Phenotypic Mutation 'wanna2' (pdf version)
Allelewanna2
Mutation Type missense
Chromosome1
Coordinate36,781,412 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Zap70
Gene Name zeta-chain (TCR) associated protein kinase
Synonym(s) ZAP-70, TZK, Srk
Chromosomal Location 36,761,798-36,782,818 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009539; MGI: 99613

Mapped Yes 
Limits of the Critical Region 36761861 - 36782816 bp
Amino Acid Change Cysteine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000027291]
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: C563R

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000027291)
Phenotypic Category
Phenotypequestion? Literature verified References
30 min GTT hypoglycemic
dsDNA induced type I IFN production - increased
FACS B:T cells - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS T cells - decreased
impaired response to dsDNA- type I IFN production by macrophages
T-dependent humoral response defect- decreased antibody response to rSFV
T-dependent humoral response defect- increased antibody response to OVA+ alum immunization
TLR signaling defect: hypersensitivity to LPS
TLR signaling defect: hypersensitivity to PAM3CSK4
TLR signaling defect: hypersensitivity to R848
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All mutations/alleles(20) : Chemically induced (ENU)(6) Gene trapped(1) Spontaneous(2) Targeted(10) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense possibly damaging 0.95
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 splice site probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.01
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038234-MU
Last Updated 2017-08-08 8:10 PM by Diantha La Vine
Record Created 2015-09-18 10:31 PM by Jin Huk Choi
Record Posted 2015-10-09
Phenotypic Description

Figure 1. Homozygous wanna2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The wanna2 phenotype was identified among G3 mice of the pedigree R3689, one of which showed a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the diminished T-dependent antibody response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R3689.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. The diminished T-dependent antibody response to rSFV-β-gal phenotype was linked by continuous variable mapping to a mutation in Zap70:  a T to C transition at base pair 36,781,412 (v38) on chromosome 1, or base pair 19,615 in the GenBank genomic region NC_000067.  Linkage was found with a recessive model of inheritance (P = 7.764 x 10-6), wherein one variant homozygote departed phenotypically from three homozygous reference mice and 10 heterozygous mice (Figure 2).  

 

The mutation corresponds to residue 1,849 in the mRNA sequence NM_001289766 within exon 12 of 13 total exons.


 

19600 GAATGTCCGCCGGAGTGTCCTCCTGAGATGTAT

558   -E--C--P--P--E--C--P--P--E--M--Y-

 

Genomic numbering corresponds to NC_000067. The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to arginine (R) substitution at residue 563 (C563R) in the ZAP70 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999) (1).

 

Protein Prediction

Figure 3. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The wanna2 mutation causes a cysteine (C) to arginine (R) substitution at amino acid 563 (C563R). The 3D structure is human ZAP70. UCSF Chimera structure based on PDB 2OZO. This image is interactive. Click on the image to view other mutations found in ZAP-70 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

The ζ-associated protein of 70 kDa (ZAP-70) is a protein tyrosine kinase (PTK) that binds to the doubly phosphorylated immunoreceptor tyrosine-based activation motifs (ITAMS) of ζ and CD3ε chains of the T cell receptor (TCR; see the record for tumormouse). ZAP70 consists of two N-terminal Src-homology 2 (SH2) domains at amino acids and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A, while the region between the second SH2 and catalytic domains is known as interdomain B (2). The two SH2 domains of mouse ZAP-70 occur at amino acids 10-102 and 163-254, and work cooperatively to bind to the phosphorylated tyrosines of an ITAM sequence [(D/E)xxYxxI/Lx(6-8)YxxI/L]. The wanna2 mutation results in a cysteine (C) to arginine (R) substitution at 563 within the ZAP70 kinase domain (Figure 3).

 

Please see the record for murdock for more information about Zap70.

Putative Mechanism

Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (3;4)]. Syk and ZAP-70 function as critical mediators of pre-TCR and TCR signaling, with ZAP-70 having a predominant role in mature T cells (4;5). Once activated, ZAP-70 and Syk interact with and phosphorylate a number of substrates important for TCR signaling including the adaptor proteins the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (6;7). Once phosphorylated, these two adaptors serve as docking sites and organize a number of effector molecules into the correct spatiotemporal manner to allow the activation of multiple signaling pathways. Zap70 knockout mice display an arrest of T cell development at the DP stage, the second critical checkpoint important during αβ T cell development due to defective TCR-mediated selection and signaling at this stage (5;8). Although ZAP-70 has a critical role in T cell development and function, it also plays a role downstream of the BCR and in NK cells. Zap70 knockout mice display normal B cell development, mount normal antibody responses and also proliferate appropriately to various stimuli (9)

 

The wanna2 mice exhibit a similar phenotype to the wanna mice, which exhibit an ENU-induced mutation in Zap70. The phenotype of the wanna2 mouse provides in vivo confirmation that Cys 563 is important for ZAP70 function.

Primers PCR Primer
wanna2(F):5'- CCTTCTCCTATGGCCAGAAG -3'
wanna2(R):5'- TGTTGGGAAGCCAAGCACAG -3'

Sequencing Primer
wanna2_seq(F):5'- GCCAGAAGCCCTACAAGGTAG -3'
wanna2_seq(R):5'- AAGAAGCCGGGTGTGACTCTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJin Huk Choi, James Butler, Bruce Beutler