Phenotypic Mutation 'invisible' (pdf version)
Allele | invisible |
Mutation Type |
splice site
(4 bp from exon)
|
Chromosome | 7 |
Coordinate | 127,669,875 bp (GRCm39) |
Base Change | A ⇒ G (forward strand) |
Gene |
Itgam
|
Gene Name | integrin alpha M |
Synonym(s) | Mac-1, complement receptor type 3, Ly-40, Mac-1 alpha, CD11B (p170), Cd11b, Mac-1a, CD11b/CD18, complement component receptor 3 alpha, F730045J24Rik, CR3 |
Chromosomal Location |
127,661,812-127,717,663 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009] PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_001082960 (variant 1), NM_008401; MGI:96607 |
Mapped | Yes |
Amino Acid Change |
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000068468 †]
[ENSMUSP00000101847 †]
[ENSMUSP00000101849 †]
[ENSMUSP00000113957 †]
[ENSMUSP00000121676 †]
† probably from a misspliced transcript
|
AlphaFold |
no structure available at present |
SMART Domains |
Protein: ENSMUSP00000068468 Gene: ENSMUSG00000030786
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
Int_alpha
|
30 |
80 |
8.11e0 |
SMART |
VWA
|
148 |
333 |
2.63e-49 |
SMART |
Int_alpha
|
400 |
449 |
1.07e1 |
SMART |
Int_alpha
|
453 |
510 |
1.48e-7 |
SMART |
Int_alpha
|
516 |
572 |
4.9e-13 |
SMART |
Int_alpha
|
579 |
633 |
3.67e-3 |
SMART |
low complexity region
|
849 |
855 |
N/A |
INTRINSIC |
Pfam:Integrin_alpha
|
1130 |
1144 |
2.1e-7 |
PFAM |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000068468 Gene: ENSMUSG00000030786
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
Int_alpha
|
30 |
80 |
8.11e0 |
SMART |
VWA
|
148 |
333 |
2.63e-49 |
SMART |
Int_alpha
|
400 |
449 |
1.07e1 |
SMART |
Int_alpha
|
453 |
510 |
1.48e-7 |
SMART |
Int_alpha
|
516 |
572 |
4.9e-13 |
SMART |
Int_alpha
|
579 |
633 |
3.67e-3 |
SMART |
low complexity region
|
849 |
855 |
N/A |
INTRINSIC |
Pfam:Integrin_alpha
|
1130 |
1144 |
2.1e-7 |
PFAM |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000101847 Gene: ENSMUSG00000030786
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
Int_alpha
|
30 |
80 |
8.11e0 |
SMART |
VWA
|
148 |
333 |
2.63e-49 |
SMART |
Int_alpha
|
400 |
449 |
1.07e1 |
SMART |
Int_alpha
|
462 |
516 |
3.67e-3 |
SMART |
low complexity region
|
732 |
738 |
N/A |
INTRINSIC |
Pfam:Integrin_alpha
|
1013 |
1027 |
3.9e-9 |
PFAM |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000101849 Gene: ENSMUSG00000030786
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
Int_alpha
|
30 |
80 |
8.11e0 |
SMART |
VWA
|
148 |
333 |
2.63e-49 |
SMART |
Int_alpha
|
400 |
449 |
1.07e1 |
SMART |
Int_alpha
|
453 |
511 |
5.91e-7 |
SMART |
Int_alpha
|
517 |
573 |
4.9e-13 |
SMART |
Int_alpha
|
580 |
634 |
3.67e-3 |
SMART |
low complexity region
|
850 |
856 |
N/A |
INTRINSIC |
Pfam:Integrin_alpha
|
1131 |
1145 |
8.4e-8 |
PFAM |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000113412 Gene: ENSMUSG00000030786
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
PDB:3K72|C
|
17 |
79 |
2e-17 |
PDB |
SCOP:d1m1xa4
|
17 |
81 |
6e-18 |
SMART |
Blast:Int_alpha
|
30 |
79 |
5e-29 |
BLAST |
|
Predicted Effect |
noncoding transcript
|
SMART Domains |
Protein: ENSMUSP00000113957 Gene: ENSMUSG00000030786
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
Int_alpha
|
30 |
80 |
8.11e0 |
SMART |
VWA
|
148 |
333 |
2.63e-49 |
SMART |
Int_alpha
|
400 |
449 |
1.07e1 |
SMART |
Int_alpha
|
453 |
511 |
5.91e-7 |
SMART |
Int_alpha
|
517 |
573 |
4.9e-13 |
SMART |
Int_alpha
|
580 |
634 |
3.67e-3 |
SMART |
low complexity region
|
850 |
856 |
N/A |
INTRINSIC |
low complexity region
|
1141 |
1150 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000113957 Gene: ENSMUSG00000030786
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
Int_alpha
|
30 |
80 |
8.11e0 |
SMART |
VWA
|
148 |
333 |
2.63e-49 |
SMART |
Int_alpha
|
400 |
449 |
1.07e1 |
SMART |
Int_alpha
|
453 |
511 |
5.91e-7 |
SMART |
Int_alpha
|
517 |
573 |
4.9e-13 |
SMART |
Int_alpha
|
580 |
634 |
3.67e-3 |
SMART |
low complexity region
|
850 |
856 |
N/A |
INTRINSIC |
low complexity region
|
1141 |
1150 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably null
|
SMART Domains |
Protein: ENSMUSP00000121676 Gene: ENSMUSG00000030786
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
PDB:3K72|C
|
17 |
79 |
2e-17 |
PDB |
SCOP:d1m1xa4
|
17 |
81 |
9e-18 |
SMART |
Blast:Int_alpha
|
30 |
79 |
3e-29 |
BLAST |
|
Predicted Effect |
probably benign
|
Meta Mutation Damage Score |
0.9755 |
Is this an essential gene? |
Probably nonessential (E-score: 0.114) |
Phenotypic Category |
Autosomal Recessive |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All mutations/alleles(5) : Gene trapped(1) Targeted(4) |
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00324:Itgam
|
APN |
7 |
127684833 |
missense |
probably damaging |
1.00 |
IGL00983:Itgam
|
APN |
7 |
127667839 |
missense |
probably damaging |
0.97 |
IGL01102:Itgam
|
APN |
7 |
127679445 |
missense |
possibly damaging |
0.94 |
IGL01615:Itgam
|
APN |
7 |
127715939 |
missense |
possibly damaging |
0.80 |
IGL01845:Itgam
|
APN |
7 |
127711644 |
missense |
probably damaging |
1.00 |
IGL01860:Itgam
|
APN |
7 |
127670115 |
missense |
probably benign |
0.03 |
IGL01874:Itgam
|
APN |
7 |
127714338 |
missense |
probably damaging |
0.97 |
IGL01910:Itgam
|
APN |
7 |
127682948 |
missense |
probably damaging |
