Phenotypic Mutation 'lackadaisical'

• Allele: lackadaisical
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 119,338,692 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Myd88
• Gene Name: myeloid differentiation primary response gene 88
• Chromosomal Location: 119,335,934-119,341,411 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P22366
• SMART Domains: Protein: ENSMUSP00000035092; Gene: ENSMUSG00000032508; AA Change: Y116C

Domain	Start	End	E-Value	Type
DEATH	19	109	7.17e-15	SMART
TIR	160	296	3.39e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000035092)
• SMART Domains: Protein: ENSMUSP00000115746; Gene: ENSMUSG00000032508

Domain	Start	End	E-Value	Type
Pfam:Death	50	109	3.5e-13	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, gDNA
• MMRRC Submission: 010473-UCD
• Last Updated: 2017-06-14 10:36 AM by Katherine Timer
• Record Created: unknown
• Record Posted: 2007-11-30
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Zhengfan Jiang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010851; MGI: 108005

Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(3) Chemically induced(2) 

Phenotypic Description

Figure 1. Peritoneal macrophages from lackadaisical (Lkd) mice treated with the TLR7 ligand resiquimod (A) and the TLR9 ligand CpG (B) produce reduced amounts of TNF when stimulated with low concentrations of ligand. Macrophages from Myd88 knockout mice are used as controls. Values represent mean ± SEM (n=6 mice or more). (C) Macrophages from WT or Lkd mice pretreated with IFN-γ (10 units/ml) then treated with TLR ligands and assayed from type I IFN. Lkd macrophages do not respond to resiquidmod or CpG, which signal through MyD88. Similar results were observed in three independent experiments. Figure reproduced from reference (1).

The lackadaisical phenotype was identified in a screen for ENU-induced mutants with altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1).  Peritoneal macrophages from lackadaisical mice produce reduced amounts of tumor necrosis factor (TNF)-α in response to resiquimod (TLR7 ligand) and unmethylated CpG oligodeoxynucleotides (CpG ODN, TLR9 ligand).  The dose response curve ([TNF-α] versus [ligand]) for both ligands is shifted to the right, such that lackadaisical cells produce approximately the same amount of TNF-α as wild type cells when stimulated with a 10X higher ligand concentration (Figure 1). Lackadaisical macrophages display normal TNF-α responses to poly I:C (TLR3 ligand), lipopolysaccharide (LPS, TLR4 ligand), Pam₃CSK₄ (a triacyl lipopeptide, TLR2/1 ligand), and MALP-2 (a diacyl lipopeptide, TLR2/6 ligand).  Type I interferon production induced by either CpG ODN or resiquimod is abolished in lackadaisical macrophages (Figure 1).

 

Phosphorylation of JNK, the MAP kinase ERK, and IκB is eliminated in lackadaisical macrophages upon resiquimod stimulation.

 

When infected intraperitoneally with 5 x 10⁵ pfu of mouse cytomegalovirus, lackadaisical mice contain the virus as efficiently as wild type mice (MCMV Susceptibility and Resistance Screen), as measured by viral titers in the spleen and type I IFN concentration in serum.

Nature of Mutation

The lackadaisical mutation was mapped to a region of Chromosome 9 including Myd88.  Sequencing identified an A to G transition in exon 2 (of 6 total exons) at position 428 of the Myd88 transcript.  The lackadaisical locus was confirmed to be allelic with Myd88.

 

412 GAGGACTGCCAGAAATACTTAGGTAAGCAGCAG

111 -E--D--C--Q--K--Y--L--G--K--Q--Q-

 

The mutated nucleotide is indicated in red lettering, and results in a tyrosine to cysteine change at position 116 of the MyD88 protein.

Protein Prediction

Figure 2. MyD88 is a 296 amino acid protein adapter. It contains an N-terminal death domain (DD) that acts as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins. The C-terminal portion of MyD88 contains a Toll/IL-1 receptor (TIR) domain, a conserved region which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain three conserved boxes (boxes 1, 2 and 3), which are required for signaling. Between the death domain and TIR domain is an “intermediate domain” that may be required for differential activation of distinct NF-κB- versus JNK-dependent transcriptional programs. The lackadaisical mutation results in the substitution of tyrosine with cysteine at residue 115.This image is interactive. Click on the image to view other mutations found in MyD88 (red). Click on the mutations for more specific information.

The lackadaisical mutation results in the substitution of tyrosine with cysteine at residue 115 of MyD88, which exists in the intermediate domain between the death domain and the TIR domain (Figure 2).

 

Please see the record for pococurante for information about Myd88.

Putative Mechanism

Figure 3. MyD88 signaling pathways. MyD88 is a protein adapter that relays signals from the IL-1 and IL-8 receptors (not shown) and from most TLRs. Activation of these receptors leads to MyD88 recruitment to the receptor complexes, where it recruits IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6. The signaling pathway culminates in the activation of NF-κB-dependent transcription. MyD88 and TRAF6 may interact directly with IRF5 in a complex, activating IRF5 and promoting its translocation to the nucleus. MyD88, together with TRAF6 and IRAK4, has also been shown to bind IRF7 directly. This occurs downstream of TLR7, TLR8 and TLR9 in plasmacytoid dendritic cells and requires the phosphorylation of IRF7 by IRAK1.

