Phenotypic Mutation 'rsq1'

• Allele: rsq1
• Mutation Type: missense
• Chromosome: X
• Coordinate: 167,308,286 bp (GRCm38)
• Base Change: G ⇒ A (forward strand)
• Gene: Tlr7
• Gene Name: toll-like receptor 7
• Synonym(s): RP23-139P21.3
• Chromosomal Location: 167,304,929-167,330,558 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung, placenta, and spleen, and lies in close proximity to another family member, TLR8, on chromosome X. [provided by RefSeq, Jul 2008] ; PHENOTYPE: The innate immune response to viral infection is affected in homozygous null mice. Mice homozygous or hemizygous for a point mutation produce little or no tumor necrosis factor (TNF) alpha in response to stimulation by a single stranded RNA analog. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P58681
• SMART Domains: Protein: ENSMUSP00000061853; Gene: ENSMUSG00000044583; AA Change: T68I

Domain	Start	End	E-Value	Type
LRRNT	35	69	5.03e-1	SMART
LRR	126	149	2.45e0	SMART
LRR	203	226	9.75e0	SMART
LRR_TYP	289	312	1.28e-3	SMART
LRR	313	337	2.08e1	SMART
LRR	396	419	9.22e0	SMART
LRR	497	516	1.09e2	SMART
LRR	542	565	4.97e0	SMART
LRR	596	619	2.76e2	SMART
LRR_TYP	650	673	1.72e-4	SMART
Pfam:LRR_7	676	692	7.2e-2	PFAM
LRR_TYP	699	722	1.58e-3	SMART
LRR	724	746	8.26e1	SMART
LRR	749	770	2.15e2	SMART
LRRCT	784	835	1.56e-3	SMART
transmembrane domain	851	873	N/A	INTRINSIC
Pfam:TIR	894	1033	4.7e-21	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000060719)
• SMART Domains: Protein: ENSMUSP00000107787; Gene: ENSMUSG00000044583; AA Change: T68I

Domain	Start	End	E-Value	Type
LRRNT	35	69	5.03e-1	SMART
LRR	126	149	2.45e0	SMART
LRR	203	226	9.75e0	SMART
LRR_TYP	289	312	1.28e-3	SMART
LRR	313	337	2.08e1	SMART
LRR	396	419	9.22e0	SMART
LRR	497	516	1.09e2	SMART
LRR	542	565	4.97e0	SMART
LRR	596	619	2.76e2	SMART
LRR_TYP	650	673	1.72e-4	SMART
Pfam:LRR_7	676	692	7.2e-2	PFAM
LRR_TYP	699	722	1.58e-3	SMART
LRR	724	746	8.26e1	SMART
LRR	749	770	2.15e2	SMART
LRRCT	784	835	1.56e-3	SMART
transmembrane domain	851	873	N/A	INTRINSIC
Pfam:TIR	894	1033	4.7e-21	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112161)
• SMART Domains: Protein: ENSMUSP00000107789; Gene: ENSMUSG00000044583; AA Change: T68I

Domain	Start	End	E-Value	Type
LRRNT	35	69	5.03e-1	SMART
LRR	126	149	2.45e0	SMART
LRR	203	226	9.75e0	SMART
LRR_TYP	289	312	1.28e-3	SMART
LRR	313	337	2.08e1	SMART
LRR	396	419	9.22e0	SMART
LRR	497	516	1.09e2	SMART
LRR	542	565	4.97e0	SMART
LRR	596	619	2.76e2	SMART
LRR_TYP	650	673	1.72e-4	SMART
LRR_TYP	699	722	1.58e-3	SMART
LRR	724	746	8.26e1	SMART
LRR	749	770	2.15e2	SMART
LRRCT	784	835	1.56e-3	SMART
transmembrane domain	851	873	N/A	INTRINSIC
Pfam:TIR	891	1049	1.7e-16	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000112164)
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.168)
• Phenotypic Category: X-linked Recessive
• Penetrance: 100%
• Mode of Inheritance: X-linked Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 030229-UCD
• Last Updated: 2018-12-14 11:08 AM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2012-06-11
• Science Writers: Eva Marie Y. Moresco, Anne Murray
• Illustrators: Diantha La Vine
• Authors: Owen M. Siggs, Bruce Beutler

Accession Number

NCBI RefSeq: NM_133211; MGI: 3767244

Alleles Listed at MGI

All alleles(6) : Targeted(4) Chemically induced(2)

Phenotypic Description

Figure 1. Graph showing results from a TLR screen of macrophages from G3 mutagenized mice. Rsq1 macrophages do not respond to the TLR7 ligand, resiquimod (R848; indicated by the red arrow).

Figure 2. Lack of TLR7 intracellular signaling cascade in rsq1 BMDMs. (A) BMDMs were treated as indicated and the WCLs were subsjected to Western blot analysis for IκB (to monitor its ligand-induced degradation), phospho-p38, phospho-JNK, and tubulin (to confirm equal protein input). (B) BMDMs were treated with LPS (1 μg/ml) or R848 (10 μM) for the indicated times, and the amounts of IRAK1 were assessed by Western blot. Obtained from ( 1 ).

