Phenotypic Mutation 'pococurante'

• Allele: pococurante
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 119,338,114 bp (GRCm38)
• Base Change: A ⇒ T (forward strand)
• Gene: Myd88
• Gene Name: myeloid differentiation primary response gene 88
• Chromosomal Location: 119,335,934-119,341,411 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Asparagine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P22366
• SMART Domains: Protein: ENSMUSP00000035092; Gene: ENSMUSG00000032508; AA Change: I179N

Domain	Start	End	E-Value	Type
DEATH	19	109	7.17e-15	SMART
TIR	160	296	3.39e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000035092)
• SMART Domains: Protein: ENSMUSP00000115746; Gene: ENSMUSG00000032508

Domain	Start	End	E-Value	Type
Pfam:Death	50	109	3.5e-13	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Embryos, Sperm, gDNA
• MMRRC Submission: 010475-UCD
• Last Updated: 2017-06-14 10:38 AM by Katherine Timer
• Record Created: unknown
• Record Posted: 2007-11-30
• Science Writers: Alyson Mack, Eva Marie Y. Moresco
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Zhengfan Jiang, Katharina Brandl, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010851; MGI: 108005

Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(3) Chemically induced(2)

Phenotypic Description

Figure 1. TNF responses of peritoneal macrophages from pococurante (Poc) mice treated with various TLR ligands (A-H). All TLR signaling is abolished except for signaling through TLR3 (F), TLR2/6 (G) and (H). Macrophages from Myd88 knockout mice are used as controls. Values represent mean ± SEM (n=6 mice or more). (I) Macrophages from WT or Poc mice were pretreated with IFN-γ (10 units/ml) then treated with TLR ligands and assayed for type I IFN. Pococurante macrophages do not respond to CpG (TLR9 ligand) or resiquimod (TLR7 ligand), but show normal type I IFN in response to LPS and poly I:C (due to signaling through the MyD88-independent pathway). Similar results were observed in three independent experiments. Figure reproduced from reference (1) .

The pococurante phenotype was identified in a screen for ENU-induced mutants with altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1). Peritoneal macrophages from pococurante mice fail to produce tumor necrosis factor (TNF)-α in response to Pam₃CSK₄ (a triacyl lipopeptide, TLR2/1 ligand), lipoteichoic acid (TLR2/6 ligand), resiquimod (TLR7 ligand) and unmethylated CpG oligodeoxynucleotides (CpG ODN, TLR9 ligand). Pococurante macrophages produce no TNF-α when stimulated with low concentrations of lipopolysaccharide (LPS, TLR4 ligand), and markedly reduced amounts of TNF-α in response to high concentrations of LPS. In contrast, signaling via TLR3, stimulated by poly I:C, is normal. Pam₂CSK₄ and MALP-2, which are believed to signal via TLR2/6 complexes and/or TLR2 homodimers, also elicit a near normal response (Figure 1). 

 

Phosphorylation of JNK, the MAP kinase ERK, and IκB is eliminated or drastically reduced in pococurante macrophages upon either Pam₃CSK₄ or resiquimod stimulation, but retained in response to MALP-2 and Pam₂CSK₄, in agreement with the TNF-α assay results. Thus, the pococurante phenotype resembles the MyD88^-/- phenotype in TLR ligand sensitivity, except that some TLR2 signaling is retained; moreover, pococurante discriminates between two types of TLR2 ligands.

 

Unlike MyD88^-/- mice, pococurante mice do not develop spontaneous bacterial infections. When tested for susceptibility to specific bacterial infections, pococurante mice are able to contain an intradermal Streptococcus pyogenes infection that MyD88^-/- mice fail to control, albeit at a slower rate than wild type. MyD88-deficient mice and pococurante homozygotes are equally susceptible to Listeria monocytogenes and to mouse cytomegalovirus (MCMV) infections (MCMV Susceptibility and Resistance Screen). Pococurante homozygotes are susceptible to dextran sodium sulfate (DSS)-induced colitis, exhibiting progressive weight loss beginning around nine days after continuous administration of 1% DSS in the drinking water, when wild type mice have not lost any weight (DSS-induced Colitis Screen).

 

Nature of Mutation

The Myd88 gene on Chromosome 9 of pococurante mice was sequenced, and a T to A transversion identified in exon 3 (of 6 total exons) at position 617 of the Myd88 transcript. The pococurante locus was confirmed to be allelic with Myd88.