1.00 |
IGL01994:Itgam
|
APN |
7 |
127700899 |
missense |
probably damaging |
0.97 |
IGL02332:Itgam
|
APN |
7 |
127684846 |
critical splice donor site |
probably null |
|
IGL02348:Itgam
|
APN |
7 |
127715472 |
missense |
possibly damaging |
0.52 |
IGL02394:Itgam
|
APN |
7 |
127684114 |
missense |
probably benign |
0.01 |
IGL02491:Itgam
|
APN |
7 |
127715190 |
missense |
possibly damaging |
0.71 |
IGL02695:Itgam
|
APN |
7 |
127685113 |
missense |
possibly damaging |
0.81 |
IGL02821:Itgam
|
APN |
7 |
127675281 |
missense |
probably damaging |
0.99 |
IGL02970:Itgam
|
APN |
7 |
127685215 |
missense |
probably benign |
0.00 |
IGL03145:Itgam
|
APN |
7 |
127712191 |
missense |
probably benign |
0.12 |
adhesion
|
UTSW |
7 |
127700709 |
missense |
probably damaging |
0.99 |
apparition
|
UTSW |
7 |
127711458 |
splice site |
probably null |
|
attachment
|
UTSW |
7 |
127712205 |
missense |
probably damaging |
1.00 |
Follower
|
UTSW |
7 |
127679436 |
missense |
probably damaging |
1.00 |
obscured
|
UTSW |
7 |
127680806 |
missense |
probably damaging |
1.00 |
R0184:Itgam
|
UTSW |
7 |
127685230 |
missense |
probably damaging |
0.96 |
R0389:Itgam
|
UTSW |
7 |
127680806 |
missense |
probably damaging |
1.00 |
R0443:Itgam
|
UTSW |
7 |
127680806 |
missense |
probably damaging |
1.00 |
R0454:Itgam
|
UTSW |
7 |
127707152 |
missense |
probably benign |
0.01 |
R0674:Itgam
|
UTSW |
7 |
127715390 |
missense |
possibly damaging |
0.67 |
R0828:Itgam
|
UTSW |
7 |
127715677 |
critical splice donor site |
probably null |
|
R0925:Itgam
|
UTSW |
7 |
127711410 |
missense |
probably benign |
0.00 |
R1086:Itgam
|
UTSW |
7 |
127679436 |
missense |
probably damaging |
1.00 |
R1655:Itgam
|
UTSW |
7 |
127714335 |
missense |
probably benign |
0.00 |
R1809:Itgam
|
UTSW |
7 |
127670109 |
missense |
possibly damaging |
0.62 |
R1823:Itgam
|
UTSW |
7 |
127663904 |
missense |
probably benign |
0.04 |
R2105:Itgam
|
UTSW |
7 |
127680884 |
missense |
probably damaging |
1.00 |
R2154:Itgam
|
UTSW |
7 |
127684749 |
missense |
probably damaging |
0.99 |
R2656:Itgam
|
UTSW |
7 |
127715987 |
missense |
probably null |
1.00 |
R2913:Itgam
|
UTSW |
7 |
127711578 |
missense |
probably damaging |
1.00 |
R3116:Itgam
|
UTSW |
7 |
127715201 |
missense |
probably damaging |
1.00 |
R3404:Itgam
|
UTSW |
7 |
127669875 |
splice site |
probably null |
|
R3821:Itgam
|
UTSW |
7 |
127711458 |
splice site |
probably null |
|
R3822:Itgam
|
UTSW |
7 |
127711458 |
splice site |
probably null |
|
R3960:Itgam
|
UTSW |
7 |
127714347 |
missense |
probably benign |
0.02 |
R3968:Itgam
|
UTSW |
7 |
127712205 |
missense |
probably damaging |
1.00 |
R4192:Itgam
|
UTSW |
7 |
127663904 |
missense |
probably benign |
0.21 |
R4400:Itgam
|
UTSW |
7 |
127680830 |
missense |
probably damaging |
1.00 |
R4708:Itgam
|
UTSW |
7 |
127700709 |
missense |
probably damaging |
0.99 |
R4709:Itgam
|
UTSW |
7 |
127700709 |
missense |
probably damaging |
0.99 |
R4742:Itgam
|
UTSW |
7 |
127712245 |
missense |
probably damaging |
1.00 |
R4790:Itgam
|
UTSW |
7 |
127715445 |
missense |
probably benign |
0.01 |
R4960:Itgam
|
UTSW |
7 |
127715012 |
missense |
possibly damaging |
0.93 |
R5109:Itgam
|
UTSW |
7 |
127712390 |
missense |
probably benign |
0.06 |
R5190:Itgam
|
UTSW |
7 |
127715489 |
splice site |
probably null |
|
R5379:Itgam
|
UTSW |
7 |
127711560 |
missense |
probably damaging |
1.00 |
R5386:Itgam
|
UTSW |
7 |
127707152 |
missense |
probably benign |
0.00 |
R6104:Itgam
|
UTSW |
7 |
127715474 |
missense |
possibly damaging |
0.85 |
R6122:Itgam
|
UTSW |
7 |
127684824 |
missense |
probably damaging |
0.99 |
R6189:Itgam
|
UTSW |
7 |
127711676 |
missense |
probably benign |
0.04 |
R6282:Itgam
|
UTSW |
7 |
127684114 |
missense |
probably benign |
0.01 |
R6545:Itgam
|
UTSW |
7 |
127707044 |
missense |
probably damaging |
1.00 |
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | |
MMRRC Submission |
038236-MU
|
Last Updated |
2019-02-01 12:52 PM
by Diantha La Vine
|
Record Created |
2015-10-03 2:54 PM
by Bruce Beutler
|
Record Posted |
2016-10-27 |
Phenotypic Description |
The invisible phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3404, some of which showed a reduced frequency of CD11b+ dendritic cells (DCs) gated in CD11c+ cells (Figure 1), an increased frequency of CD8a+ DCs gated in CD11c+ cells (Figure 2), an increased frequency of plasmacytoid DCs (pDCs) (Figure 3), a reduced frequency of macrophages (Figure 4), and a reduced frequency of neutrophils (Figure 5), all in the peripheral blood. |
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Itgam: an A to G transition at base pair 128,070,703 (v38) on chromosome 7, or base pair 8,064 in the GenBank genomic region NC_000073, within the donor splice site of intron 4 (four base pairs from exon 4). The strongest association was found with a recessive model of linkage to the normalized frequency of CD11b+ DCs, wherein five variant homozygotes departed phenotypically from nine homozygous reference mice and 18 heterozygous mice with a P value of 8.807 x 10-31 (Figure 6). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 71-base pair exon 4 (out of 30 total exons), resulting in a frame-shift after amino acid 79 and coding of 46 aberrant amino acids followed by a premature stop codon within exon 6 (after amino acid 125).