Figure 3. Lack of cytokine secretion and cellular activation in BMDMs and splenic B cells of rsq1 mice. (A) BMDMs from wild-type (solid lines) and rsq1 mice (dashed lines) were stimulated with the indicated concentrations of LPS, ssRNA, or R848 for 16 h. Supernatants were harvested and analyzed by mesoscale analysis for seven proinflammatory cytokines (IL-1β, IFN-γ, Il-12p70, IL-10, KC, IL-6, and TNF-α) all of which gave comparable activation profiles. Shown are representative results for IL-6 (upper panels) and TNF-α (lower panels) and from of at least three independent experiments. (B) Splenocytes from wild-type (solid bars) and rsq1 (open bars) were stimulated with R848 (10 μM), R006 (5 μg/ml), the immunostimulatory CpG oligonucleotide ODN1826 (1 μM), and carriers alone (DMSO and DOTAP) for 22 h. Cells were then harvested and labeled with lineage specific markers and analyzed by flow cytometry. Plotted are the mean CD86 vales (left panel) and percentage CD69 positivity (right panel) of the CD3 - , CD4 - , CD8 - , CD11c - , CD19 + , MHC + population. Results represent the average of two mice plus range. Obtained from ( 1 ).

Table 1. Comparison of cell populations in the spleens and bone marrow of wild-type and rsq1 mice. Obtained from ( 1 ).

The rsq1 phenotype was identified in a screen for ENU-induced mutants with defects in the innate immune response (TLR Signaling Screen). Peritoneal macrophages from rsq1 mice fail to produce tumor necrosis factor (TNF)-α in response to R-848, a single stranded RNA mimetic that activates TLR7 (Figure 1). However, TNF-α production is normal following stimulation with MALP-2 (macrophage-activating lipopeptide-2, TLR2/6 ligand), CpG oligodeoxynucleotides (CpG ODN, TLR9 ligand), Pam₃CSK₄ (a triacyl lipopeptide, TLR2/1 ligand), poly I:C (TLR3 ligand) and lipopolysaccharide (LPS, TLR4 ligand).  Bone marrow-derived macrophages (BMDMs) from the mice were unable to trigger IkB, p38, and JNK responses (Figure 2A) (1). Furthermore, the rsq1 mice were unable to induce the IRAK1-mediated degradative pathway (Figure 2B) (1).   Loss of TLR7-mediated intracellular signaling in the rsq1 mutant resulted in a failure to induce cytokines in BMDMs (Figure 3A), splenocytes, and dendritic cells (1).  Splenic B cells from the rsq1 mutants were also unable to upregulate costimuatory and activation markers (i.e. CD86 and CD69) after TLR7 stimulation (Figure 3B) (1).    The frequencies of T cells, B cells, monocytes, and dendritic cells in both the bone marrow and spleen were normal (Table 1) (1). 

Nature of Mutation

The Tlr7 gene on the X chromosome of rsq1 mice was sequenced, and a C to T transition was identified in exon 3 (of 3 total exons) at position 391 of the Tlr7 transcript. The mutation was identified in a hemizygous male.

 

375 ATTCCCACTAACACCACCAATCTTACCCTTACC

63  -I--P--T--N--T--T--N--L--T--L--T-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of threonine to isoleucine at residue 68 of the TLR7 protein.

Protein Prediction

TLR7 is a type I integral membrane glycoprotein containing 1050 amino acids. Like the other TLRs, its cytoplasmic domain (at its C terminus) shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (2-4), which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs and in IL receptors contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (5). In addition, TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops. The crystal structures of the TLR1 and TLR2 TIR domains revealed that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (6) (see the record for languid for a picture of the TLR2 TIR domain). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4 (see the record for lps3), which abolishes MyD88 binding (7) and LPS-induced signaling in mice (8).

Figure 4. Crystal structure of a TLR3 heterodimer complexed with its ligand, dsRNA (dark blue).  TLR3 ectodomains are shown in pink, and the two long LRR insertions in each ectodomain are in yellow.  The dsRNA ligand binds to the concave surface of the heterodimer complex at both the N- and C-terminal locations on each ectodomain.  Homology studies of TLR7 suggest that the TLR7 ligand may also bind to the concave surface of the ectodomain at N-terminal sites.  UCSF Chimera structure is based on PDB ID 3CIY, Liu et al., Science 320, 379-381 (2008).  Click on the 3D structure to view it rotate.

Figure 5. Protein and domain structure of TLR7. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the rsq1 mutation is shown in red. 3D image was created using UCSF Chimera. B) TLR7 is a 1050 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The rsq1 mutation (red asterisk) results in a conversion of threonine to isoleucine at residue 68 of the TLR7 protein. This image is interactive. Click on the image to view other mutations found in TLR7 (red). Click on the mutations for more specific information.

