Phenotypic Mutation 'Panr1'

• Allele: Panr1
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 35,419,180 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Tnf
• Gene Name: tumor necrosis factor
• Synonym(s): DIF, TNF alpha, TNFalpha, Tnfsf1a, Tnfa, tumor necrosis factor-alpha, TNF-alpha
• Chromosomal Location: 35,418,357-35,420,983 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. Members of this family are classified based on primary sequence, function, and structure. This protein is synthesized as a type-II transmembrane protein and is reported to be cleaved into products that exert distinct biological functions. It plays an important role in the innate immune response as well as regulating homeostasis but is also implicated in diseases of chronic inflammation. In mouse deficiency of this gene is associated with defects in response to bacterial infection, with defects in forming organized follicular dendritic cell networks and germinal centers, and with a lack of primary B cell follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013] ; PHENOTYPE: Mutations at this locus primarily affect the immune system, causing increased susceptibility to infection, failure to form splenic B-cell follicles, increased inflammation and impaired contact hypersensitivity. Homozygotes also may show metabolic defects. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Proline changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P06804
• PDB Structure: 1.4 A RESOLUTION STRUCTURE OF MOUSE TUMOR NECROSIS FACTOR, TOWARDS MODULATION OF ITS SELCTIVITY AND TRIMERISATION [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000025263; Gene: ENSMUSG00000024401; AA Change: P217T

Domain	Start	End	E-Value	Type
transmembrane domain	35	57	N/A	INTRINSIC
TNF	91	235	1.59e-53	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000025263)
• SMART Domains: Protein: ENSMUSP00000126122; Gene: ENSMUSG00000024401; AA Change: P201T

Domain	Start	End	E-Value	Type
transmembrane domain	35	57	N/A	INTRINSIC
TNF	74	219	2.8e-49	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000167924)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Dominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Live Mice, Embryos, gDNA
• MMRRC Submission: 010462-UCD
• Last Updated: 2017-04-18 4:44 PM by Katherine Timer
• Record Created: unknown
• Record Posted: 2007-12-05
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Sohpie Rutschmann, Kasper Hoebe, Bruce Beutler

Accession Number

NCBI RefSeq: NM_013693; MGI: 104798

Alleles Listed at MGI

All alleles(20) : Targeted, knock-out(13) Targeted, other(4) Spontaneous(2) Chemically induced(1)

Phenotypic Description

The PanR1 ("pan-resistance") phenotype was detected in a screen of ENU-induced G1 mutant mice for altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Tumor necrosis factor (TNF) bioactivity in culture supernatants of peritoneal macrophages from homozygous mice is undetectable in response to all TLR stimuli tested (i.e., lipid A, zymosan A, lipoteichoic acid, lipopeptide, poly I:C and CpG ODN). In heterozygotes, TLR-induced TNF activity is approximately one-eighth of wild type levels, consistent with a dominant phenotype (1) (Figure 1). However, PanR1 homozygotes and heterozygotes secrete wild type levels of immunoreactive TNF despite reduced TNF bioactivity. Preincubation of conditioned medium from LPS-stimulated wild type or heterozygous PanR1 macrophages with anti-TNF mAb, but not anti-lymphotoxin-alpha (Lta) mAb, abolishes TNF activity. The production of cytokines interleukin 6 (IL-6) and IL-12 is normal in PanR1 mutants.

 

PanR1 mutants display a dominant immunocompromised phenotype. Upon challenge with 1 x 10⁵ cfu of Listeria monocytogenes (a dose sublethal for wild type animals), increased susceptibility is observed: 90% of homozygotes and 50% of heterozygotes die within seven days post-infection, compared to zero wild type mice. However, PanR1 mutants are less susceptible than Tnf^-/- mice, all of which succumb to the same infection within five days.

 

Upon immunization, PanR1 lymphoid organ architecture is largely normal. The number of Peyer’s patches, as well as B cell follicles segregated from T cell-rich areas, and germinal center development are normal in PanR1 homozygotes and heterozygotes. Similarly normal primary follicles, germinal centers and marginal zones are observed in the PanR1 spleen. Only a moderate decrease in the cell density of the follicular dendritic cell network is found in the spleen of PanR1 mice.