 

601 TTTGTGCAGGAGATGATCCGGCAACTAGAACAG

174 -F--V--Q--E--M--I--R--Q--L--E--Q-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of isoleucine to asparagine at residue 179 of the MYD88 protein.

Protein Prediction

MyD88 is a 296 amino acid protein adapter that relays signals from the IL-1 and IL-18 receptors and from most TLRs. It is a modular protein containing an N-terminal death domain encoded by the first exon (aa 1-109), which shares similarity with regions of the p55 tumor necrosis factor receptor type I and Fas antigen receptor (Figure 2) (2;3). The death domain was first identified in proteins involved in cell death induction, but it is now known also to be a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins (4).

 

Figure 2. MyD88 domain structure and 3D TIR domain. A, MyD88 is a 296 amino acid protein adapter. It contains an N-terminal death domain (DD) that acts as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins. The C-terminal portion of MyD88 contains a Toll/IL-1 receptor (TIR) domain, a conserved region which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain three conserved boxes (boxes 1, 2 and 3), which are required for signaling. Between the death domain and TIR domain is an “intermediate domain” that may be required for differential activation of distinct NF-κB- versus JNK-dependent transcriptional programs. The pococurante mutation replaces isoleucine with asparagine at position 179. B, The 3D structure shows the six α-helices and five β-strands of the TIR domain. 3D structure was created using UCSF Chimera package (2Z5V). This image is interactive. Click on the image to view other mutations found in MyD88 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

Following the MyD88 death domain is an “intermediate domain” encoded by exon 2 (5). Alternative splicing of Myd88 results in a variant that lacks the intermediate domain (MyD88_s), which is expressed only in the spleen and brain (5). When overexpressed in HEK293 cells, MyD88_s is able to bind IRAK, but does not activate NF-κB (a hallmark of MyD88 signaling, discussed in Background), reportedly because MyD88_s is unable to induce IRAK phosphorylation (5). The MyD88 intermediate domain has been suggested to provide for differential activation of distinct (NF-κB- versus JNK-dependent) transcriptional programs (6).

 

The C-terminal portion of MyD88 (exons 3-5) contains a Toll/IL-1 receptor (TIR) domain (2;3), a conserved region of approximately 200 amino acids which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain three conserved boxes (boxes 1, 2 and 3), which are required for signaling (9;10). TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (named for the α-helix and β-strand they connect; e.g. AA connects βA with αA). The crystal structures of the TLR1 and TLR2 TIR domains reveal that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (11) (see languid). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4 (see lps3), which has been reported to abolish MyD88 binding to a constitutively active TLR4 mutant (12), and LPS-induced signaling in mice (13). Nevertheless, amino acid identity between any two TIR domains is generally only about 25% (14), and significant conformational differences exist between the TIR domains of TLR1, TLR2 and IL-1RAPL (IL-1R accessory protein-like) (11;14). Thus, specific sequence elements unique to each TIR domain-containing protein likely confer particular binding partner recognition.

 

The pococurante mutation replaces isoleucine with asparagine at position 179, which exists near the center of the αA helix of the MyD88 TIR domain. The mechanism by which it may cause the mutant phenotype is discussed below (Putative Mechanism).

Expression/Localization

MyD88 transcript is detected in most tissues including heart, brain, spleen, lung, liver, muscle, kidney and testis, and in T, B and myeloid cell lines (2;15). MyD88 is localized in distinct condensed particles scattered throughout the cytoplasm (16-18), reportedly in organelles yet to be identified (18). Using TIR domain-swapped and truncation mutants of MyD88, this subcellular localization was attributed to the death domain and/or intermediate domain, since mutants lacking portions of either domain localized diffusely throughout the cytoplasm (18). Interestingly, truncation mutants that localized diffusely in the cytoplasm failed to activate an NF-κB luciferase reporter construct when transfected into HEK293 cells (18).

Background

TLRs are transmembrane receptors that sense molecules of microbial origin and trigger host cell responses. The twelve mouse TLRs and ten human TLRs recognize a wide range of structurally distinct molecules, and all signal through only four adapter proteins known to date: MyD88, Tirap (Mal), TICAM-1 (TRIF) and TICAM-2 (TRAM) (19). TLR signaling through these adapters initiates a cascade of signaling events involving various kinases, adapters and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7.