The extracellular domains of TLRs, unlike those of the interleukin receptors, contain multiple leucine-rich repeats (LRRs), which mediate ligand recognition by TLRs and generally consist of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) followed by XØXXØX₄FXXLX (residues ~11-24, but variable in length, sequence and structure), where X is any amino acid and Ø is a hydrophobic amino acid [discussed in (9)]. Crystal structures of several TLRs reveal that each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (10-12). In addition, the XLXXLXLXX sequence folds into a β-strand, with the remaining LRR residues oriented on the convex side of the structure. TLR7 has 27 LRRs in its ectodomain encoded by the N-terminal portion of the protein (3;4). Some of these LRRs contain insertions of up to 16 amino acids following positions 10 or 15 in the LRR consensus sequence, a common occurrence among LRRs of many TLRs. In TLR3, insertions in two of the LRRs extend outward from the convex face of the protein (11;12) (Figure 4; PDB ID 3CIY). It has been suggested that insertions in LRRs provide contacts that mediate the ligand-binding specificity of TLRs (9). For TLR7, LRRs 2, 5 and 8 contain long insertions following the tenth residue.  These insertions, along with an insertion in LRR11, are positioned proximal to the β-strands formed by the first ten residues.  These four insertions may contribute to the ligand-binding site (9). The ectodomain of TLR9 has been shown to undergo proteolytic cleavage between LRR14 and LRR15, and a similar cleavage event also occurs in TLR7 (13;14).

 

A recent study using a VISA knockout mouse model found that the mitochondrial protein, VISA (i.e. IPS-1, MAVS, or CardIF), is necessary for B cell expression of TLR7 (15).  Treatment of the VISA-deficient B cells with a TLR7 agonist found that TLR7-mediated induction of CD23 and CD69 did not occur; no change was observed after treatment with a TLR9 agonist (15).  Furthermore, VISA-deficient B cells proliferated poorly and produced less cytokines in response to TLR7 agonists (15).  Further examination the VISA-deficient B cells found that VISA is required for NF-κB activation after TLR7 agonist exposure; TLR9-mediated activation of NF-κB was not changed (15).  TLR7-mediated MyD88 association with IRAK1 is essential for TLR7 signaling.  In VISA-deficient B cells, the about of TLR7-mediated MyD88-IRAK1 association was decreased (15).

The rsq1 mutation results in a threonine to isoleucine substitution of amino acid 68 of TLR7, located within the first LRR b-strand (Figure 5). Threonine 68 is conserved among mammalian TLR7 orthologues and mouse paralogues.  The rsq1 mutation disrupts a N-linked glycosylation consensus sequence [NXT/S, where X can be any amino acid]; the putative glycosylation site is at N66.  An intact glycosylation consensus sequence is essential for the initiation of a signaling response to ssRNA and low molecular weight TLR7 agonists (1).

Expression/Localization

Northern blot and RT-PCR analysis detected Tlr7 transcript in heart, spleen, liver, kidney, small intestine, stomach and placenta (2-4). Tlr7 mRNA is also found in bone marrow and lymph node cells (2), in particular in plasmacytoid dendritic cells (pDC) (16;17), B cells (2;18), and eosinophils (19). TLR7 is localized intracellularly (20), in the endoplasmic reticulum (ER) (21), and at endosomal membranes (22;23).

Background

Figure 6. Overview of Toll-like receptor (TLR) signaling pathways. Shown are the signaling events downstream of TLR activation that ultimately lead to the induction of thousands of genes including TNF and type I IFN, which are critical in activating innate and adaptive immune responses. TLR1,2,4,5 and 6 are located at the cell surface, while TLR3,7, and 9 are localized in the endosome. Once TLR complexes recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions.

In the MyD88-dependent pathway utilized by all TLRs except TLR3, MyD88 (lime green) recruits IRAK kinases through their death domains (DD). TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination (small light blue circles) of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2. Activation of TAK1 leads to activation of MAP kinase cascades and the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, p105, and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus and permitting TPL2 to become activated, respectively. Activation of the p38, JNK and ERK1/2 kinases leads to the activation of both CREB and AP1, which in turn induce many target genes. In pDCs, activation of TLR7 and 9 in endosomes recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN.
 
In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM (bright yellow) recruits polyubiquitinated RIP1, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3.

Note that TLR4 signals through the MyD88-dependent pathway from the cell membrane and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway. When bound to vesicular stomatitis virus glycoprotein G (VSV-G) (far left), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM. Upon viral stimulation, TLR2 may also be internalized into endosomes to activate both IRF3 and IRF7 by an unknown mechanism. LTA = lipoteichoic acid; LP2 = lipopeptide 2. PAM3CSK4 is a triacyl lipopeptide. Phosphorylation events are represented by small yellow circles labeled with a “P”. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Figure 7. Toll-like receptor 7 (TLR7) signaling pathways. TLR7 is localized in the endosome in a process dependent on UNC-93B and the chaperones PRAT4A and gp96 (gray arrow). TLR7 forms homodimers and recruits MyD88 for the production of proinflammaotry cytokines. In pDCs, activation of TLR7 recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7, leading to production of large amounts of type I IFN.

TLRs are key sensors of invading microorganisms, recognizing conserved molecular motifs found in different pathogens and triggering host cell responses. There are 12 TLRs in mice and 10 in humans, and each receptor recognizes a distinct set of microbial ligand(s) (Figure 6). TLR7 was first shown to recognize imidazoquinolines, guanosine-based chemicals that are used as antiviral drugs (2). Peritoneal macrophages from mice with a targeted deletion of TLR7 produce normal amounts of TNF-α in response to LPS, peptidoglycan and zymosan (TLR2/6 ligands), MALP-2, Pam₃CSK₄ and CpG ODNs, but produced no detectable TNF-α or IL-12p40 in response to the imidazoquinolines imiquimod or R-848 (2). Splenic B lymphocyte proliferation and upregulation of costimulatory molecules (CD40, CD80, CD86) by bone marrow-derived dendritic cells, normal responses to imidazoquinolines, are also abrogated in Tlr7^-/- mice (2).

