Phenotypic Mutation 'slim' (pdf version)
List |< first << previous [record 97 of 132] next >> last >|
Alleleslim
Mutation Type nonsense
Chromosome16
Coordinate3,990,910 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Slx4
Gene Name SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonym(s) Btbd12, D16Bwg1016e
Chromosomal Location 3,979,105-4,003,770 bp (-)
MGI Phenotype FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_177472; MGI:106299

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000038871]
SMART Domains Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: Q389*

DomainStartEndE-ValueType
low complexity region 400 413 N/A INTRINSIC
BTB 506 609 6.15e-7 SMART
low complexity region 651 667 N/A INTRINSIC
low complexity region 833 849 N/A INTRINSIC
low complexity region 857 875 N/A INTRINSIC
low complexity region 1176 1192 N/A INTRINSIC
low complexity region 1437 1461 N/A INTRINSIC
Pfam:Slx4 1484 1541 3e-17 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738

DomainStartEndE-ValueType
Pfam:BTB 6 102 6.7e-14 PFAM
Predicted Effect probably benign
Predicted Effect probably benign
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 21240276
Body Weight (DSS Female) - decreased 21240276
Body Weight (DSS) - decreased 21240276
Body Weight (Female) - decreased 21240276
growth/size
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Gene trapped(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Slx4 APN 16 3990888 missense probably benign 0.17
IGL01767:Slx4 APN 16 3990248 missense probably benign 0.01
IGL02525:Slx4 APN 16 3980597 missense probably damaging 1.00
R0033:Slx4 UTSW 16 3988000 missense probably benign 0.08
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0363:Slx4 UTSW 16 3980089 missense probably damaging 1.00
R0433:Slx4 UTSW 16 3986018 missense probably benign 0.01
R0993:Slx4 UTSW 16 3985825 missense probably benign 0.00
R1083:Slx4 UTSW 16 3990910 nonsense probably null
R1373:Slx4 UTSW 16 3985510 missense probably benign 0.02
R1710:Slx4 UTSW 16 3999158 missense probably benign 0.15
R1712:Slx4 UTSW 16 3991594 missense probably damaging 0.99
R1874:Slx4 UTSW 16 3986848 missense probably benign 0.25
R1937:Slx4 UTSW 16 3987166 makesense probably null
R2008:Slx4 UTSW 16 3979921 missense probably damaging 1.00
R2156:Slx4 UTSW 16 3986359 missense probably benign 0.00
R2427:Slx4 UTSW 16 3988987 missense probably damaging 0.99
R3765:Slx4 UTSW 16 3980986 missense probably damaging 1.00
R3890:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R3891:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R4465:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4467:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4497:Slx4 UTSW 16 3994909 missense probably damaging 1.00
R4882:Slx4 UTSW 16 3980996 critical splice acceptor site probably null
R5119:Slx4 UTSW 16 4001199 missense possibly damaging 0.89
R5384:Slx4 UTSW 16 3990805 missense probably damaging 1.00
R5472:Slx4 UTSW 16 3991540 missense probably benign 0.13
R5578:Slx4 UTSW 16 3986862 missense probably damaging 1.00
R5582:Slx4 UTSW 16 3985788 missense possibly damaging 0.93
R5696:Slx4 UTSW 16 3979967 missense probably damaging 1.00
R5827:Slx4 UTSW 16 4001284 missense possibly damaging 0.94
R5964:Slx4 UTSW 16 4000951 critical splice donor site probably null
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6345:Slx4 UTSW 16 3990850 missense probably benign 0.06
R6612:Slx4 UTSW 16 3985276 missense probably damaging 0.99
R6979:Slx4 UTSW 16 3985015 missense probably damaging 0.96
R6989:Slx4 UTSW 16 3995838 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-05-12 11:31 AM by Anne Murray
Record Created 2015-08-06 9:26 AM by Bruce Beutler
Record Posted 2016-09-27
Phenotypic Description

Figure 1. Slim mice exhibit reduced body weights compared to control littermates. WGT data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The slim phenotype was identified among G3 mice of the pedigree R1083, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R1083. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The body weight phenotype was linked to a mutation in Slx4: a C to T transition at base pair 3,990,910 (v38) on chromosome 16, or base pair 12,920 in the GenBank genomic region NC_000082 encoding Slx4. Linkage was found with a recessive model of inheritance (P = 9.211 x 10-6), wherein six variant homozygotes departed phenotypically from 21 homozygous reference mice and 28 heterozygous mice (Figure 2).