<--exon 3 <--exon 4 intron 4--> exon 5-->
6042 ……CCCATCCCCCTGCAAG ……CCCCAGCAGCTGCTG gtgagttgccctccaaa…… GCCTGTGGCCC……GCAGGAGAGTGA…… 13414
75 ……-P--I--P--L--Q-- ……-P--Q--Q--L--L- G--L--W--P-……-A--G--E--* 125
correct deleted aberrant
|
Genomic numbering corresponds to NC_000073. The donor splice site of intron 4, which is destroyed by the invisible mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. |
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Itgam encodes CD11b, a surface marker on myeloid dendritic cells that regulates leukocyte adhesion and migration as well as phagocytosis and cytotoxicity. CD11b is an integrin α protein that forms a noncovalently linked dimer with the integrin β2 protein (also called CD18; see the record for Joker) to form functional integrin receptors. CD11b is a single-pass transmembrane domain with an extracellular N-terminus (amino acids 17-1105) and a cytoplasmic C-terminus (amino acids 1130-1153) (Figure 7) (1). Amino acids 1-16 comprise a signal peptide. Electron microscopy determined that the integrin receptor extracellular domain is a globular ligand-binding headpiece connected to two long stalk regions, which is then connected to the transmembrane and C-terminal cytoplasmic domains. Electron microscopic studies, crystallographic and NMR analyses strongly suggest that integrin ectodomains exist in a bent conformation in the latent, low-affinity state (Figure 8; PDB 1JV2) (2-4). Destabilization of the interface between the α and β legs in the tailpiece leads to destabilization of the bent conformation and “switchblade-like” opening of the structure to an open high-affinity conformation where ligand may bind. On the cell surface, integrins equilibrate between the low- and high-affinity state, an equilibrium which may be shifted by the presence of intracellular activators or extracellular ligands (4). The extracellular domain of CD11b has several subdomains, including seven β-propeller repeats that form a β-propeller fold, and a Von Willebrand factor (alternatively integrin I-domain; amino acids 148-333) domain. The I-domain serves as a binding site for several of the CD11b ligands (5) (see the Background section). It has six major α helices and a β sheet composed of five parallel and one anti-parallel β strand. There is a large interface between the β-propeller domain of the integrin α subunit (containing the I domain) and the I-like domain of the integrin β subunit (2). Evidence suggests that the I-like domain regulates the conformation of the I domain when both are present in the integrin (6). Ligand binding depends on the integrity of the metal ion-dependent adhesion site (MIDAS) in both the I and I-like domains. The MIDAS binds to divalent cations and coordinates with a glutamine or aspartate residue in the ligand. Please refer to reference (5) for an excellent review of integrin receptor extracellular domains and structure. CD11b undergoes several posttranslational modifications. Three regions of CD11b mediate calcium binding: amino acids 465-473, 529-537, and 592-600. There are 19 putative N-glycosylation sites within the extracellular domain. Phosphorylation of Ser1126 in the cytoplasmic domain regulates CD11b activation (7). Mutation of Ser1126 prevents the activation of CD11b upon binding to its ligands ICAM-1 and ICAM-2; activation of CD11b by another ligand, iC3b, was not affected. The extracellular domain of CD11b is cleaved by serine proteases including elastase, proteinase-3, and cathepsin G, which mediates neutrophil detachment from the surface of epithelial monolayers before neutrophil transmigration (8). The cleavage site for elastase/proteinase-3 is 761Thr-Ala762, while the cathepsin G cleavage site is 760Phe-Thr761 (8). The mutation in invisible putatively results in a in a frame-shift and coding of a premature stop codon within exon 6 (corresponding to amino acid 125). Amino acid 125 is within the CD11b extracellular domain within an undefined region between the first β-propeller repeat and the I domain. |
Expression/Localization | CD11b/CD18 is expressed on macrophages, neutrophils, dendritic cells (DCs), peritoneal cavity mast cells, and peritoneal cavity B1 cells (9;10). However, almost half of the cells in the B1a or B1b subset do not express CD11b. CD11b expression is upregulated during myelomonocytic cell line differentiation and maturation (1). However, blood monocyte differentiation into macrophages results in downregulation of CD11b on the cell surface (11). CD11b expression is upregulated on NK cells upon NK cell maturation and activation (12). CD11b expression on the surface of neutrophils and monocytes is upregulated by inflammatory stimuli. |
Background |
Integrins are adhesion molecules that mediate cell-cell, cell-extracellular matrix, and cell-pathogen interactions. They regulate cell migration and morphogenesis by coordinating regulatory signals from inside and outside the cell, with the physical machinery for cell movement. Most integrins, including β2-integrins, link to and regulate the actin cytoskeleton. Their ligands are diverse, but most possess a short peptide motif containing an acidic residue (aspartate or glutamate) positioned in a flexible loop. There are 24 distinct integrins formed by a combination of α and β subunits, and those containing the β2 subunit are leukocyte-specific [reviewed in (13)]. Each leukocyte class expresses a distinct pattern of integrins that changes in functional state, density and localization in response to intra- and extracellular cues, including protein modifications (e.g. phosphorylation), cytokines, chemokines, and other cell adhesion molecules. However, all leukocytes express one or more β2-containing integrin. The β2-containing integrins