Single-stranded (ss) RNA viruses are now known to be the natural microbial ligands for TLR7 (24-26). This was demonstrated using Tlr7^-/- mice, which produce greatly reduced levels of serum IFN-α upon systemic infection with the ssRNA virus vesicular stomatitis virus (VSV) (24). In vitro, Tlr7^-/- pDC or total bone marrow cells produce almost no IFN-α and IL-12p40 after infection with VSV or influenza virus, another ssRNA virus (24;26). GU-rich ssRNA oligonucleotides from HIV-1 also activate TLR7 on human myeloid cells and pDC to produce IFN-α, IL-6, TNF-α and IL-12p40 (25). Recent studies demonstrate that pDC recognition of some ssRNA viruses via TLR7 requires the transport of cytosolic viral replication intermediates into lysosomes by autophagy (27), a process by which cells engulf parts of their own cytoplasm to eliminate foreign material or recycle various molecules. This mechanism explains why certain ssRNA viruses, such as respiratory syncytial virus (28), elicit pDC responses only after live viral infection. In addition, the shape of viral ssRNAs may determine the potency of TLR7 signaling, since UV crosslinking of viral RNAs before transfection into TLR7-expressing HEK cells can affect the level of IFN-α production (29). Similar to TLR9, proteolytic cleavage of TLR7 within its ectodomain occurs in the endolysosome (13;14). Although full length and cleaved forms of TLR9 are capable of binding ligand, only the cleaved form can recruit MyD88 and lead to signaling. The cleavage mechanism has been postulated to restrict receptor activation to endolysosomal compartments and prevent responses to self nucleic acids (13).
 TLR7 signaling requires proper localization of the receptor in the endosomal/lysosomal compartment as well as lysosomal acidification, which permits viral-lysosomal membrane fusion (22-24;26). Because not only viral-derived ssRNA, but ssRNA in general, can activate TLR7, it is thought that compartmentalization of TLR7 helps to prevent activation of signaling by self-ssRNA (26). The ER-resident twelve transmembrane-spanning protein Unc93b1 is required for signaling by all of the nucleic acid-sensing intracellular TLRs (TLRs 3, 7, 9 in mice), as evidenced by the lack of cytokine production by 3d cells (which harbor a mutation in Unc93b1) when stimulated with poly I:C, R-848 or CpG ODN (30). Unc93b1 physically interacts with TLRs 3, 7 and 9 (21), an interaction that may be required for proper targeting of these TLRs from the ER to the endosome (Figure 7).

Once activated, TLR7 signaling requires the adapter MyD88 and, like other MyD88-dependent TLRs, recruits IL-1R-associated kinase 1 (IRAK1), IRAK4 and tumor necrosis factor receptor-associated factor 6 (TRAF6), leading to NF-κB and MAP kinase activation (2;25;26;31). MyD88, together with TRAF6 and IRAK4, has also been shown to bind interferon regulatory factor 7 (IRF7) directly in order to stimulate IFN-α production (32;33). Although TLR7 signaling (including IRAK-1 and NF-κB activation) leading to IFNα/β production is strictly IRAK-4-dependent, human patients with IRAK-4 deficiency are said to be resistant to common viruses, and peripheral blood mononuclear cells from such patients produce normal levels of IFN-α/β and –λ in response to a variety of viruses, including ssRNA viruses (31). It has been suggested that TLR7 induction of IFN-α/β and –λ via IRAK4 in humans may be redundant in protective immunity to viruses (31). However, this statement rests upon the fact that living IRAK4 deficient patients are not seen to have severe viral infections. This sampling approach would ignore premature deaths from viral infection that might occur among IRAK4 deficient individuals. Moreover, viral infection of blood cells was not confirmed in the experiments that were performed (31).

Several reports support a role for TLR7 in the pathogenesis of the autoimmune disease systemic lupus erythematosus. TLR7 deficiency results in lower titers of autoantibodies and less severe disease in the lupus-prone MRL-Fas^lpr mice (34). In addition, the Y chromosome-linked autoimmunity accelerator (Yaa) locus in male BXSB mice (that confers a high incidence of lupus with early onset when bred to lupus mouse models) is caused by an X to Y chromosome translocation of a group of genes including Tlr7, suggesting that its increased expression may contribute to the disease (35;36). This hypothesis has been recently confirmed in transgenic mice overexpressing TLR7, which spontaneously develop autoimmune disease characterized by autoantibody production, splenomegaly, glomerulonephritis, DC expansion, and liver and lung inflammation (37). These phenotypes apparently lead to death in Tlr7-transgenic mice, with the level of TLR7 overexpression correlating with the number of deaths among transgenic lines (37).

A recent study has shown that TLR7 is also involved in promoting autoimmune diabetes in the NOD mouse (38). Cytotoxic T lymphocytes in the NOD model are induced by TLR7 signaling (in conjunction with CD40-mediated activation of dendritic cells) (38).   Treatment with a TLR7 agonist protomoted diabetes onset and activate NOD bone-derived dendritic cells and the secretion of proinflammatory cytokines and chemokines; inhibition of TLR7 leads to a delay in the early events of diabetes (38).