Nature of Mutation

The PanR1 mutation was mapped to Chromosome 17, and corresponds to a C to A transversion at position 805 of the Tnf tranascript, in exon 4 of 4 total exons.

 

790 GCTGAGGTCAATCTGCCCAAGTACTTAGACTTT

212 -A--E--V--N--L--P--K--Y--L--D--F-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of proline to threonine at residue 217 (formerly residue 138) of the TNF protein.

Protein Prediction

Figure 2. Model the TNF trimer. The residue affected by the PanR1 mutation, which is exposed on the surface of the molecule, is shown in yellow. The mutation is near one of four regions required for ligand-receptor interactions, and disrupts TNF binding to the receptor. Trimer formation is not affected by the PanR1 mutation. UCSF Chimera model is based on PDB 3ALQ, Makai et al. Sci. Signal 3, ra83 (2010). Click on the image to view the structures rotate.

TNF (also called TNF-α) is a protein ligand for TNF receptors 1 and 2; in its uncleaved form it is 235 amino acids in mice and 233 amino acids in humans. Human TNF was isolated and cloned independently by several groups, and was shown to be encoded by four exons, the fourth of which contains most of the coding sequence (2-4). Mouse TNF was identified separately as cachectin, a protein that suppresses lipoprotein lipase activity in cultured 3T3-L1 adipocytes (5). Mouse TNF is 79% homologous to human TNF (6). The amino acid sequences of both mouse and human TNF contain unusually long leader sequences (79 amino acids in mouse; 76 amino acids in human) at the N terminus, of which about 26 are hydrophobic (2-4;6;7) and serve to anchor the protein in the plasma membrane (8). The leader is also a propeptide, which may be cleaved from the extracellular 157 amino acid C-terminal precursor peptide (156 amino acids in humans) by a metalloprotease of the ADAM (a disintegrin and metalloprotease domain) family (9;10). This processing gives rise to the soluble, mature active form of TNF. Thus, TNF exists as both membrane-bound and soluble forms; both are biologically active and may have distinct physiological roles (11).

 

Soluble TNF is active as a trimer (12), which crystallographic analysis has demonstrated binds in the groove between TNF receptor subunits (13-15). The TNF monomer exists as β-pleated sheet sandwich made up of 10 antiparallel β-strands with similar topology to the “jelly roll” structure observed for viral capsid proteins (14;15). Monomers form bell-shaped rigid trimers around a 3-fold axis of symmetry (Figure 2) (13-15). The association of TNF monomers is on the edge and face of neighboring subunits, respectively (14;15), and the trimer forms a central channel lined by polar and charged residues at the top and bottom of the channel, and hydrophobic residues at the middle part (13). TNF monomers contain one pair of cysteine residues, which form a disulfide bond, but are not required for biological activity (15;16).

 

The PanR1 mutation is a proline to threonine substitution at position 217 (formerly position 138), which exists in one of the α-helical elements connecting two β sheets and is exposed at the surface of the molecule (1). P217 is located in the turn preceding region IV, between β-strands G and H of TNF (see Putative Mechanism for discussion).

Expression/Localization

TNF is expressed primarily by cells of the immune system, including macrophages, monocytes, dendritic cells, natural killer (NK) cells, B cells and T cells [reviewed in (17)]. It is expressed at the cell membrane as a transmembrane protein (8), and may also be processed and cleaved to form a soluble secreted protein (2-4). A larger secreted form of TNF containing ten amino acids of the most C-terminal portion of the propeptide also exists; it has no biological activity (18).