are αLβ2 (CD11a/CD18; also called leukocyte function-associated antigen 1, LFA-1), αMβ2 (CD11b/CD18; also called MAC-1 or complement receptor 3 [CR3]), αXβ2 (CD11c/CD18; also called p150,95 or CR4) and αDβ2 (CD11d/CD18). The CD11/CD18 integrins are referenced collectively as the “leukocyte” integrins, and mediate leukocyte adhesion during inflammatory responses to infections and also during wound repair. Leukocytes circulate in the blood in a quiescent state of low adhesiveness, becoming activated and migrating into tissues during microbial invasion in order to defend against infection. The β2-containing integrins are thus inactive when leukocytes are in a resting state, and must be rapidly activated during infection to mediate leukocyte adhesion to various cell types such as endothelial cells of vessel walls and antigen-presenting cells. Integrins transmit signals bidirectionally across the plasma membrane. “Outside-in” signaling occurs when ligands bind to integrins, and serves to mediate adhesion and to initiate downstream signaling (Figure 9). Ligand binding induces the clustering of integrins on the cell surface and enables the recruitment of signaling molecules to the cytoplasmic face of the receptor. “Inside-out” signaling primes integrins for ligand binding. The adhesive state of integrins may be modulated by conformational changes in the integrin itself, or possibly by clustering of integrins on the cell surface to increase avidity (5). The intracellular domain of the β2 chain has been shown to influence integrin adhesive activity in the case of LFA-1 (14;15). How this process is regulated is largely unknown, but Rho family GTPases and the cytoskeletal protein talin have been shown to play a role. Knockdown of the leukocyte-specific inhibitory RhoH in peripheral blood lymphocytes results in a constitutively adherent phenotype towards ICAM-1, demonstrating that RhoH promotes the nonadhesive state of LFA-1 (integrin αLβ2) (16). Conversely, knockdown of talin impairs TCR-induced adhesion to ICAM-1 (17). Another Rho GTPase, RhoA, promotes neutrophil adhesion through β2 integrin (18). Dendritic cells sense and subsequently present antigens to T cells to induce an antigen-specific immune response. DCs resident in lymphoid tissue are termed conventional DCs (cDCs), which can be subdivided into two subsets, CD8α+ DCs and CD4+CD11b+ DCs. Migratory DCs express the integrins CD103 or CD11b, except in the lamina propria where DCs can co-express both CD103 and CD11b (19;20). CD11b+ DCs have several known functions. For example, splenic CD11b+ DCs induce CD4+ T cell proliferation (21). Dermal CD11b+ DCs are essential for the induction of efficient CD8+ memory T cell responses (22). Lung CD11b+ DCs induce Th2 responses in response to house dust mite, a model of allergic inflammation (23). After Aspergillus fumigatus infection, lung CD11b+ DCs stimulate T helper 17 (Th17) immunity through the release of IL-23 (24). Intestinal CD11b+ DCs also control Th17 immunity. Intestinal CD11b+ DCs are separated into two subsets according to the expression of CD103. CD11b+CD103+ DCs regulate intestinal homeostasis and also are the major producers of Th17-inducing cytokines after Citrobacter rodentium infection or after exposure to TLR5 ligand (25-26). CD11b+CD103- DCs are a small population, and migrate to the mesenteric lymph node where they induce IFN-γ/IL-17-secreting CD4+ T-cells (27). The CD11b/CD18 integrin has several functions; the ligands that mediate these functions are summarized in Table 1:
-
CD11b/CD18 inhibits DC maturation and function as well as DC-induced T cell activation (28;29).
-
CD11b/CD18 mediates the phagocytosis of iC3b-coated particles (e.g., apoptotic cells) (30).
-
CD11b/CD18 mediates chemotaxis by binding ICAM ligands on blood vessel endothelium (7;31).
-
is required for monocyte activation through the stimulation of several signaling pathways including the NF-κB (see the record for Finlay) and the TNF (see the record for Panr1) pathways resulting in the subsequent induction of cytokines, chemokines, and transcription factors (32).
-
promotes osteoclast differentiation in the bone marrow and circulation upon RANKL induction (33).
-
CD11b/CD18 functions in the development of antigen-induced immune tolerance partly through the suppression of Th17 differentiation (34). In Itgam-deficient ( Itgam-/-) mice, increased IL-6 production of antigen presenting cells promoted the preferential differentiation of naïve T cells to Th17 cells. Immunization of the Itgam-/- mice resulted in IL-17 production within the lymph nodes, which interfered with the establishment of oral tolerance.
-
CD11b/CD18 recognizes extracellular dsRNA to induce macrophage immune responses (35). In peritoneal macrophages and serum, Itgam deficiency led to diminished poly(I:C)-induced inflammatory cytokine induction. CD11b interacts with poly(I:C) on the macrophage surface. Upon recognition of dsRNA by CD11b/CD18, the poly(I:C) is internalized through PI3K signaling induction and -associated activation of interferon regulatory factor 3 (IRF3) in macrophages. In addition, poly(I:C) induced NADPH oxidase (NOX2) activation in a TLR3-independent, CD11b/CD18-dependent manner. The NOX2-derived reactive oxygen species subsequently activated MAPK
-
CD11b/CD18 mediates the efflux of activated macrophages to the lymphatics and is proposed to assist in the removal of local inflammatory macrophages and in their subsequent migration to the lymph nodes or back to the circulation (36). CD11b/CD18 is not required for early monocyte accumulation or the reduction within the peritoneum. However, CD11b/CD18 is required for the accelerated migration of activated macrophages from the peritoneum to the lymphatics.