In an effort to understand the contributions of sex-associated factors on the immune system, a recent study examined the populations of leukocytes in young and old female and male mice (39).  In aged female mice, B cells bearing CD11b and CD11c, but not CD21 were found at a much higher frequency in the older females when compared to the above-mentioned groups (39).  When autoimmune-prone mice were examined at several ages, the number of the CD11b/c subset of B cells were elevated by as early as 3 months; the presence of autoantibodies could be observed by 6 months (39).  Examination of the elevated population found that these cells secreted autoreactive antibodies (39).  Gene expression analysis by microarray determined that the CD11b/c B cells share similarities to peritoneal B1 cells, however, there are over 500 genes that are differentially expressed in the CD11b/c cells.  The CD11b/c cells express many genes that are expressed by cytotoxic cells (e.g. T-bet, perforin, and granzyme A). Changes to TLR7 signaling (in both MyD88 and TLR7 knockout mice) prevented the accumulation of the B cells in aged female mice.  Exposure to TLR3, TLR4, and TLR9 agonists did not lead to an accumulation of CD11b/c B cells or the secretion of autoantibodies.

Putative Mechanism

Figure 8. TLR7 requries an intact N-glycosylation consensus sequence at positions 66-68. (A) 293T transiently expressing the indicated TLR7 mutant (abscissa) and the NF-κB-luciferase reporter gene were left untreated (nil) or were stimulated with R848 (5 μM). Doue hours later, the activity of the NF-κB-luciferase reporter gene was recorded by luminometry. RLU, relative luciferase units. (B) The amounts of the HA-tagged TLR7 mutants used in the experiment in A were assessed by anti-HA Western blotting. Obtained from ( 1 ) .

Figure 9. TLR7 rsq1 is dominant negative. 293T cells stably expressing the NF-κB-luciferase reporter and IRF5 were transiently transfected with the indicated plasmids: empty vector (dashed line), human TLR7 (squares), and human rsq1 (triangles). The cells were stimulated with titrated amounts of R848. After an overnight incubation, the NF-κB luciferase reporter activation was determined by luminometry (left panel). IFN-β in the supernatants was determined by MesoScale Discovery analysis (right panel). Obtained from ( 1 ) .

The exact molecular defect that is caused by the T68I rsq1 mutation in TLR7 is unknown.  Expression analysis revealed that the defect in TLR7 signaling was not due to impaired expression or localization of the rsq1 mutant.  It is proposed that the loss of the putative N-glycosylation consensus sequence in the rsq1 mutant leads to loss of N-glycosylation at N66 (Figure 8) and analysis of a mutant TLR7 (N66A) resulted in a TLR7 protein that was unable to activate NF-kB (1).  Although the mutation is in close proximity to the ligand binding site, the rsq1 mutant was able to bind ssRNA and interfere with TLR7 signaling as well as to colocalize and bind to wild-type TLR7, therefore, the loss of the purported glycosylation moiety at N66 seems to not cause a large change in the folding of TLR7 (1).  Co-expression studies using the rsq1 TLR7 mutant and wild-type TLR7 found that although rsq1 associates with the wild-type TLR7, the mutant prevents the formation of a signaling-competent dimer (Figure 9) (1).  Therefore, the loss of N-glycosylation at N66 could lead to a change in the structure that would subsequently disturb the function of TLR7 (1).  It is proposed that the loss of N-glycosylation at N66 due to the rsq1 mutation could alter the ability of TLR7 to trigger the dimeric receptor complex or that it could change the ability of TLR7 to bind to a signaling partner such as a protease or a chaperone (1).

Primers

Primers cannot be located by automatic search.

Genotyping

Rsq1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Rsq1(F): 5’- AGCACTCTTCGCAGCAACTAATATGTAA-3’

Rsq1(R): 5’-CCAACTCAACAAGGTTGGGAAGAAAATG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 35X

6) 72°C             10:00

7) 4°C               ∞

 

Primers for sequencing

Rsq1_seq(F): 5’- TACTTGTGGACAAGACTGATGACC -3’

Rsq1_seq(R): 5’- TTTCCATCCAGGTAAAGGGC -3’

 

The following sequence of 1911 nucleotides (from Genbank genomic region NC_000086 for linear DNA sequence of Tlr7) is amplified:

 