Background

Figure 3. TNF signaling. See text for details. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The study of TNF extends relatively far back into history, with the first encounter in the late 1800s during the observation of spontaneous tumor regression in cancer patients coincident with the onset of bacterial infection [reviewed in (17)]. Filtrates of lysed bacteria were then tested as cancer treatments in patients, and one in particular, Coley’s Toxin, was moderately successful (19). The essential component of this bacterial lysate turned out to be lipopolysaccharide (LPS) (20), and later it was discovered that not LPS, but an LPS-induced serum factor was responsible for the tumor regression effects of LPS (21). This factor, first called tumor-necrotizing factor (21), and later tumor necrosis factor (22), was found to be secreted into the sera by macrophages of mice and rabbits infected with Mycobacterium bovis bacillus Calmette-Guerin and then treated with endotoxin (22). TNF in the serum from such animals could, in some cases, induce complete regression of certain transplanted tumors in mice (22). Later on, the cloning of TNF and the structurally and functionally related lymphotoxin alpha (Lta), suggested the existence of a TNF superfamily which is now known to contain at least 19 members.

 

TNFR-1 and TNFR-2 are expressed in a wide variety of cell types, and they signal through adapter proteins to activate MAPK, JNK, NF-κB and AP-1 [reviewed in (17;23)] (Figure 3). TNF signaling also activates caspases, leading to apoptosis. TNF trimers bind to homodimers of TNF receptor 1 (TNFR1) and TNFR2 (24;25), receptors also known by their molecular weights of 55 and 75 kD, respectively (26). Upon ligand binding, TNFR-1 binds to TNFR-associated death domain (TRADD) protein, which in turn recruits TNF receptor-associated factor 2 (TRAF2) and/or TRAF5, and the Ser/Thr kinase receptor-interacting protein (RIP). These interactions may occur in the context of lipid rafts, after which TNFR1 and RIP are ubiquitinated, resulting in their degradation by the proteasome pathway (27). Subsequently, activation of the TAB2/TAK1 complex activates the IKK complex to phosphorylate IκB, resulting in release of NF-κB for translocation to the nucleus and activation of gene expression. TNFR1 activates JNK through sequential recruitment of TRAF2, MEKK1 and MKK7. MAPK activation involves signaling through TRADD, RIP and MKK3. TRADD recruitment to TNFR1 also leads to the induction of apoptosis through FAS-associated death domain (FADD) protein, caspase-8 and caspase-3. TNFR2 signals via the same pathways as TNFR1, but does not signal through FADD and caspases to mediate apoptosis.

 

TNF is an important cytokine in the normal response to infection, yet aberrant expression of TNF can lead to a lethal state of shock (5;28). The net biological response to TNF expression depends on a balance between the proliferation- and apoptosis-promoting activities of TNF, as well as many other factors. For example, the induction of adhesion molecule expression by TNF, which favors margination and sequestration of leukocytes, may contribute to severe, systemic inflammatory effects (29;30). The effects of TNF on coagulation may also engender some aspects of septic shock (31).

 

The systemic toxicity of TNF is one of the main barriers to the use of TNF as an anti-cancer therapeutic. Finally, TNF has been implicated in the development of several autoimmune diseases (e.g. rheumatoid arthritis, ankylosing spondylitis, Crohn’s disease, and psoriasis; OMIM *191160) and antibodies against TNF can be useful in treating some cases of each of these diseases. TNF has been specifically implicated in TNF receptor-associated periodic syndrome (TRAPS, also known as Familial Hybernian Fever; OMIM #142680), an autosomal dominant syndrome characterized by episodes of fever and severe localized inflammation (32). These autoinflammatory symptoms may be caused by increased TNFR1 signaling due to impaired downregulation of membrane TNFR1 (32).

 

On the other hand, despite its involvement in both acute and chronic inflammation, TNF is essential for normal immune function. It is required for the normal development of secondary lymphoid organs. Tnf^-/- mice are reported to have reduced numbers and sizes of Peyer’s patches and defective splenic architecture (33-35). During infection, TNF is a key mediator of innate resistance to certain microbes such as Listeria monocytogenes (36;37) and mycobacteria (38), first noted when mice were treated with anti-TNF antibodies. Tnf^-/- and Tnfr1^-/- mice are highly susceptible to infection with L. monocytogenes, rapidly dying from infection (33;39). As predicted by the passive immunization studies (36-38) and by the protective effects of soluble forms of TNF receptors (40), Tnf^-/- and Tnfr1^-/- mice are resistant to LPS-induced septic shock (33;39).