 

MyD88 was first characterized as a differentiation marker induced by IL-6 treatment of myeloleukemic cells as they lose the ability to proliferate and come to resemble mature macrophages (20). Several years later, MyD88 was shown to function in signaling from the IL-1 receptor (IL-1R) (4;21;22), and from TLRs (Figure 3)(23). Activation of these receptors leads to MyD88 recruitment to the receptor complexes, where it functions as an adapter to recruit IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6 (4;23). The ensuing signaling pathway has been extensively studied, and culminates in the activation of NF-κB-dependent transcription [reviewed in (19;24)]. Briefly, IRAK-1 and TRAF6 dissociate from the receptor complex, and freed TRAF6 interacts with TAK1, activating it to phosphorylate the IκB kinase (IKK) complex. The IKK complex phosphorylates IκB, targeting it for degradation and relieving its inhibition of NF-κB which translocates to the nucleus and activates expression of target genes including IL-6, IL-1, TNF, IL-12p40 and type I interferon, cytokines required for the inflammatory response. Recent work demonstrates that TLR signaling through MyD88 also activates interferon regulatory factor 5 (IRF5), leading to induction of inflammatory cytokines but not type I interferon production (25). MyD88 and TRAF6 may interact directly with IRF5 in a complex, activating IRF5 and promoting its translocation to the nucleus (25).

 

Figure 3. MyD88 signaling pathways. MyD88 is a protein adapter that relays signals from the IL-1 and IL-8 receptors (not shown) and from most TLRs. Activation of these receptors leads to MyD88 recruitment to the receptor complexes, where it recruits IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6. The signaling pathway culminates in the activation of NF-κB-dependent transcription. MyD88 and TRAF6 may interact directly with IRF5 in a complex, activating IRF5 and promoting its translocation to the nucleus. MyD88, together with TRAF6 and IRAK4, has also been shown to bind IRF7 directly. This occurs downstream of TLR7, TLR8 and TLR9 in plasmacytoid dendritic cells and requires the phosphorylation of IRF7 by IRAK1.

MyD88, together with TRAF6 and IRAK4, has also been shown to bind IRF7 directly in order to stimulate IFN-α production (16;26). This occurs downstream of TLR7, TLR8 and TLR9 in plasmacytoid dendritic cells and requires the phosphorylation of IRF7 by IRAK1 (27).

 

The function of MyD88 in IL-1R and TLR signaling has been confirmed using MyD88-deficient mice. Myd88^-/- mice display no response to IL-1, including T cell proliferation or cytokine induction, and fail to activate NF-κB (28). In TLR signaling, MyD88 is known to serve all the TLRs except for TLR3. Thus, TLR2/1, TLR2/6, TLR5, TLR7 and TLR9 signaling leading to activation of NF-κB is abolished in MyD88-deficient mice. In the case of TLR4 signaling, NF-κB activation still occurs in Myd88^-/- mice, but with delayed kinetics compared to wild type (29). The adapter TRIF is responsible for this second, late wave of NF-κB activity (30;31), but it cannot fully compensate for lack of MyD88 in the production of inflammatory cytokines nor in the induction of LPS-induced shock responses nor in resistance to several bacterial infections (1;29). MyD88-deficient mice are highly susceptible to infections with Staphylococcus aureus (32), Toxoplasma gondii (33), Listeria monocytogenes (1;34), Leishmania major (35) and mouse cytomegalovirus (36).

Putative Mechanism

Figure 4. Proposed TIR domain interactions based on docking studies. A, Face-to-face interaction model mediating receptor:adaptor binding. TLR2 is shown in blue, and MyD88 is shown in yellow. Individual amino acids and motifs are indicated by arrows in colors corresponding to the color of each protein. The critical P residue of each BB loop is shown in red, and the critical V or I residue of the Poc site is shown in green. B, Back-to-back interaction model mediating TIR domain oligomerization. Blue and yellow ribbons represent TIR domains of two different MyD88 proteins or two different TLR2 molecules after ligand stimulation. The interaction is mediated by the C-terminal α-helices (αE) in an antiparallel fashion. Figure reproduced from reference (1).

