinoma. Int J Clin Exp Pathol. 7, 792-796.

  17. Chan, O. T., Chiles, L., Levy, M., Zhai, J., Yerian, L. M., Xu, H., Xiao, S. Y., Soffer, E. E., Conklin, J. L., Dhall, D., Kahn, M. E., Balzer, B. L., Amin, M. B., and Wang, H. L. (2013) Smoothelin Expression in the Gastrointestinal Tract: Implication in Colonic Inertia. Appl Immunohistochem Mol Morphol. 21, 452-459.

  18. Jiang, J., Nakayama, T., Shimodaira, M., Sato, N., Aoi, N., Sato, M., Izumi, Y., Kasamaki, Y., Ohta, M., Soma, M., Matsumoto, K., Kawamura, H., Ozawa, Y., and Ma, Y. (2012) Haplotype of Smoothelin Gene Associated with Essential Hypertension. Hereditas. 149, 178-185.

  19. Jiang, J., Nakayama, T., Shimodaira, M., Sato, N., Aoi, N., Sato, M., Izumi, Y., Kasamaki, Y., Ohta, M., Soma, M., Matsumoto, K., Kawamura, H., Ozawa, Y., Hinohara, S., Doba, N., and Ma, Y. (2012) Association of the Smoothelin (SMTN) Gene with Cerebral Infarction in Men: A Haplotype-Based Case-Control Study. Vasc Med. 17, 317-325.

  20. Jiang, J., Nakayama, T., Shimodaira, M., Sato, N., Aoi, N., Sato, M., Izumi, Y., Kasamaki, Y., Ohta, M., Soma, M., Matsumoto, K., Kawamura, H., Ozawa, Y., and Ma, Y. (2012) A Haplotype of the SMTN Gene Associated with Myocardial Infarction in Japanese Women. Genet Test Mol Biomarkers. 16, 1019-1026.

  21. Niessen, P., Rensen, S., van Deursen, J., De Man, J., De Laet, A., Vanderwinden, J. M., Wedel, T., Baker, D., Doevendans, P., Hofker, M., Gijbels, M., and van Eys, G. (2005) Smoothelin-a is Essential for Functional Intestinal Smooth Muscle Contractility in Mice. Gastroenterology. 129, 1592-1601.

  22. Rensen, S. S., Niessen, P. M., van Deursen, J. M., Janssen, B. J., Heijman, E., Hermeling, E., Meens, M., Lie, N., Gijbels, M. J., Strijkers, G. J., Doevendans, P. A., Hofker, M. H., De Mey, J. G., and van Eys, G. J. (2008) Smoothelin-B Deficiency Results in Reduced Arterial Contractility, Hypertension, and Cardiac Hypertrophy in Mice. Circulation. 118, 828-836.