The lackadaisical mutation changes a single residue in the intermediate domain of MyD88.  Alternative splicing of Myd88 results in a variant that lacks the intermediate domain (MyD88_s), which is expressed only in the spleen and brain (2). When overexpressed in HEK293 cells, MyD88_s is able to bind IRAK, but does not activate NF-κB (a hallmark of MyD88 signaling)(Figure 3), reportedly because MyD88_s is unable to induce IRAK phosphorylation (2). The MyD88 intermediate domain has been suggested to provide for differential activation of distinct (NF-κB- versus JNK-dependent) transcriptional programs (3). MyD88_s has been postulated to act as a negative regulator of MyD88-dependent NF-κB activation (3).  MyD88_s expression is not detected in several cell lines of different origin, but may be induced after prolonged (16 hours) LPS treatment in a human monocytic cell line (2).  The protein encoded by Myd88^lck does not act as a dominant negative inhibitor of LPS-induced (or other ligand-induced) NF-κB activation, and therefore probably does not function like MyD88_s.  However, the lackadaisical phenotype supports the hypothesis that the intermediate domain is important for MyD88 function.  It appears that the lackadaisical mutation is a relatively mild loss-of-function mutation, since TLR signaling is retained at least partially (for TLRs 7 and 9), and in most cases completely (TLRs 3, 4, 2/1, 2/6), in these mutants.  In support of this conclusion, lackadaisical mice display robust resistance to MCMV infection.  On the other hand, complete loss of TLR9 function (e.g., in mice homozygous for the CpG1 allele) causes substantial impairment of MCMV resistance, despite retention of normal TLR7 signaling. The lackadaisical phenotype, as well as other studies, suggest that MyD88 is recruited to TLRs in a ligand-specific manner (1;4).  Distinct ligands likely bind distinct sites in TLR ectodomains (5), inducing unique receptor conformations intracellularly that may be recognized differentially by adapters.

Primers

Primers cannot be located by automatic search.

Genotyping

Lackadaisical genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

1) lackadaisical(F): 5’- GCAGTCAGTGCTCTTACCGGCTGAG -3’

2) lackadaisical(R): 5’- AATGAGCAGCTTGCCCAAGGTCCC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:20

4) 68°C             1:00

5) repeat steps (2-4) 34X

6) 68°C             5:00

7) 4°C               ∞

 

Primers for sequencing

2) lackadaisical_seq(F): 5’- TCTTACCGGCTGAGCCATCTC -3’

1) lackadaisical_seq(R): 5’- AAGGTCCCAGGTCCATCCATC -3’

 

The following sequence of 426 nucleotides (from Genbank genomic region NC_000075 for linear genomic DNA sequence of Myd88) is amplified:

 

1165                           gcagtc agtgctctta ccggctgagc catctcgcca

1201 gccccaagta ggctctttaa actaattcag gattttgagt gtgtgtacag cagcaacctg

1261 gggcatgggg ggcgggggtg tcggggatgg ggtgggagga ggagcctcta cacccttctc

1321 ttctccacag aggaggactg ccagaaatac ttaggtaagc agcagaacca ggagtccgag

1381 aagcctttac aggtggccag agtggaaagc agtgtcccac aaacaaagga actgggaggc

1441 atcaccaccc ttgatgaccc cctaggtaag ggcccagtac tgtgccccta ggtagaatag

1501 gtgggccaca gcctcaaaca tgtgacctgc agagggcatg gataccggaa gcagatggat

1561 ggacctggga ccttgggcaa gctgctcatt

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.

References

   1.  Jiang, Z., Georgel, P., Li, C., Choe, J., Crozat, K., Rutschmann, S., Du, X., Bigby, T., Mudd, S., Sovath, S., Wilson, I. A., Olson, A., and Beutler, B. (2006) Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis, Proc Natl Acad Sci U S A 103, 10961-10966.

   2.  Janssens, S., Burns, K., Tschopp, J., and Beyaert, R. (2002) Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88, Curr. Biol. 12, 467-471.

   3.  Burns, K., Janssens, S., Brissoni, B., Olivos, N., Beyaert, R., and Tschopp, J. (2003) Inhibition of interleukin 1 receptor/Toll-like receptor signaling through the alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4, J. Exp. Med. 197, 263-268.

  4.  Toshchakov, V. U., Basu, S., Fenton, M. J., and Vogel, S. N. (2005) Differential involvement of BB loops of toll-IL-1 resistance (TIR) domain-containing adapter proteins in TLR4- versus TLR2-mediated signal transduction, J. Immunol. 175, 494-500.

  5.  Meng, G., Grabiec, A., Vallon, M., Ebe, B., Hampel, S., Bessler, W., Wagner, H., and Kirschning, C. J. (2003) Cellular recognition of tri-/di-palmitoylated peptides is independent from a domain encompassing the N-terminal seven leucine-rich repeat (LRR)/LRR-like motifs of TLR2, J. Biol. Chem. 278, 39822-39829.