21166                                                  agcac tcttcgcagc

21181 aactaatatg taatgctgct tctgtatctt aaaaactgtt tggggcagca agagacatgg

21241 ctcagtgggt aagtatggtg atgtgaatgt gaatgacccc gtaggctcat gtttgaatac

21301 ttggttccca gtcagtggaa cttttggcaa ggattaggag gtgtggcttt gttgaaagag

21361 gtgtgccact agaggtaggc tgtgagattt caaaagtcca tgcccatccc agtctcattc

21421 cttctctgcc tacaatttgc agataacatg tgagctctca gcagctgctc cagtgtcatg

21481 cctacctgtc tgctaccatg tttcctgtca tgatatcata aactaaccct ctaaaactct

21541 aggcaagaac cagagcaaat gctttgtttt ctaaggtgtt gtggtcatag tggttcatca

21601 cagcaataga aacagtaatg agacagtaag tgtacttgtg gacaagactg atgacctgcg

21661 tttgatctgc aggatccaca aggtggaagg agataacaga ctctcacaag ttatcctctg

21721 accgccacaa tcacgtcatg gtatgtgcac actcactgac atatgcaaag catactcaca

21781 caagacaaat aaataaatgt gaaaaaattc ttgaagtttg ttagaaagct aagatggtac

21841 aagcaaaaca taaaaccatt atcaaagtct tcagtggtta ataagtacag tcacagggac

21901 ggaggtgctg tttacactat tacaaacaag acctgtgttg tttagtttta ataatgtacc

21961 aaaagagagg aaataaatgg aacttctcaa tcattccttg atatatttta taacaataat

22021 ttttttctct cttttattta caggtgtttt cgatgtggac acggaagaga caaattttga

22081 tctttttaaa tatgctctta gtttctagag tctttgggtt tcgatggttt cctaaaactc

22141 taccttgtga agttaaagta aatatcccag aggcccatgt gatcgtggac tgcacagaca

22201 agcatttgac agaaatccct gagggcattc ccactaacac caccaatctt acccttacca

22261 tcaaccacat accaagcatc tctccagatt ccttccgtag gctgaaccat ctggaagaaa

22321 tcgatttaag atgcaattgt gtacctgttc tactggggtc caaagccaat gtgtgtacca

22381 agaggctgca gattagacct ggaagcttta gtggactctc tgacttaaaa gccctttacc

22441 tggatggaaa ccaacttctg gagataccac aggatctgcc atccagctta catcttctga

22501 gccttgaggc taacaacatc ttctccatca cgaaggagaa tctaacagaa ctggtcaaca

22561 ttgaaacact ctacctgggt caaaactgtt attatcgaaa tccttgcaat gtttcctatt

22621 ctattgaaaa agatgctttc ctagttatga gaaatttgaa ggttctctca ctaaaagata

22681 acaatgtcac agctgtcccc accactttgc cacctaattt actagagctc tatctttata

22741 acaatatcat taagaaaatc caagaaaatg attttaataa cctcaatgag ttgcaagttc

22801 ttgacctaag tggaaattgc cctcgatgtt ataatgtccc atatccgtgt acaccgtgtg

22861 aaaataattc ccccttacag atccatgaca atgctttcaa ttcattgaca gaattaaaag

22921 ttttacgttt acacagtaat tctcttcagc atgtgccccc aacatggttt aaaaacatga

22981 gaaacctcca ggaactagac ctctcccaaa actacttggc cagagaaatt gaggaggcca

23041 aatttttgca ttttcttccc aaccttgttg agttgg

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.

References

  1. Iavarone, C., Ramsauer, K., Kubarenko, A. V., Debasitis, J. C., Leykin, I., Weber, A. N., Siggs, O. M., Beutler, B., Zhang, P., Otten, G., D'Oro, U., Valiante, N. M., Mbow, M. L., and Visintin, A. (2011) A Point Mutation in the Amino Terminus of TLR7 Abolishes Signaling without Affecting Ligand Binding. J. Immunol.. 186, 4213-4222.

  2. Hemmi, H., Kaisho, T., Takeuchi, O., Sato, S., Sanjo, H., Hoshino, K., Horiuchi, T., Tomizawa, H., Takeda, K., and Akira, S. (2002) Small Anti-Viral Compounds Activate Immune Cells Via the TLR7 MyD88- Dependent Signaling Pathway. Nat. Immunol.. 3, 196-200.

  3. Du, X., Poltorak, A., Wei, Y., and Beutler, B. (2000) Three Novel Mammalian Toll-Like Receptors: Gene Structure, Expression, and Evolution. Eur. Cytokine Netw.. 11, 362-371.

  4. Chuang, T. H., and Ulevitch, R. J. (2000) Cloning and Characterization of a Sub-Family of Human Toll-Like Receptors: HTLR7, hTLR8 and hTLR9. Eur. Cytokine Netw.. 11, 372-378.

  5. Slack, J. L., Schooley, K., Bonnert, T. P., Mitcham, J. L., Qwarnstrom, E. E., Sims, J. E., and Dower, S. K. (2000) Identification of Two Major Sites in the Type I Interleukin-1 Receptor Cytoplasmic Region Responsible for Coupling to Pro-Inflammatory Signaling Pathways. J. Biol. Chem.. 275, 4670-4678.

  6. Xu, Y., Tao, X., Shen, B., Horng, T., Medzhitov, R., Manley, J. L., and Tong, L. (2000) Structural Basis for Signal Transduction by the Toll/interleukin-1 Receptor Domains. Nature. 408, 111-115.

  7. Rhee, S. H., and Hwang, D. (2000) Murine TOLL-Like Receptor 4 Confers Lipopolysaccharide Responsiveness as Determined by Activation of NF Kappa B and Expression of the Inducible Cyclooxygenase. J. Biol. Chem.. 275, 34035-34040.

  8. Poltorak, A., He, X., Smirnova, I., Liu, M. -., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS Signaling in C3H/HeJ and C57BL/10ScCr Mice: Mutations in Tlr4 gene. Science. 282, 2085-2088.

  9. Jin, M. S., Kim, S. E., Heo, J. Y., Lee, M. E., Kim, H. M., Paik, S. G., Lee, H., and Lee, J. O. (2007) Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide. Cell. 130, 1071-1082.