Putative Mechanism

The crystal structures of TNF (13-15) and the related Lta molecule (41), and mutational analysis of TNF (42-45) suggest that there are four main regions involved in ligand-receptor interaction which are mainly located in the loops connecting β-strands, and reside in the intersubunit grooves of the TNF trimer. These regions (region I, residues 32-34; region II, residues 82-89; region III, residues 115-117; region IV, residues 141-146) are required for the full biological activity of TNF (42;43). In particular, Y141 and E146 are highly likely to mediate receptor binding (13;43). Notably, the TNF point mutant A145R is reported to form trimers with wild type TNF, but inhibits TNF-mediated caspase and NF-κB activation by sequestering normal, productive trimers from activating receptor (44;46). The PanR1 mutation is located in the loop connecting β-strands G and H, in close proximity to ligand-receptor interaction region IV. Consistent with these data, the PanR1 mutation disrupts TNF binding to the receptor, possibly by disrupting the receptor binding interface of the TNF trimer by replacing P138  (now P217 according to Genbank record NM_013693) with a more bulky threonine residue. At the same time, the mutation does not appear to disrupt TNF trimer formation; these trimers are estimated to have <0.1% of wild type TNF trimer activity (1).

 

PanR1 mice have generally less severe phenotypes than Tnf^-/- mice. PanR1 mice are less susceptible to L. monocytogenes infection than Tnf^-/- mice, and have nearly normal secondary lymphoid organ development, unlike Tnf^-/- mice. As discussed in (1), these disparities may be attributed to strain differences between PanR1 (mixed C57BL/6J x 129/Sv background) and Tnf^-/- mice (C57BL/6J background). In addition, Lta, Ltb and Tnf are closely linked on mouse Chromosome 17, and gene targeting of the Tnf locus could potentially affect the transcription of Lta or Ltb, both of which contribute to the immune response to L. monocytogenes (47) and to secondary lymphoid organ development (48). Finally, trimers containing the TNF P138T mutant may provide enough signaling capacity to support increased resistance to L. monocytogenes and proper secondary lymphoid organ development in PanR1 compared to Tnf^-/- mice.

Primers

Primers cannot be located by automatic search.

Genotyping

PanR1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

Primers

PanR1(F1): 5’- AAGTGGAGGAGCAGCTGGAGTG-3’

PanR1(R1): 5’-CTGAAGACAGCTTCCCACACTG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 60°C             0:20

4) 72°C             1:00

5) repeat steps (2-4) 35X

6) 72°C             5:00

7) 4°C               ∞

 

The following sequence of 947 nucleotides (from Genbank genomic region NC_000083 for linear DNA sequence of Tnf) is amplified:

 

1443   aagtggag gagcagctgg agtggctgag ccagcgcgcc aacgccctcc tggccaacgg

1501 catggatctc aaagacaacc aactagtggt gccagccgat gggttgtacc ttgtctactc

1561 ccaggttctc ttcaagggac aaggctgccc cgactacgtg ctcctcaccc acaccgtcag

1621 ccgatttgct atctcatacc aggagaaagt caacctcctc tctgccgtca agagcccctg

1681 ccccaaggac acccctgagg gggctgagct caaaccctgg tatgagccca tatacctggg

1741 aggagtcttc cagctggaga agggggacca actcagcgct gaggtcaatc tgcccaagta

1801 cttagacttt gcggagtccg ggcaggtcta ctttggagtc attgctctgt gaagggaatg

1861 ggtgttcatc cattctctac ccagccccca ctctgacccc tttactctga cccctttatt

1921 gtctactcct cagagccccc agtctgtatc cttctaactt agaaagggga ttatggctca

1981 gggtccaact ctgtgctcag agctttcaac aactactcag aaacacaaga tgctgggaca

2041 gtgacctgga ctgtgggcct ctcatgcacc accatcaagg actcaaatgg gctttccgaa

2101 ttcactggag cctcgaatgt ccattcctga gttctgcaaa gggagagtgg tcaggttgcc

2161 tctgtctcag aatgaggctg gataagatct caggccttcc taccttcaga cctttccaga

2221 ttcttccctg aggtgcaatg cacagccttc ctcacagagc cagcccccct ctatttatat

2281 ttgcacttat tatttattat ttatttatta tttatttatt tgcttatgaa tgtatttatt

2341 tggaaggccg gggtgtcctg gaggacccag tgtgggaagc tgtcttcag

 

Primer binding sites are underlined; the mutated C is highlighted in red.