-
Nearly half of B1a and B1b cells in the peritoneal cavity express CD11b (10). The CD11b + B1 cells are larger and more granular than B1 cells that do not express Cd11b (often referred to B1c cells (37)). In addition, the CD11b + B1 cells express more surface IgM and less surface IgD than the CD11b - B1 cells. The CD11b + B1 cells form tightly associated doublets, which are observed at a high frequency in the peritoneal cavity; the function of the doublets is unknown. The CD11b + B1 cells had a limited reconstitution capability.
-
CD11b negatively regulates NK cell activation. Treatment with an anti-CD11b antibody increased NK cell cytotoxicity and interferon-γ (IFN-γ) and granzyme B production (12). Itgam-deficient NK cells stimulated with poly(I:C) showed more potent cytotoxicity, and higher production of IFN-γ and granzyme B.
-
CD11b/CD18 restricts TLR signaling in macrophages through the Src/Syk (see the record for poppy) signaling pathway and subsequently leads to the degradation of MyD88 (see the record for pococurante) and TRIF (see the record for Lps2) (38). CD11b/CD18 reduces macrophage responses by inducing signaling inhibitors such as suppressor of cytokine signaling 3 (SOCS3) and A20 as well as IL-10 (39).
Table 1. CD11b/CD18 (αMβ2, MAC-1) ligands
Ligand
|
Brief Description
|
Effect
|
References
|
ICAM-1
|
Ig superfamily cell adhesion molecule
|
Leukocyte adhesion and emigration
|
(40;41)
|
ICAM-2
|
(42)
|
ICAM-4
|
(43)
|
iC3b
|
Complement fragment
|
Cell adhesion and phagocytosis
|
(44)
|
Fibrinogen
|
Provisional matrix molecule; blood coagulation protein
|
Binding of polymorphonuclear leukocytes to fibrinogen-coated surfaces
|
(45)
|
Heparin
|
Clotting factor
|
Mediates firm adhesions between neutrophils and E-selectin
|
(46)
|
Low-density lipoprotein receptor related protein (LRP)
|
Cell surface receptor (see the record for r18)
|
Mediates leukocyte adhesion
|
(47)
|
Matrix metalloproteinase 9 (MMP9)
|
Membrane-type metalloproteinase
|
Regulates cell motility
|
(48)
|
Factor X
|
Clotting factor
|
Stimulates rapid fibrin formation
|
(49)
|
CD40L/CD40
|
See the record for walla; provides costimulatory, activating signals to antigen presenting cells (APCs) such as B cells, macrophages, and dendritic cells (DCs)
|
Mediates leukocyte recruitment
|
(50)
|
Neutrophils from Itgam-deficient (Itgam-/-) mice exhibit defective adherence to fibrinogen, iC3b-mediated phagocytosis, and homotypic aggregation as well as reduced degranulation (51;52). Neutrophil accumulation in the peritoneal cavity of thioglycolate challenged Itgam-/- mice was normal (52). Blood leukocyte and peripheral blood neutrophil counts in the Itgam-/- mice were comparable to that in wild-type mice (51). The ability of neutrophils to roll as well as the velocity of rolling cells was normal in the Itgam-/- mice (51). Intraperitoneal injection of thioglycollate, an inducer of neutrophil-rich inflammatory exudate, resulted in an accumulation of neutrophils in the peritoneal exudate (51). Apoptosis of the extravasated neutrophils was decreased in the Itgam-/- mice compared to that in wild-type mice (51). In addition, eosinophil accumulation after thioglycolate injection in the Itgam-/- mice was higher than that in wild-type mice. T cells from the Itgam-/- mice exhibited diminished CD3 and CD28 expression and the Itgam-/- mice had a reduced CD4/CD8 ratio due to a diminished frequency of CD4+ T cells. Splenocytes from Itgam-/- mice exhibited diminished T cell responses to stimulation with staphylococcal enterotoxin (53). Itgam-/- splenocytes exhibited reduced activation when stimulated with the leptins PHA and Con A. In contrast, when stimulated with PMA-ionomycin, the proliferative response was normal in the Itgam-/- splenocytes compared to that in wild-type mice. After transient focal cerebral ischemia, Itgam-/- mice had a reduction in infarction volume compared to wild-type mice (54). In addition, neutrophil infiltration and cerebral cell death were reduced in the Itgam-/- mice after transient focal cerebral ischemia (54). Itgam-/- mice exhibited delayed wound healing (55). However, macrophage recruitment to the wound site as well as vascularity, collage organization, or polymorphonuclear neutrophil recruitment was not impaired in the Itgam-/- mice. Itgam-/- mice have a reduced frequency of mast cells in the peritoneal cavity, peritoneal wall, and dorsal skin (9). After cecal ligation and puncture, a model of acute septic peritonitis whereby host resistance is mast cell-dependent, Itgam-/- mice exhibit increased mortality compared to wild-type mice (9). Mutations in ITGAM (e.g., rs1143679, R77H) are linked to systemic lupus erythematosus (SLE) (56;57). The R77H variant affects the ability of the integrin to mediate cell adhesion to ligands. The R77H variant also exhibits aberrant phagocytosis. In addition, it does not restrict macrophage inflammatory cytokine (i.e., IL-6) production. The R77H mutation is predicted to cause SLE because of reduced clearance of apoptotic cells, leading to the activation of DCs, inflammatory cytokine production, and the uptake and presentation of nuclear antigens to T cells (58). Humans with absent or reduced levels of integrin β2 