Molecular modeling indicates two principal modes of receptor:adapter TIR domain interaction: face-to face, involving BB loop and pococurante site interactions, and back-to-back, involving α_E helix interactions (1). The classical Lps mutation (P712H) in the BB loop of the TIR domain of murine TLR4 abolishes LPS signaling (13). Based on comparisons with the structure of the TLR2 TIR domain (11), both P712 in TLR4 and I179 in MyD88 appear to protrude from clusters of hydrophobic amino acids. When the BB loop mutation is engrafted onto TLR2, TLR2^BB is able to activate NF-κB reporter gene transcription (36). To test the importance of I179 (the “Poc” site) in the context of receptors, the corresponding mutation was made in TLR2, TLR4 or TLR9. TLR2^Poc is able to activate NF-κB, and respond to MALP-2, but not lipoteichoic acid or Pam₃CSK₄. In contrast, TLR4^Poc and TLR9^Poc are unable to activate NF-κB. Mutation of either site on MyD88 still allows MALP-2-dependent NF-κB activation, but mutation of both sites abrogates this ability. MyD88^poc can bind TLR2. These findings suggest that in the case of TLR2/6 signaling, either the BB loop site or the Poc site is sufficient for the receptor:adapter interaction (when one of the proteins is wild type). Thus, the BB loop and Poc site may serve the same molecular function in the TLR2/6:MyD88 interaction. In the case of TLR4 or TLR9, disruption of either the BB-loop site or the Poc site is sufficient to abolish interaction (1).

 

Mutation of two conserved amino acids within the α_E helix of either TLR2 or MyD88 prevents ligand-induced NF-κB activation (1). However, MyD88 containing the αE helix mutations is still able to bind wild type TLR2 or TLR4 in immunoprecipitation experiments. These data support the conclusion that the α_E helix of TIR domains is required for homotypic oligomerization of TIR domains (both in the case of the receptors and MyD88). Homotypic oligomerization is required for propagation of the signal from the receptor (i.e., recruitment of an adapter subunit) and from the adapter to more distal elements of the pathway. This conclusion is supported by similar mutagenesis studies of MyD88 in IL-1 receptor interactions (10).

 

On the basis of these observations as well as molecular docking studies, a model for receptor:adapter TIR domain interactions has been proposed, in which both the Poc site and BB loop contribute to the interface between the receptor and adapter, and the α_E helix contributes to receptor oligomerization and to adapter oligomerization (1) (Figure 2).

Primers

Primers cannot be located by automatic search.

Genotyping

Pococurante genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Poco(F): 5’-AACCGGGATTTCATCTGGGAGGAAG -3’

Poco(R): 5’-TCGTCAGAAACAACCACCACCATGC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:20

4) 68°C             1:00

5) repeat steps (2-4) 35X

6) 68°C             5:00

7) 4°C               ∞

 

Primers for sequencing

Poco_seq(F): 5’- AGACTCCAGGTTGGGCTCCTTC -3’

Poco_seq(R): 5’- CCAGCTAGCAGGACAGTCCTTG -3’

 

The following sequence of 544 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Cd14) is amplified:

 

1685     aaccgg gatttcatct gggaggaagt tatctgttca ctggtagaga gggcatgtat

1741 atgacattgc tttgatatgg atacaggccc aggttccctt gatggaagac tccaggttgg

1801 gctccttcca gccttctgca gaggctgatt gattcccttg tcccctgtcc tcaggacaaa

1861 cgccggaact tttcgatgcc tttatctgct actgccccaa cgatatcgag tttgtgcagg

1921 agatgatccg gcaactagaa cagacagact atcggcttaa gttgtgtgtg tccgaccgtg

1981 acgtcctgcc gggcacctgt gtctggtcca ttgccagcga gctaattgag aaaaggttgg

2041 ttaaacatct aagagggtag gtgggtgaat gcatgaaacc cagaggtcca gatgcaagga

2101 ctgtcctgct agctgggctc tgtcccgcct gggtaatgta gtccttcctg accccatcct

2161 ctgaaggaag tcaccgcagt gccactctcc ctcaggtgtc gccgcatggt ggtggttgtt

2221 tctgacga

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1.  Jiang, Z., Georgel, P., Li, C., Choe, J., Crozat, K., Rutschmann, S., Du, X., Bigby, T., Mudd, S., Sovath, S., Wilson, I. A., Olson, A., and Beutler, B. (2006) Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis, Proc Natl Acad Sci U S A 103, 10961-10966.

   2.  Rand, D. M., Dorfsman, M., and Kann, L. M. (1994) Neutral and non-neutral evolution of Drosophila mitochondrial DNA, Genetics 138, 741-756.

