Phenotypic Mutation 'Sisyphus' (pdf version)
AlleleSisyphus
Mutation Type missense
Chromosome13
Coordinate52,640,790 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Syk
Gene Name spleen tyrosine kinase
Synonym(s) Sykb
Chromosomal Location 52,583,173-52,648,792 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011518 (variant 1), NM_001198977 (variant 2); MGI:99515

Mapped Yes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000060828] [ENSMUSP00000112914] [ENSMUSP00000113852]
SMART Domains Protein: ENSMUSP00000060828
Gene: ENSMUSG00000021457
AA Change: Y520C

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000055087)
SMART Domains Protein: ENSMUSP00000112914
Gene: ENSMUSG00000021457
AA Change: Y497C

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 342 582 2.68e-106 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000118756)
SMART Domains Protein: ENSMUSP00000113852
Gene: ENSMUSG00000021457
AA Change: Y520C

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000120135)
Meta Mutation Damage Score 0.9511 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - increased
IgE response to a Cysteine Protease (Papain) - increased
Candidate Explorer Status CE: potential candidate; Verification probability: 0.243; ML prob: 0.2864; human score: -0.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(22) : Chemically induced (ENU)(1) Gene trapped(6) Targeted (15)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Syk APN 13 52624748 missense probably benign 0.00
IGL01522:Syk APN 13 52643061 missense probably benign
IGL01957:Syk APN 13 52631740 missense probably benign
IGL01962:Syk APN 13 52610957 missense probably damaging 1.00
IGL02613:Syk APN 13 52643040 missense probably damaging 0.97
IGL02824:Syk APN 13 52623283 splice site probably benign
IGL03130:Syk APN 13 52622732 missense probably benign 0.12
Apricot UTSW 13 52640733 missense probably damaging 1.00
Poppy UTSW 13 52640733 missense probably damaging 1.00
H8562:Syk UTSW 13 52640621 missense probably damaging 1.00
R0091:Syk UTSW 13 52640733 missense probably damaging 1.00
R0346:Syk UTSW 13 52640659 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1917:Syk UTSW 13 52622708 missense probably damaging 1.00
R2001:Syk UTSW 13 52611238 missense probably benign 0.21
R2919:Syk UTSW 13 52611121 missense probably benign
R3413:Syk UTSW 13 52631739 missense probably benign
R3695:Syk UTSW 13 52622765 splice site probably null
R4363:Syk UTSW 13 52640730 missense probably damaging 1.00
R4754:Syk UTSW 13 52612259 intron probably benign
R4755:Syk UTSW 13 52641986 missense probably benign 0.25
R4806:Syk UTSW 13 52632927 missense probably benign 0.14
R4817:Syk UTSW 13 52611206 missense probably benign 0.03
R4903:Syk UTSW 13 52611081 missense probably damaging 1.00
R4997:Syk UTSW 13 52612448 nonsense probably null
R5066:Syk UTSW 13 52641982 missense possibly damaging 0.49
R5114:Syk UTSW 13 52611035 missense probably damaging 1.00
R5267:Syk UTSW 13 52641926 missense probably benign 0.05
R5323:Syk UTSW 13 52631717 missense probably benign 0.00
R5705:Syk UTSW 13 52611047 missense probably benign 0.03
R6190:Syk UTSW 13 52611053 missense probably damaging 0.97
R6892:Syk UTSW 13 52632898 missense probably benign 0.00
R6932:Syk UTSW 13 52612459 splice site probably null
R6977:Syk UTSW 13 52633058 missense probably benign 0.00
R7496:Syk UTSW 13 52612416 missense probably benign
R7650:Syk UTSW 13 52611095 missense probably benign 0.24
R8081:Syk UTSW 13 52638159 missense probably benign 0.00
R8199:Syk UTSW 13 52624732 missense probably benign 0.00
R8350:Syk UTSW 13 52620899 missense probably damaging 1.00
R8381:Syk UTSW 13 52633049 missense probably benign 0.08
R8420:Syk UTSW 13 52624727 missense probably benign 0.02
R8450:Syk UTSW 13 52620899 missense probably damaging 1.00
Z1177:Syk UTSW 13 52632913 missense possibly damaging 0.91
Mode of Inheritance Autosomal Dominant
Local Stock Sperm, gDNA
Repository
Last Updated 2020-01-15 10:21 AM by Eva Marie Y. Moresco
Record Created 2015-09-02 8:28 AM
Record Posted 2015-12-11
Phenotypic Description

Figure 1. Sisyphus mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sisyphus mice exhibited increased IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Sisyphus phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1888, some of which exhibited increased frequencies of natural killer cells in the peripheral blood (Figure 1). Some mice also exhibited increased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment, indicative of enhanced NLRP3 inflammasome function (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the increased frequency of peripheral NK cells using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 98 mutations (X-axis) identified in the G1 male of pedigree R1888. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 98 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Syk:  an A to G transition at base pair 52,640,790 (v38) on chromosome 13, or base pair 59,535 in the GenBank genomic region NC_000079 encoding the Syk gene. The strongest association was found with a dominant model of linkage to the normalized frequency of NK cells, wherein nine heterozygous mice departed phenotypically from 14 homozygous reference mice with a P value of 4.134 x 10-7 (Figure 3).  

 

The mutation corresponds to residue 1,775 in the mRNA sequence NM_011518 within exon 11 of 14 total exons and residue 1,771 in the mRNA sequence NM_001198977 within exon 11 of 14 total exons.