 

PanR1 genotyping can also be done by PCR amplification followed by Hpy188I restriction digestion of the amplified region. 

Primers

PanR1(F2): 5’-CGTCAGCCGATTTGCTATCT -3’

PanR1(R2): 5’-GGGGGCTCTGAGGAGTAGAC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             0:30

5) repeat steps (2-4) 35X

6) 72°C             7:00

7) 4°C               ∞

 

The following sequence of 326 nucleotides (from Genbank genomic region NC_000083 for linear DNA sequence of Tnf) is amplified:

 

1615                                                            cgtcag

1621 ccgatttgct atctcatacc aggagaaagt caacctcctc tctgccgtca agagcccctg

1681 ccccaaggac acccctgagg gggctgagct caaaccctgg tatgagccca tatacctggg

1741 aggagtcttc cagctggaga agggggacca actcagcgct gaggtcaatc tgcccaagta

1801 cttagacttt gcggagtccg ggcaggtcta ctttggagtc attgctctgt gaagggaatg

1861 ggtgttcatc cattctctac ccagccccca ctctgacccc tttactctga cccctttatt

1921 gtctactcct cagagccccc

 

Primer binding sites are underlined; the novel Hpy188I site created by the PanR1 mutation is highlighted in gray; the mutated C is shown in red text.

References

   1.  Rutschmann, S., Hoebe, K., Zalevsky, J., Du, X., Mann, N., Dahiyat, B. I., Steed, P., and Beutler, B. (2006) PanR1, a dominant negative missense allele of the gene encoding TNF-alpha (Tnf), does not impair lymphoid development, J. Immunol. 176, 7525-7532.

   2.  Pennica, D., Nedwin, G. E., Hayflick, J. S., Seeburg, P. H., Derynck, R., Palladino, M. A., Kohr, W. J., Aggarwal, B. B., and Goeddel, D. V. (1984) Human tumor necrosis factor: precursor structure, expression and homology to lymphotoxin, Nature 312, 724-729.

   3.  Shirai, T., Yamaguchi, H., Ito, H., Todd, C. W., and Wallace, R. B. (1985) Cloning and expression in Escherichia coli of the gene for human tumour necrosis factor, Nature 313, 803-806.

   4.  Wang, A. M., Creasey, A. A., Ladner, M. B., Lin, L. S., Strickler, J., Van Arsdell, J. N., Yamamoto, R., and Mark, D. F. (1985) Molecular cloning of the complementary DNA for human tumor necrosis factor, Science 228, 149-154.

   5.  Beutler, B., Greenwald, D., Hulmes, J. D., Chang, M., Pan, Y.-C. E., Mathison, J., Ulevitch, R., and Cerami, A. (1985) Identity of tumour necrosis factor and the macrophage-secreted factor cachectin, Nature 316, 552-554.

   6.  Pennica, D., Hayflick, J. S., Bringman, T. S., Palladino, M. A., and Goeddel, D. V. (1985) Cloning and expression in Escherichi coli of the cDNA for murine tumor necrosis factor, Proc. Natl. Acad. Sci. ,USA 82, 6060-6064.

   7.  Fransen, L., Muller, R., Marmenout, A., Tavernier, J., Van der Heyden, J., Kawashima, E., Chollet, A., Tizard, R., Van Heuverswyn, H., Van Vliet, A., Ruysschaert, M.-R., and Fiers, W. (1985) Molecular cloning of mouse tumour necrosis factor cDNA and its eukaryotic expression, Nucleic Acids Res. 13, 4417-4429.