 

The mutation corresponds to residue 1,473 in the NM_177472 mRNA sequence in exon 7 of 15 total exons. 

 

1458 CCTTCCAAGGAACCCCAGCTACCATTGGAGCTG

384  -P--S--K--E--P--Q--L--P--L--E--L-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine (Q) 389 for a premature stop codon (Q389*) in the SLX4 protein.

Protein Prediction

Figure 3. Domain organization of SLX4. Abbreviations: UBZ, ubiquitin-binding C2HC-type zinc finger; MLR, MEI9XPF interaction-like region; BTB, Broad-Complex, Tramtrack and Bric a brac/POxvirus and Zinc finger; SAP,  SAF-A/B, Acinus and PIAS motif; SBD, SLX1 binding domain. The location of the slim mutation is indicated.

Slx4 encodes structure-specific endonuclease subunit 4 (SLX4; alternatively, BTB/POX domain-containing protein 12 [BTBD12] or Fanconi Anemia Complementation Group P [FANCP]). SLX4 has two N-terminal ubiquitin-binding C2HC-type zinc finger (UBZ) domains, a MEI9XPF interaction-like region (MLR), a Broad-Complex, Tramtrack and Bric a brac/POxvirus and Zinc finger (BTB/POZ) protein-protein interaction domain (amino acids 506-609), a SAF-A/B, Acinus and PIAS (SAP) motif, a SLX1 binding domain (SBD; amino acids 1484-1541), and a highly conserved C-terminal domain that contains a helix-turn-helix motif (Figure 3) (1).

 

SLX4 interacts with several proteins necessary for its function. The MLR domain mediates the interaction between SLX4 with the DNA repair endonuclease complex XPF-ERCC1, the SAP domain of SLX4 binds the endonuclease complex MUS81-EME1, and the SBD domain binds the SLX1 endonuclease (see the Background section for more details) (2;3). SLX4 also binds the mismatch repair recognition complex MSH2-MSH3, the PLK1 cell cycle control kinase, and SLX4IP (1;4;5). The UBZ domains mediate an interaction between SLX4 and ubiquitinylated FANCD2 (6). The UBZ domains are required for the FANCD2-mediated recruitment of SLX4 to DNA-interstrand crosslink (ICL)-induced DNA damage foci (6;7). ICL is a type of DNA damage that links two strands of DNA, subsequently inhibiting transcription and replication (8). Mutation of the UBZ domain causes selective sensitivity to ICL-inducing agents (6). Deletion of the UBZ domain resulted in an inability of SLX4 to be recruited to the sites of ICL induction (9). The first UBZ domain of SLX4, but not the second, binds to ubiquitin polymers (9). Although not required for ICL repair or the binding of ubiquitin, the second UBZ domain is required for the resolution of Holliday junctions (9).

 

Human SLX4 has a TRF2-binding motif (TBM; H1020-X-L1022-X-P1024) within an unstructured region of the protein after the BTB domain (3;10). TRF2 is a subunit of the telomere TRF2-RAP1 shelterin subcomplex and mediates the recruitment of SLX4 to telomeres (10). TRF2 is not essential for SLX4 localization to the sites of DNA damage or for the ability of SLX4 to promote DNA repair (10). Some mammals have a motif similar to the TBM, but the TBM-like motifs are not predicted to interact with TRF2 (11).

 

SLX4 undergoes several posttranslational modifications. SLX4 has three small ubiquitin-like modifier (SUMO)-interacting motifs (SIMs): VILLL, VIDV, and VVEV (in mouse) corresponding to amino acids 956-960, 997-1000, and 1180-1183, respectively (12-14). The SIMs and the BTB domain mediate the SUMOylation of SLX4 (12). The SIM domains putatively facilitate the recruitment of SLX4 to DNA damage sites where it subsequently enhanced interactions with known SUMOylated targets including RPA70. The SIM motifs also promote SLX4 recruitment to telomeres (13). Cells expressing a SLX4 SIM mutant are sensitive to DNA damage and exhibit increased common fragile site instability as well as increased frequency of metaphase breaks, micronuclei, and 53BP1 nuclear bodies (15). Furthermore, the SLX4 SIM mutant is not recruited to promyelotic leukemia (PML) nuclear bodies or stabilized at laser-induced DNA damage sites (14). PARylation (i.e., the binding of PARP1) of SLX4 is also required for recruitment of SLX4 to sites of DNA damage (14). Yeast SLX4 is phosphorylated by the Mec1 and Tel1 kinases in response to DNA damage and during all cell cycle stages (16;17). SLX4 phosphorylation is essential for single-strand annealing yeast cells. The function of phosphorylation of SLX4 in mammalian cells is unknown.