   3.  Hardiman, G., Rock, F. L., Balasubramanian, S., Kastelein, R. A., and Bazan, J. F. (1996) Molecular characterization and modular analysis of human MyD88, Oncogene 13, 2467-2475.

   4.  Wesche, H., Henzel, W. J., Shillinglaw, W., Li, S., and Cao, Z. (1997) MyD88: an adapter that recruits IRAK to the IL-1 receptor complex, Immunity 7, 837-847.

   5.  Janssens, S., Burns, K., Tschopp, J., and Beyaert, R. (2002) Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88, Curr. Biol. 12, 467-471.

   6.  Janssens, S., Burns, K., Vercammen, E., Tschopp, J., and Beyaert, R. (2003) MyD88S, a splice variant of MyD88, differentially modulates NF-kappaB- and AP-1-dependent gene expression, FEBS Lett. 548, 103-107.

   7.  Oshiumi, H., Matsumoto, M., Funami, K., Akazawa, T., and Seya, T. (2003) TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon-beta induction, Nat. Immunol. 4, 161-171.

   8.  Yamamoto, M., Sato, S., Mori, K., Hoshino, K., Takeuchi, O., Takeda, K., and Akira, S. (2002) Cutting edge: a novel Toll/IL-1 receptor domain-containing adapter that preferentially activates the IFN-beta promoter in the Toll-like receptor signaling, J. Immunol. 169, 6668-6672.

  9.  Slack, J. L., Schooley, K., Bonnert, T. P., Mitcham, J. L., Qwarnstrom, E. E., Sims, J. E., and Dower, S. K. (2000) Identification of two major sites in the type I interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways, J. Biol. Chem. 275, 4670-4678.

 10.  Li, C., Zienkiewicz, J., and Hawiger, J. (2005) Interactive sites in the MyD88 Toll/interleukin (IL) 1 receptor domain responsible for coupling to the IL1beta signaling pathway, J. Biol. Chem. 280, 26152-26159.

 11.  Xu, Y., Tao, X., Shen, B., Horng, T., Medzhitov, R., Manley, J. L., and Tong, L. (2000) Structural basis for signal transduction by the Toll/interleukin-1 receptor domains, Nature 408, 111-115.

 12.  Rhee, S. H. and Hwang, D. (2000) Murine TOLL-like Receptor 4 Confers Lipopolysaccharide Responsiveness as Determined by Activation of NFkappa B and Expression of the Inducible Cyclooxygenase, J. Biol. Chem. 275, 34035-34040.

 13.  Poltorak, A., He, X., Smirnova, I., Liu, M.-Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282, 2085-2088.

 14.  Khan, J. A., Brint, E. K., O'Neill, L. A., and Tong, L. (2004) Crystal structure of the Toll/interleukin-1 receptor domain of human IL-1RAPL, J. Biol. Chem. 279, 31664-31670.

 15.  Bonnert, T. P., Garka, K. E., Parnet, P., Sonoda, G., Testa, J. R., and Sims, J. E. (1997) The cloning and characterization of human MyD88: a member of an IL-1 receptor related family, FEBS Lett 402, 81-84.

 16.  Kawai, T., Sato, S., Ishii, K. J., Coban, C., Hemmi, H., Yamamoto, M., Terai, K., Matsuda, M., Inoue, J., Uematsu, S., Takeuchi, O., and Akira, S. (2004) Interferon-alpha induction through Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6, Nat. Immunol. 5, 1061-1068.

 17.  Jaunin, F., Burns, K., Tschopp, J., Martin, T. E., and Fakan, S. (1998) Ultrastructural distribution of the death-domain-containing MyD88 protein in HeLa cells, Exp. Cell Res. 243, 67-75.

 18.  Nishiya, T., Kajita, E., Horinouchi, T., Nishimoto, A., and Miwa, S. (2007) Distinct roles of TIR and non-TIR regions in the subcellular localization and signaling properties of MyD88, FEBS Lett 581, 3223-3229.

 19.  Beutler, B., Jiang, Z., Georgel, P., Crozat, K., Croker, B., Rutschmann, S., Du, X., and Hoebe, K. (2006) Genetic analysis of host resistance: Toll-Like receptor signaling and immunity at large, Annu. Rev. Immunol. 24, 353-389.

 20.  Lord, K. A., Hoffman-Liebermann, B., and Liebermann, D. A. (1990) Nucleotide sequence and expression of a cDNA encoding MyD88, a novel myeloid differentiation primary response gene induced by IL6, Oncogene 5, 1095-1097.