 
1759 GCTGATGAAAACTACTACAAGGCCCAGACCCAC NM_011518 (variant 1)
1755 GCTGATGAAAACTACTACAAGGCCCAGACCCAC NM_001198977 (variant 2)

515  -A--D--E--N--Y--Y--K--A--Q--T--H-

 

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at position 520 (Y520C) in the Syk protein, and is predicted by PolyPhen-2 to be probably benign (score = 0.045) (1).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 4. Domain structure of Syk. Mouse Syk consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). Aspartic acid (D) 488 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues are autophosphorylated following BCR stimulation. The Sisyphus mutation causes a tyrosine to cysteine change at amino acid 520. This image is interactive; click to view another mutation in Syk.

Figure 5. Crystal structure of the kinase domain of human Syk. Protein structure modeled from PDB: 1XBA using UCSF Chimera. Please see the entry for poppy for more details about the structure. The location of the Sisyphus mutation is labeled. The active site is also labeled. Click the image to rotate.
Figure 6. Crystal structure of full-length human Syk. Protein structure modeled from PDB:4FL3 and (41using UCSF Chimera. Please see the text for more details about the structure. The equivalent location of the Sisyphus mutation is labeled. Click the image to rotate.

Syk encodes spleen tyrosine kinase (Syk), one of two members of the Syk family of cytosolic protein kinases. Syk has two Src homology 2 (SH2) domains and a C-terminal kinase region followed by a short C-terminal tail [Figures 4-6; reviewed in (2-4)]. Between the SH2 domains is interdomain A; between the C-terminal SH2 domain and the kinase domain is interdomain B [(5); reviewed in (2-4)]. Interdomain A facilitates the proper conformation of the SH2 domains to promote binding to phosphorylated ITAMs using a helical coiled-coil structure. Interdomain B contains five putative autophosphorylation sites and functions to recruit, and dock, downstream signaling proteins (e.g., phospholipase Cγ1 (PLCγ1), Vav1 and c-Cbl) as well as regulate the ability of Syk to bind to ITAMs. The Sisyphus mutation results in a tyrosine to cysteine substitution at amino acid 520 within the Syk kinase domain. 

 

For more information about Syk, please see the record for poppy.

Putative Mechanism

Syk plays a major role in B cell development as a component of the pre-B cell receptor (BCR) and BCR signaling pathway. In BCR signaling, following the aggregation of BCR molecules, the ITAMs in the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) (6;7). These phosphotyrosines then act as docking sites for the SH2 domains of Syk, resulting in Syk phosphorylation and activation. Syk phosphorylates a number of downstream targets including BLNK (see the record for busy), PLCγ2 (see the record for queen), and protein kinase C β (PKCβ; see the record for Untied). BCR-associated signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for puff, xander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (8)]. Syk couples pre-BCR and BCR activation to downstream signaling pathways that mediate B cell development, proliferation, and survival. In addition to its role in BCR signaling, Syk also functions in pre-TCR signaling in thymocytes during the transition from the DN3 to the DN4 stage of development (9), and during TCR signaling in mature T cell populations (intraepithelial γδ T cells and naïve αβ T cells) (10;11). Syk functions in ITAM-associated signaling in other immune cells including natural killer cells downstream from the FcγRIII receptor (12), in mast cells downstream from the FcεRI receptor (13), and in neutrophils and macrophages downstream from FcγR signaling, which trigger several cellular responses including proliferation, differentiation, cell survival, mast cell degranulation, reactive oxygen species (ROS) production, phagocytosis, and cytokine release [(14;15); reviewed in (2;4)].

 

Fc receptor-mediated myeloid functions and β2 integrin-mediated leukocyte activation both require Syk and are linked to the pathogenesis of rheumatoid arthritis. In humans, defects in Syk-associated signaling are linked to autoimmune and allergic diseases such as rheumatoid arthritis, asthma, and allergic rhinitis (16-18). Syk-deficient mice exhibited perinatal lethality with a concomitant defect in blood vessel morphology, dilated vasculature, and systemic hemorrhage in the embryo (19-22). Homozygous Sisyphus mice are not born at expected Mendalian ratios, indicating that SykSisyphus does not retain sufficient functionality to support survival. Tyr519 and Tyr520 are autophosphorylated following Syk binding to phosphorylated ITAMs. Phosphorylation of Tyr519 and Tyr520 is required for Syk signal transduction, although it is not absolutely required for Syk kinase activity (23;24).  Activation loop autophosphorylation sustains Syk signaling after transient ITAM phosphorylation ends (25).

 

Altogether, the phenotypes of the Sisyphus mice indicate that SykSisyphus exhibits loss of function.

Primers PCR Primer
Sisyphus_pcr_F: CGTGTGATTCTAGGCACATTAAGG
Sisyphus_pcr_R: TCTCCAAGGTTACTAGTGAGATTTC

Sequencing Primer
Sisyphus_seq_F: GATAAGAACATCATAGAGCTGGTTC
Sisyphus_seq_R: CTACCATAGTAAAATACAGAGAGCAC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 416 nucleotides is amplified (chromosome 13, + strand):


1   cgtgtgattc taggcacatt aaggataaga acatcataga gctggttcac caggtttcca
61  tggggatgaa gtatttggaa gagagcaact ttgtgcacag agatctggct gcgcggaacg
121 tgcttctggt cacacagcac tatgccaaga tcagcgattt cggtctttcc aaagccctgc
181 gtgctgatga aaactactac aaggtaggag cgctcggtgc aagctcacag aacagggaga
241 ggaaacagct ctgtgcaggc tcacggagca ggctgagagc tcagtacagg ctcacagagc
301 agctgagggg acagcttcca tgcatagtta aggttgcagg ttataaagat atagaaagat
361 aaatgtgtgc tctctgtatt ttactatggt agaaatctca ctagtaacct tggaga


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Hexin Shi, and Bruce Beutler