on the surface of leukocytes develop leukocyte adhesion deficiency, type I (LAD, OMIM #116920), an autosomal recessive disorder characterized by leukocytosis (especially neutrophilia), failure to recruit leukocytes to sites of infection, recurring bacterial and fungal infections involving the skin and mucosa, impaired wound healing, and lack of pus formation. Patients also show a delayed separation of the umbilical cord at birth. These deficiencies are due to impaired adhesive function and signaling of leukocytes. LAD is associated with the lack of LFA-1, MAC-1, αXβ2, but not αDβ2. The severity of the disease corresponds to the levels of functional β2-containing integrins expressed on the cell surface; most patients with no detectable CD18 expression die within the first 5 years of life unless treated by bone marrow transplantation (59). |
Putative Mechanism | Similar to Itgam-/- mice, the invisible mice did not exhibit overt changes in peripheral blood leukocyte counts. The reduced frequency of CD11b+ DCs is consistent with loss of Itgam expression. |
Primers |
PCR Primer
invisible_pcr_F: CCTGACTGCTTCACAACTCCTCT
invisible_pcr_R: CCGTTCTAAGGGACCTACCTCTG
Sequencing Primer
invisible_seq_F: TCTAACCCCAAGGATCATTG
invisible_seq_R: GGTTGGAGCCGAACAAATAG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 415 nucleotides is amplified (chromosome 7, + strand):
1 cctgactgct tcacaactcc tctaacccca aggatcattg tgcatacatc tgtcttctca 61 gtacctccag aggctgtgaa tatgtccttg ggcctgtccc tggctgtttc tactgtcccc 121 cagcagctgc tggtgagttg ccctccaaag gaagagggtc tcgaggggag agatggaaga 181 gagggagatg ctgggctgga ggtcttgtgg agggtggagg ggttgcaatg ggaggacggg 241 aggcaggggc agccctttga ctcctgcgct gtccctcagg cctgtggccc cacggtgcac 301 caaaactgca aggagaatac ttatgtgaat ggattgtgct atttgttcgg ctccaacctg 361 ctgaggccgc cccagcagtt cccagaggct ctcagaggta ggtcccttag aacgg
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Corbi, A. L., Kishimoto, T. K., Miller, L. J., and Springer, T. A. (1988) The Human Leukocyte Adhesion Glycoprotein Mac-1 (Complement Receptor Type 3, CD11b) Alpha Subunit. Cloning, Primary Structure, and Relation to the Integrins, Von Willebrand Factor and Factor B. J Biol Chem. 263, 12403-12411.
2. Xiong, J. P., Stehle, T., Diefenbach, B., Zhang, R., Dunker, R., Scott, D. L., Joachimiak, A., Goodman, S. L., and Arnaout, M. A. (2001) Crystal Structure of the Extracellular Segment of Integrin Alpha Vbeta3. Science. 294, 339-345.
6. Lu, C., Shimaoka, M., Zang, Q., Takagi, J., and Springer, T. A. (2001) Locking in Alternate Conformations of the Integrin alphaLbeta2 I Domain with Disulfide Bonds Reveals Functional Relationships among Integrin Domains. Proc Natl Acad Sci U S A. 98, 2393-2398.
7. Fagerholm, S. C., Varis, M., Stefanidakis, M., Hilden, T. J., and Gahmberg, C. G. (2006) Alpha-Chain Phosphorylation of the Human Leukocyte CD11b/CD18 (Mac-1) Integrin is Pivotal for Integrin Activation to Bind ICAMs and Leukocyte Extravasation. Blood. 108, 3379-3386.
8. Zen, K., Guo, Y. L., Li, L. M., Bian, Z., Zhang, C. Y., and Liu, Y. (2011) Cleavage of the CD11b Extracellular Domain by the Leukocyte Serprocidins is Critical for Neutrophil Detachment during Chemotaxis. Blood. 117, 4885-4894.
9. Rosenkranz, A. R., Coxon, A., Maurer, M., Gurish, M. F., Austen, K. F., Friend, D. S., Galli, S. J., and Mayadas, T. N. (1998) Impaired Mast Cell Development and Innate Immunity in Mac-1 (CD11b/CD18, CR3)-Deficient Mice. J Immunol. 161, 6463-6467.
10. Ghosn, E. E., Yang, Y., Tung, J., Herzenberg, L. A., and Herzenberg, L. A. (2008) CD11b Expression Distinguishes Sequential Stages of Peritoneal B-1 Development. Proc Natl Acad Sci U S A. 105, 5195-5200.
11. Hogg, N., Takacs, L., Palmer, D. G., Selvendran, Y., and Allen, C. (1986) The p150,95 Molecule is a Marker of Human Mononuclear Phagocytes: Comparison with Expression of Class II Molecules. Eur J Immunol. 16, 240-248.
12. Zhang, M., Han, Y., Han, C., Xu, S., Bao, Y., Chen, Z., Gu, Y., Xia, D., and Cao, X. (2009) The beta2 Integrin CD11b Attenuates Polyinosinic:Polycytidylic Acid-Induced Hepatitis by Negatively Regulating Natural Killer Cell Functions. Hepatology. 50, 1606-1616.
14. Hibbs, M. L., Jakes, S., Stacker, S. A., Wallace, R. W., and Springer, T. A. (1991) The Cytoplasmic Domain of the Integrin Lymphocyte Function-Associated Antigen 1 Beta Subunit: Sites Required for Binding to Intercellular Adhesion Molecule 1 and the Phorbol Ester-Stimulated Phosphorylation Site. J Exp Med. 174, 1227-1238.
16. Cherry, L. K., Li, X., Schwab, P., Lim, B., and Klickstein, L. B. (2004) RhoH is Required to Maintain the Integrin LFA-1 in a Nonadhesive State on Lymphocytes. Nat Immunol. 5, 961-967.
19. Bogunovic, M., Ginhoux, F., Helft, J., Shang, L., Hashimoto, D., Greter, M., Liu, K., Jakubzick, C., Ingersoll, M. A., Leboeuf, M., Stanley, E. R., Nussenzweig, M., Lira, S. A., Randolph, G. J., and Merad, M. (2009) Origin of the Lamina Propria Dendritic Cell Network. Immunity. 31, 513-525.
20. Varol, C., Vallon-Eberhard, A., Elinav, E., Aychek, T., Shapira, Y., Luche, H., Fehling, H. J., Hardt, W. D., Shakhar, G., and Jung, S. (2009) Intestinal Lamina Propria Dendritic Cell Subsets have Different Origin and Functions. Immunity. 31, 502-512.