  10. Bell, J. K., Botos, I., Hall, P. R., Askins, J., Shiloach, J., Segal, D. M., and Davies, D. R. (2005) The Molecular Structure of the Toll-Like Receptor 3 Ligand-Binding Domain. Proc. Natl. Acad. Sci. U. S. A.. 102, 10976-10980.

  11. Choe, J., Kelker, M. S., and Wilson, I. A. (2005) Crystal Structure of Human Toll-Like Receptor 3 (TLR3) Ectodomain. Science. 309, 581-585.

  12. Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-Rich Repeats and Pathogen Recognition in Toll-Like Receptors. Trends Immunol.. 24, 528-533.

  13. Ewald, S. E., Lee, B. L., Lau, L., Wickliffe, K. E., Shi, G. P., Chapman, H. A., and Barton, G. M. (2008) The Ectodomain of Toll-Like Receptor 9 is Cleaved to Generate a Functional Receptor. Nature. 456, 658-662.

  14. Park, B., Brinkmann, M. M., Spooner, E., Lee, C. C., Kim, Y. M., and Ploegh, H. L. (2008) Proteolytic Cleavage in an Endolysosomal Compartment is Required for Activation of Toll-Like Receptor 9. Nat. Immunol.. 9, 1407-1414.

  15. Xu, L. G., Jin, L., Zhang, B. C., Akerlund, L. J., Shu, H. B., and Cambier, J. C. (2012) VISA is Required for B Cell Expression of TLR7. J. Immunol.. 188, 248-258.

  16. Kadowaki, N., Ho, S., Antonenko, S., Malefyt, R. W., Kastelein, R. A., Bazan, F., and Liu, Y. J. (2001) Subsets of Human Dendritic Cell Precursors Express Different Toll-Like Receptors and Respond to Different Microbial Antigens. J. Exp. Med.. 194, 863-869.

  17. Edwards, A. D., Diebold, S. S., Slack, E. M., Tomizawa, H., Hemmi, H., Kaisho, T., Akira, S., and Reis e Sousa, C. (2003) Toll-Like Receptor Expression in Murine DC Subsets: Lack of TLR7 Expression by CD8 Alpha+ DC Correlates with Unresponsiveness to Imidazoquinolines. Eur. J. Immunol.. 33, 827-833.

  18. Bekeredjian-Ding, I. B., Wagner, M., Hornung, V., Giese, T., Schnurr, M., Endres, S., and Hartmann, G. (2005) Plasmacytoid Dendritic Cells Control TLR7 Sensitivity of Naive B Cells Via Type I IFN. J. Immunol.. 174, 4043-4050.

  19. Nagase, H., Okugawa, S., Ota, Y., Yamaguchi, M., Tomizawa, H., Matsushima, K., Ohta, K., Yamamoto, K., and Hirai, K. (2003) Expression and Function of Toll-Like Receptors in Eosinophils: Activation by Toll-Like Receptor 7 Ligand. J. Immunol.. 171, 3977-3982.

  20. Nishiya, T., Kajita, E., Miwa, S., and Defranco, A. L. (2005) TLR3 and TLR7 are Targeted to the Same Intracellular Compartments by Distinct Regulatory Elements. J. Biol. Chem.. 280, 37107-37117.

  21. Brinkmann, M. M., Spooner, E., Hoebe, K., Beutler, B., Ploegh, H. L., and Kim, Y. M. (2007) The Interaction between the ER Membrane Protein UNC93B and TLR3, 7, and 9 is Crucial for TLR Signaling. J. Cell Biol.. 177, 265-275.

  22. Heil, F., Ahmad-Nejad, P., Hemmi, H., Hochrein, H., Ampenberger, F., Gellert, T., Dietrich, H., Lipford, G., Takeda, K., Akira, S., Wagner, H., and Bauer, S. (2003) The Toll-Like Receptor 7 (TLR7)-Specific Stimulus Loxoribine Uncovers a Strong Relationship within the TLR7, 8 and 9 Subfamily. Eur. J. Immunol.. 33, 2987-2997.

  23. Lee, J., Chuang, T. H., Redecke, V., She, L., Pitha, P. M., Carson, D. A., Raz, E., and Cottam, H. B. (2003) Molecular Basis for the Immunostimulatory Activity of Guanine Nucleoside Analogs: Activation of Toll-Like Receptor 7. Proc. Natl. Acad. Sci. U. S. A.. 100, 6646-6651.

  24. Lund, J. M., Alexopoulou, L., Sato, A., Karow, M., Adams, N. C., Gale, N. W., Iwasaki, A., and Flavell, R. A. (2004) Recognition of Single-Stranded RNA Viruses by Toll-Like Receptor 7. Proc. Natl. Acad. Sci. U. S. A.. 101, 5598-5603.

  25. Heil, F., Hemmi, H., Hochrein, H., Ampenberger, F., Kirschning, C., Akira, S., Lipford, G., Wagner, H., and Bauer, S. (2004) Species-Specific Recognition of Single-Stranded RNA Via Toll-Like Receptor 7 and 8. Science. 303, 1526-1529.

  26. Diebold, S. S., Kaisho, T., Hemmi, H., Akira, S., and Reis e Sousa, C. (2004) Innate Antiviral Responses by Means of TLR7-Mediated Recognition of Single-Stranded RNA. Science. 303, 1529-1531.