 

The slim mutation results in substitution of Q389 for a premature stop codon (Q389*). Q389 is in the vicinity of the MLR domain. Expression of SLX4slim has not been examined.

Expression/Localization

SLX4 is ubiquitously expressed. SLX4 localizes to telomeres in human cells; however mouse SLX4 does not (10). SLX4 associates with telomeres throughout the cell cycle, but this interaction is at a maximum level during late S phase and under cell conditions of genotoxic stress (18).

Background

Figure 4. SLX4 promotes DNA lesion-specific responses. (Left & middle) Stalling of replication forks on DNA interstrand crosslinks (ICLs) induces lesion recognition by the FANCM–FAAP24–MHF1–MHF2 complex (not shown) and subsequent recruitment of the Fanconi anaemia core complex. A consequence of activation of the Fanconi anaemia core complex is the monoubiquitylation of the FANCD2–FANCI (FANCD2–I) heterodimer. Ubiquitylated FANCD2 is directed to the ICL region, where it functions as a landing pad for the recruitment of several factors, including SLX4 and Fanconi-associated nuclease 1 (FAN1), and coordinates nucleolytic incisions that are probably mediated by ERCC4 (a structure-specific endonuclease that also functions in nucleotide excision repair) and possibly MUS81. Ligation restores an intact DNA duplex, which functions as a template for homologous recombination-mediated repair of the double-strand break (DSB). The DNA incisions create a DSB, which is further processed by nucleases such as CtBP-interacting protein (CtIP), MRN (MRE11–RAD50–NBS1), exonuclease 1 (EXO1) and the helicase–nuclease complex BLM–DNA2 (Bloom syndrome protein–DNA replication ATP-dependent helicase/nuclease 2) that create a single-stranded DNA (ssDNA) overhang. This ssDNA coated with replication protein A (RPA) is a substrate for RAD51-mediated strand invasion promoted by BRCA2 and subsequent homologous recombination. The USP1–UAF1 (ubiquitin carboxyl-terminal hydrolase 1– USP1-associated factor 1) complex deubiquitylates the FANCD2–I heterodimer and completes repair. Figure legend adapted from Ceccaldi et al (2016). (Right) The SIMs promote SLX4 SUMO E3 ligase activity and ability to interact with SUMO-modified target proteins, facilitating cellular responses to replication-associated stress

Structure-specific endonucleases (SSEs) catalyze most forms of DNA cleavage during DNA repair. SLX4 has several functions in the maintenance of genome stability, including promoting DNA ICL, Holliday junction resolution, restoration of stalled replication forks, and telomere maintenance by regulating SSEs (1;19). SLX4 is a component of the scaffold that promotes the assembly of multiprotein complexes containing enzymes for DNA maintenance and repair. The SLX4 complex is recruited to sites of DNA repair and facilitates the repair of 3’ flaps, 5’ flaps, and replication fork structures.

 

During ICL repair, the MUS81-EME1 heterodimer catalyzes nick incision on the template strands at the site of DNA replication fork machinery stall, resulting in a one-ended double-strand break with a 3’ ssDNA overhang. SLX4 interacts with MUS81-EME1, but is not required for ICL-induced DSB formation (Figure 4) (5;20). DNA double helix unwinding occurs adjacent to the ICL with the assistance of the TFIIH complex comprised of ERCC3/XPB, ERCC2/XPD DNA helicases, and several other factors. There is a subsequent incision 3’ and 5’ of the ICL and then displacement of the ICL from the double helix. The endonuclease complex XPF-ERCC1 creates a nick incision 5’ of the DNA lesion.

 

Holliday junctions occur at the last step of homologous recombination during DNA double strand break repair and restoration of stalled replication forks. Holliday junction processing is essential for the completion of DNA repair as well as for chromosome segregation during mitosis. SLX4-SLX1 is one of three nucleases (the others being GEN1 and MUS81-EME1) that resolve Holliday junctions (21;22). Cells that do not express SLX1/4, MUS81, or GEN1 pathway-associated proteins exhibit defects in chromosome segregation and reduced survival (21). Upon cyclin-dependent kinase-mediated phosphorylation, SLX1-SLX4 and MUS81-EME1 associate to form a SLX-MUS holoenzyme at the G2/M transition. The SLX-MUS holoenzyme functions as a Holliday junction resolvase (21).