 21.  Muzio, M., Ni, J., Feng, P., and Dixit, V. M. (1997) IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL- 1 signaling., Science 278, 1612-1615.

 22.  Burns, K., Martinon, F., Esslinger, C., Pahl, H., Schneider, P., Bodmer, J. L., Di, M. F., French, L., and Tschopp, J. (1998) MyD88, an adapter protein involved in interleukin-1 signaling, J Biol. Chem. 273, 12203-12209.

 23.  Medzhitov, R., Preston-Hurlburt, P., Kopp, E., Stadlen, A., Chen, C., Ghosh, S., and Janeway, C. A., Jr. (1998) MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways, Mol. Cell 2, 253-258.

 24.  Kawai, T. and Akira, S. (2006) Innate immune recognition of viral infection, Nat. Immunol. 7, 131-137.

 25.  Takaoka, A., Yanai, H., Kondo, S., Duncan, G., Negishi, H., Mizutani, T., Kano, S., Honda, K., Ohba, Y., Mak, T. W., and Taniguchi, T. (2005) Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors, Nature 434, 243-249.

 26.  Honda, K., Yanai, H., Mizutani, T., Negishi, H., Shimada, N., Suzuki, N., Ohba, Y., Takaoka, A., Yeh, W. C., and Taniguchi, T. (2004) Role of a transductional-transcriptional processor complex involving MyD88 and IRF-7 in Toll-like receptor signaling, Proc. Natl. Acad. Sci. U. S. A 101, 15416-15421.

 27.  Uematsu, S., Sato, S., Yamamoto, M., Hirotani, T., Kato, H., Takeshita, F., Matsuda, M., Coban, C., Ishii, K. J., Kawai, T., Takeuchi, O., and Akira, S. (2005) Interleukin-1 receptor-associated kinase-1 plays an essential role for Toll-like receptor (TLR)7- and TLR9-mediated interferon-{alpha} induction, J. Exp. Med. 201, 915-923.

 28.  Adachi, O., Kawai, T., Takeda, K., Matsumoto, M., Tsutsui, H., Sakagami, M., Nakanishi, K., and Akira, S. (1998) Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function., Immunity 9, 143-150.

 29.  Kawai, T., Adachi, O., Ogawa, T., Takeda, K., and Akira, S. (1999) Unresponsiveness of MyD88-deficient mice to endotoxin, Immunity 11, 115-122.

 30.  Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., and Akira, S. (2003) Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway, Science 301, 640-643.

 31.  Hoebe, K., Du, X., Georgel, P., Janssen, E., Tabeta, K., Kim, S. O., Goode, J., Lin, P., Mann, N., Mudd, S., Crozat, K., Sovath, S., Han, J., and Beutler, B. (2003) Identification of Lps2 as a key transducer of MyD88-independent TIR signaling, Nature 424, 743-748.

 32.  Takeuchi, O., Hoshino, K., and Akira, S. (2000) Cutting Edge: TLR2-Deficient and MyD88-Deficient Mice Are Highly Susceptible to Staphylococcus aureus Infection, J. Immunol. 165, 5392-5396.

 33.  Scanga, C. A., Aliberti, J., Jankovic, D., Tilloy, F., Bennouna, S., Denkers, E. Y., Medzhitov, R., and Sher, A. (2002) Cutting edge: MyD88 is required for resistance to Toxoplasma gondii infection and regulates parasite-induced IL-12 production by dendritic cells, J Immunol. 168, 5997-6001.

 34.  Edelson, B. T. and Unanue, E. R. (2002) MyD88-dependent but Toll-like receptor 2-independent innate immunity to Listeria: no role for either in macrophage listericidal activity, J Immunol. 169, 3869-3875.

 35.  Muraille, E., De Trez, C., Brait, M., De Baetselier, P., Leo, O., and Carlier, Y. (2003) Genetically resistant mice lacking MyD88-adapter protein display a high susceptibility to Leishmania major infection associated with a polarized Th2 response, J. Immunol. 170, 4237-4241.

 36.  Forget, G., Matte, C., Siminovitch, K. A., Rivest, S., Pouliot, P., and Olivier, M. (2005) Regulation of the Leishmania-induced innate inflammatory response by the protein tyrosine phosphatase SHP-1, Eur. J. Immunol. 35, 1906-1917.