21. Dudziak, D., Kamphorst, A. O., Heidkamp, G. F., Buchholz, V. R., Trumpfheller, C., Yamazaki, S., Cheong, C., Liu, K., Lee, H. W., Park, C. G., Steinman, R. M., and Nussenzweig, M. C. (2007) Differential Antigen Processing by Dendritic Cell Subsets in Vivo. Science. 315, 107-111.
22. Wakim, L. M., Waithman, J., van Rooijen, N., Heath, W. R., and Carbone, F. R. (2008) Dendritic Cell-Induced Memory T Cell Activation in Nonlymphoid Tissues. Science. 319, 198-202.
23. Plantinga, M., Guilliams, M., Vanheerswynghels, M., Deswarte, K., Branco-Madeira, F., Toussaint, W., Vanhoutte, L., Neyt, K., Killeen, N., Malissen, B., Hammad, H., and Lambrecht, B. N. (2013) Conventional and Monocyte-Derived CD11b(+) Dendritic Cells Initiate and Maintain T Helper 2 Cell-Mediated Immunity to House Dust Mite Allergen. Immunity. 38, 322-335.
24. Schlitzer, A., McGovern, N., Teo, P., Zelante, T., Atarashi, K., Low, D., Ho, A. W., See, P., Shin, A., Wasan, P. S., Hoeffel, G., Malleret, B., Heiseke, A., Chew, S., Jardine, L., Purvis, H. A., Hilkens, C. M., Tam, J., Poidinger, M., Stanley, E. R., Krug, A. B., Renia, L., Sivasankar, B., Ng, L. G., Collin, M., Ricciardi-Castagnoli, P., Honda, K., Haniffa, M., and Ginhoux, F. (2013) IRF4 Transcription Factor-Dependent CD11b+ Dendritic Cells in Human and Mouse Control Mucosal IL-17 Cytokine Responses. Immunity. 38, 970-983.
25. Persson, E. K., Uronen-Hansson, H., Semmrich, M., Rivollier, A., Hagerbrand, K., Marsal, J., Gudjonsson, S., Hakansson, U., Reizis, B., Kotarsky, K., and Agace, W. W. (2013) IRF4 Transcription-Factor-Dependent CD103(+)CD11b(+) Dendritic Cells Drive Mucosal T Helper 17 Cell Differentiation. Immunity. 38, 958-969.
26. Kinnebrew, M. A., Buffie, C. G., Diehl, G. E., Zenewicz, L. A., Leiner, I., Hohl, T. M., Flavell, R. A., Littman, D. R., and Pamer, E. G. (2012) Interleukin 23 Production by Intestinal CD103(+)CD11b(+) Dendritic Cells in Response to Bacterial Flagellin Enhances Mucosal Innate Immune Defense. Immunity. 36, 276-287.
27. Cerovic, V., Houston, S. A., Scott, C. L., Aumeunier, A., Yrlid, U., Mowat, A. M., and Milling, S. W. (2013) Intestinal CD103(-) Dendritic Cells Migrate in Lymph and Prime Effector T Cells. Mucosal Immunol. 6, 104-113.
28. Podgrabinska, S., Kamalu, O., Mayer, L., Shimaoka, M., Snoeck, H., Randolph, G. J., and Skobe, M. (2009) Inflamed Lymphatic Endothelium Suppresses Dendritic Cell Maturation and Function Via Mac-1/ICAM-1-Dependent Mechanism. J Immunol. 183, 1767-1779.
29. Varga, G., Balkow, S., Wild, M. K., Stadtbaeumer, A., Krummen, M., Rothoeft, T., Higuchi, T., Beissert, S., Wethmar, K., Scharffetter-Kochanek, K., Vestweber, D., and Grabbe, S. (2007) Active MAC-1 (CD11b/CD18) on DCs Inhibits Full T-Cell Activation. Blood. 109, 661-669.
30. Morelli, A. E., Larregina, A. T., Shufesky, W. J., Zahorchak, A. F., Logar, A. J., Papworth, G. D., Wang, Z., Watkins, S. C., Falo, L. D.,Jr, and Thomson, A. W. (2003) Internalization of Circulating Apoptotic Cells by Splenic Marginal Zone Dendritic Cells: Dependence on Complement Receptors and Effect on Cytokine Production. Blood. 101, 611-620.
31. Phillipson, M., Heit, B., Colarusso, P., Liu, L., Ballantyne, C. M., and Kubes, P. (2006) Intraluminal Crawling of Neutrophils to Emigration Sites: A Molecularly Distinct Process from Adhesion in the Recruitment Cascade. J Exp Med. 203, 2569-2575.
33. Hayashi, H., Nakahama, K., Sato, T., Tuchiya, T., Asakawa, Y., Maemura, T., Tanaka, M., Morita, M., and Morita, I. (2008) The Role of Mac-1 (CD11b/CD18) in Osteoclast Differentiation Induced by Receptor Activator of Nuclear Factor-kappaB Ligand. FEBS Lett. 582, 3243-3248.
34. Ehirchiou, D., Xiong, Y., Xu, G., Chen, W., Shi, Y., and Zhang, L. (2007) CD11b Facilitates the Development of Peripheral Tolerance by Suppressing Th17 Differentiation. J Exp Med. 204, 1519-1524.
35. Zhou, H., Liao, J., Aloor, J., Nie, H., Wilson, B. C., Fessler, M. B., Gao, H. M., and Hong, J. S. (2013) CD11b/CD18 (Mac-1) is a Novel Surface Receptor for Extracellular Double-Stranded RNA to Mediate Cellular Inflammatory Responses. J Immunol. 190, 115-125.
38. Han, C., Jin, J., Xu, S., Liu, H., Li, N., and Cao, X. (2010) Integrin CD11b Negatively Regulates TLR-Triggered Inflammatory Responses by Activating Syk and Promoting Degradation of MyD88 and TRIF Via Cbl-b. Nat Immunol. 11, 734-742.
39. Wang, L., Gordon, R. A., Huynh, L., Su, X., Park Min, K. H., Han, J., Arthur, J. S., Kalliolias, G. D., and Ivashkiv, L. B. (2010) Indirect Inhibition of Toll-Like Receptor and Type I Interferon Responses by ITAM-Coupled Receptors and Integrins. Immunity. 32, 518-530.