 

SLX4 localizes to telomeres through an interaction with TRF2 (3;4;10). TRF2 negatively regulates the length of telomeres (23;24). Upon association with TRF2, SLX4 transports SLX1 to the telomere. SLX4 is required for the nucleolytic resolution of branched intermediates during telomere replication (18). Loss of the interaction between SLX4 and TRF2 or SLX1 results in telomere fragility (18). SLX4 prevents telomere fragility in the absence and presence of exogenous replication stress. SLX4 prevents DNA damage at telomeres as loss of SLX4 in mouse and human cells resulted in an increased rate of telomere dysfunction-induced foci as well as increased telomere length (10). A function for SLX4 in telomere trimming is the result of its interaction with SLX1; a SLX4 mutant unable to interact with SLX1 failed to restore telomere length. SLX1 promoted the cleavage of telomeric D-loop (3).  

 

SLX4 functions as a SUMO E3 ligase that is able to SUMOlyate itself as well as the XPF subunit of the XPF-ERCC1 endonuclease (Figure 4) (12). SLX4 interacts with the SUMO-associated E2 conjugating enzyme UBC9. The SUMOylation activity of SLX4 is stimulated in vitro by DNA and is SLX4 phosphorylation-dependent. SLX4-associated SUMOylation is not required for ICL repair, but is associated with SLX4 overexpression-associated cellular toxicity. SLX4-associated SUMOylation is toxic by promoting DSBs in response to global replication stress.

 

SLX4 is required for Mec1-mediated phosphorylation of Rtt107, a BRCA1 C-terminal domain protein that assists in recovery from DNA damage during the S phase of the cell cycle (25). SLX4-dependent Rtt107 phosphorylation is essential for replication restart after alkylation damage. The function of SLX4 in promoting Rtt107 phosphorylation is independent of its function in the SLX1-SLX4 complex. SLX4 is recruited to chromatin behind stressed replication forks; the location of SLX4 recruitment is distinct from the area in which the replication machinery binds. SLX4 complex formation is nucleated by Mec1-mediated phosphorylation of histone H2A, which is then recognized by Rtt107. SLX4 promotes the recruitment of the Mec1 activator Dbp11 behind the stressed replication forks (26). Yeast cells depleted of either Rtt107 or SLX4 exhibited genome instability, sensitivity to DNA replication stress, and inability to complete DNA replication during recovery from replication stress (26).

 

Mutations in SLX4 are linked to Fanconi anemia, complementation group P (FANCP; OMIM: #613951), an autosomal disorder characterized by increased chromosomal instability and early-onset bone marrow failure (27). Some patients also have skeletal anomalies, chromosome instability, hypersensitivity to DNA crosslinking agents, and a predisposition to cancer (20;27).

Putative Mechanism

Slx4-deficient (Slx4-/-) mice are born at sub-Mendelian ratios (frequency of homozygotes was 11%) and have reduced fertility due to gonad dysfunction (28). Ovaries from female Slx4-/- mice did not have oocytes, and the testes from male exhibited failure of spermatogenesis. Several mutant mice exhibited perinatal lethality. Surviving mutant mice exhibited growth retardation compared to wild-type littermates, domed skulls, ocular anomalies, and blood cytopenia (28). Cells derived from the Slx4-/- mice showed premature senescence, accumulation of damaged chromosomes, and sensitivity to DNA crosslinking agents. Slx4-/- mice develop epithelial cancers and a contracted hematopoietic stem cell pool (29). The low body weight phenotype in the slim mice indicates loss of SLX4slim function. No other obvious phenotypes were observed in the slim mice.

Primers PCR Primer
slim(F):5'- TGCCAAGTCCACAAGGTCCTGAAG -3'
slim(R):5'- TGGAACCTGCATCCTGCATACAAAC -3'

Sequencing Primer
slim_seq(F):5'- TCCTGAAGGGCTTGACGC -3'
slim_seq(R):5'- TTCACCTAAATGGGCGACTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsZhe Chen and Bruce Beutler
List |< first << previous [record 97 of 132] next >> last >|