  27. Lee, H. K., Lund, J. M., Ramanathan, B., Mizushima, N., and Iwasaki, A. (2007) Autophagy-Dependent Viral Recognition by Plasmacytoid Dendritic Cells. Science. 315, 1398-1401.

  28. Hornung, V., Schlender, J., Guenthner-Biller, M., Rothenfusser, S., Endres, S., Conzelmann, K. K., and Hartmann, G. (2004) Replication-Dependent Potent IFN-Alpha Induction in Human Plasmacytoid Dendritic Cells by a Single-Stranded RNA Virus. J. Immunol.. 173, 5935-5943.

  29. Wang, J. P., Liu, P., Latz, E., Golenbock, D. T., Finberg, R. W., and Libraty, D. H. (2006) Flavivirus Activation of Plasmacytoid Dendritic Cells Delineates Key Elements of TLR7 Signaling Beyond Endosomal Recognition. J. Immunol.. 177, 7114-7121.

  30. Tabeta, K., Hoebe, K., Janssen, E. M., Du, X., Georgel, P., Crozat, K., Mudd, S., Mann, N., Sovath, S., Goode, J., Shamel, L., Herskovits, A. A., Portnoy, D. A., Cooke, M., Tarantino, L. M., Wiltshire, T., Steinberg, B. E., Grinstein, S., and Beutler, B. (2006) The Unc93b1 Mutation 3d Disrupts Exogenous Antigen Presentation and Signaling Via Toll-Like Receptors 3, 7 and 9. Nat. Immunol.. 7, 156-164.

  31. Yang, K., Puel, A., Zhang, S., Eidenschenk, C., Ku, C. L., Casrouge, A., Picard, C., von, B. H., Senechal, B., Plancoulaine, S., Al-Hajjar, S., Al-Ghonaium, A., Marodi, L., Davidson, D., Speert, D., Roifman, C., Garty, B. Z., Ozinsky, A., Barrat, F. J., Coffman, R. L., Miller, R. L., Li, X., Lebon, P., Rodriguez-Gallego, C., Chapel, H., Geissmann, F., Jouanguy, E., and Casanova, J. L. (2005) Human TLR-7-, -8-, and -9-Mediated Induction of IFN-alpha/beta and -Lambda is IRAK-4 Dependent and Redundant for Protective Immunity to Viruses. Immunity. 23, 465-478.

  32. Kawai, T., Sato, S., Ishii, K. J., Coban, C., Hemmi, H., Yamamoto, M., Terai, K., Matsuda, M., Inoue, J., Uematsu, S., Takeuchi, O., and Akira, S. (2004) Interferon-Alpha Induction through Toll-Like Receptors Involves a Direct Interaction of IRF7 with MyD88 and TRAF6. Nat. Immunol.. 5, 1061-1068.

  33. Honda, K., Yanai, H., Mizutani, T., Negishi, H., Shimada, N., Suzuki, N., Ohba, Y., Takaoka, A., Yeh, W. C., and Taniguchi, T. (2004) Role of a Transductional-Transcriptional Processor Complex Involving MyD88 and IRF-7 in Toll-Like Receptor Signaling. Proc. Natl. Acad. Sci. U. S. A.. 101, 15416-15421.

  34. Christensen, S. R., Shupe, J., Nickerson, K., Kashgarian, M., Flavell, R. A., and Shlomchik, M. J. (2006) Toll-Like Receptor 7 and TLR9 Dictate Autoantibody Specificity and have Opposing Inflammatory and Regulatory Roles in a Murine Model of Lupus. Immunity. 25, 417-428.

  35. Pisitkun, P., Deane, J. A., Difilippantonio, M. J., Tarasenko, T., Satterthwaite, A. B., and Bolland, S. (2006) Autoreactive B Cell Responses to RNA-Related Antigens due to TLR7 Gene Duplication. Science. 312, 1669-1672.

  36. Subramanian, S., Tus, K., Li, Q. Z., Wang, A., Tian, X. H., Zhou, J., Liang, C., Bartov, G., McDaniel, L. D., Zhou, X. J., Schultz, R. A., and Wakeland, E. K. (2006) A Tlr7 Translocation Accelerates Systemic Autoimmunity in Murine Lupus. Proc. Natl. Acad. Sci. U. S. A.. 103, 9970-9975.

  37. Deane, J. A., Pisitkun, P., Barrett, R. S., Feigenbaum, L., Town, T., Ward, J. M., Flavell, R. A., and Bolland, S. (2007) Control of Toll-Like Receptor 7 Expression is Essential to Restrict Autoimmunity and Dendritic Cell Proliferation. Immunity. 27, 801-810.

  38. Lee, A. S., Ghoreishi, M., Cheng, W. K., Chang, T. Y., Zhang, Y. Q., and Dutz, J. P. (2011) Toll-Like Receptor 7 Stimulation Promotes Autoimmune Diabetes in the NOD Mouse. Diabetologia. 54, 1407-1416.

  39. Rubtsov, A. V., Rubtsova, K., Fischer, A., Meehan, R. T., Gillis, J. Z., Kappler, J. W., and Marrack, P. (2011) Toll-Like Receptor 7 (TLR7)-Driven Accumulation of a Novel CD11c(+) B-Cell Population is Important for the Development of Autoimmunity. Blood. 118, 1305-1315.