40. Dunne, J. L., Collins, R. G., Beaudet, A. L., Ballantyne, C. M., and Ley, K. (2003) Mac-1, but Not LFA-1, Uses Intercellular Adhesion Molecule-1 to Mediate Slow Leukocyte Rolling in TNF-Alpha-Induced Inflammation. J Immunol. 171, 6105-6111.
42. Xie, J., Li, R., Kotovuori, P., Vermot-Desroches, C., Wijdenes, J., Arnaout, M. A., Nortamo, P., and Gahmberg, C. G. (1995) Intercellular Adhesion Molecule-2 (CD102) Binds to the Leukocyte Integrin CD11b/CD18 through the A Domain. J Immunol. 155, 3619-3628.
43. Hermand, P., Huet, M., Callebaut, I., Gane, P., Ihanus, E., Gahmberg, C. G., Cartron, J. P., and Bailly, P. (2000) Binding Sites of Leukocyte Beta 2 Integrins (LFA-1, Mac-1) on the Human ICAM-4/LW Blood Group Protein. J Biol Chem. 275, 26002-26010.
45. Wright, S. D., Weitz, J. I., Huang, A. J., Levin, S. M., Silverstein, S. C., and Loike, J. D. (1988) Complement Receptor Type Three (CD11b/CD18) of Human Polymorphonuclear Leukocytes Recognizes Fibrinogen. Proc Natl Acad Sci U S A. 85, 7734-7738.
46. Diamond, M. S., Alon, R., Parkos, C. A., Quinn, M. T., and Springer, T. A. (1995) Heparin is an Adhesive Ligand for the Leukocyte Integrin Mac-1 (CD11b/CD1). J Cell Biol. 130, 1473-1482.
47. Spijkers, P. P., da Costa, M. P., Westein, E., Gahmberg, C. G., Zwaginga, J. J., and Lenting, P. J. (2005) LDL-Receptor-Related Protein Regulates beta2-Integrin-Mediated Leukocyte Adhesion. Blood. 105, 170-177.
48. Stefanidakis, M., Bjorklund, M., Ihanus, E., Gahmberg, C. G., and Koivunen, E. (2003) Identification of a Negatively Charged Peptide Motif within the Catalytic Domain of Progelatinases that Mediates Binding to Leukocyte Beta 2 Integrins. J Biol Chem. 278, 34674-34684.
50. Wolf, D., Hohmann, J. D., Wiedemann, A., Bledzka, K., Blankenbach, H., Marchini, T., Gutte, K., Zeschky, K., Bassler, N., Hoppe, N., Rodriguez, A. O., Herr, N., Hilgendorf, I., Stachon, P., Willecke, F., Duerschmied, D., von zur Muhlen, C., Soloviev, D. A., Zhang, L., Bode, C., Plow, E. F., Libby, P., Peter, K., and Zirlik, A. (2011) Binding of CD40L to Mac-1's I-Domain Involves the EQLKKSKTL Motif and Mediates Leukocyte Recruitment and Atherosclerosis--but does Not Affect Immunity and Thrombosis in Mice. Circ Res. 109, 1269-1279.
51. Coxon, A., Rieu, P., Barkalow, F. J., Askari, S., Sharpe, A. H., von Andrian, U. H., Arnaout, M. A., and Mayadas, T. N. (1996) A Novel Role for the Beta 2 Integrin CD11b/CD18 in Neutrophil Apoptosis: A Homeostatic Mechanism in Inflammation. Immunity. 5, 653-666.
52. Lu, H., Smith, C. W., Perrard, J., Bullard, D., Tang, L., Shappell, S. B., Entman, M. L., Beaudet, A. L., and Ballantyne, C. M. (1997) LFA-1 is Sufficient in Mediating Neutrophil Emigration in Mac-1-Deficient Mice. J Clin Invest. 99, 1340-1350.
53. Wu, H., Rodgers, J. R., Perrard, X. Y., Perrard, J. L., Prince, J. E., Abe, Y., Davis, B. K., Dietsch, G., Smith, C. W., and Ballantyne, C. M. (2004) Deficiency of CD11b Or CD11d Results in Reduced Staphylococcal Enterotoxin-Induced T Cell Response and T Cell Phenotypic Changes. J Immunol. 173, 297-306.
54. Soriano, S. G., Coxon, A., Wang, Y. F., Frosch, M. P., Lipton, S. A., Hickey, P. R., and Mayadas, T. N. (1999) Mice Deficient in Mac-1 (CD11b/CD18) are Less Susceptible to Cerebral ischemia/reperfusion Injury. Stroke. 30, 134-139.
55. Sisco, M., Chao, J. D., Kim, I., Mogford, J. E., Mayadas, T. N., and Mustoe, T. A. (2007) Delayed Wound Healing in Mac-1-Deficient Mice is Associated with Normal Monocyte Recruitment. Wound Repair Regen. 15, 566-571.
56. Fagerholm, S. C., MacPherson, M., James, M. J., Sevier-Guy, C., and Lau, C. S. (2013) The CD11b-Integrin (ITGAM) and Systemic Lupus Erythematosus. Lupus. 22, 657-663.
57. Anaya, J. M., Kim-Howard, X., Prahalad, S., Chernavsky, A., Canas, C., Rojas-Villarraga, A., Bohnsack, J., Jonsson, R., Bolstad, A. I., Brun, J. G., Cobb, B., Moser, K. L., James, J. A., Harley, J. B., and Nath, S. K. (2012) Evaluation of Genetic Association between an ITGAM Non-Synonymous SNP (rs1143679) and Multiple Autoimmune Diseases. Autoimmun Rev. 11, 276-280.
58. Chan, V. S., Nie, Y. J., Shen, N., Yan, S., Mok, M. Y., and Lau, C. S. (2012) Distinct Roles of Myeloid and Plasmacytoid Dendritic Cells in Systemic Lupus Erythematosus. Autoimmun Rev. 11, 890-897.
|
Science Writers | Anne Murray |
Illustrators | Katherine Timer |
Authors | Zue Zhong, Ming Zeng, Bruce Beutler |