   8.  Kriegler, M., Perez, C., DeFay, K., Albert, I., and Lu, S. D. (1988) A novel form of TNF/cachectin is a cell surface cytotoxic transmembrane protein: Ramifications for the complex physiology of TNF, Cell 53, 45-53.

   9.  Black, R. A., Rauch, C. T., Kozlosky, C. J., Peschon, J. J., Slack, J. L., Wolfson, M. F., Castner, B. J., Stocking, K. L., Reddy, P., Srinivasan, S., Nelson, N., Boiani, N., Schooley, K. A., Gerhart, M., Davis, R., Fitzner, J. N., Johnson, R. S., Paxton, R. J., March, C. J., and Cerretti, D. P. (1997) A metalloproteinase disintegrin that releases tumour-necrosis factor- alpha from cells, Nature 385, 729-733.

 10.  Moss, M. L., Jin, S. L., Milla, M. E., Bickett, D. M., Burkhart, W., Carter, H. L., Chen, W. J., Clay, W. C., Didsbury, J. R., Hassler, D., Hoffman, C. R., Kost, T. A., Lambert, M. H., Leesnitzer, M. A., McCauley, P., McGeehan, G., Mitchell, J., Moyer, M., Pahel, G., Rocque, W., Overton, L. K., Schoenen, F., Seaton, T., Su, J. L., Becherer, J. D., and . (1997) Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-alpha, Nature 385, 733-736.

 11.  Grell, M., Douni, E., Wajant, H., Löhden, M., Clauss, M., Maxeiner, B., Georgopoulos, S., Lesslauer, W., Kollias, G., Pfizenmaier, K., and Scheurich, P. (1995) The transmembrane form of tumor necrosis factor is the prime activating ligand of the 80 kDa tumor necrosis factor receptor, Cell 83, 793-802.

 12.  Smith, R. A. and Baglioni, C. (1987) The active form of tumor necrosis factor is a trimer, J. Biol. Chem. 262, 6951-6954.

 13.  Baeyens, K. J., De Bondt, H. L., Raeymaekers, A., Fiers, W., and De Ranter, C. J. (1999) The structure of mouse tumour-necrosis factor at 1.4 A resolution: towards modulation of its selectivity and trimerization, Acta Crystallogr. D. Biol. Crystallogr. 55, 772-778.

 14.  Eck, M. J. and Sprang, S. R. (1989) The structure of tumor necrosis factor-alpha at 2.6A resolution: implications for receptor binding, J. Biol. Chem. 264, 17595-17605.

 15.  Jones, E. Y., Stuart, D. I., and Walker, N. P. C. (1989) Structure of tumour necrosis factor, Nature 338, 225-228.

 16.  Boraschi, D., Nencioni, L., Villa, L., Censini, S., Bossu, P., Ghiara, P., Presentini, R., Perin, F., Frasca, D., Doria, G., Forni, G., Musso, T., Giovarelli, M., Ghezzi, P., Bertini, R., Besedovsky, H. O., Del Rey, A., Sipe, J. D., Antoni, G., Silvestri, S., and Tagliabue, A. (1988) In vivo stimulation and restoration of the immune response by the noninflammatory fragment 163-171 of human interleukin 1beta, J. Exp. Med. 168, 675-686.

 17.  Aggarwal, B. B. (2003) Signalling pathways of the TNF superfamily: a double-edged sword, Nat. Rev. Immunol. 3, 745-756.

 18.  Cseh, K. and Beutler, B. (1989) Alternative cleavage of the cachectin/TNF propeptide results in a larger, inactive form of secreted protein, J. Biol. Chem. 264, 16256-16260.

 19.  Coley, W. B. (1893) The treatment of malignant tumors by repeated inoculations of erysipelas; with a report of ten original cases, Am. J. Med. Sci. 105, 487-511.

 20.  Shear, M. J., Turner, F. C., Perrault, A., and Shovelton, J. (1943) Chemical treatment of tumors. V. Isolation of the hemorrhage-producing fraction from Serratia marcescens (Baccillus prodigiosus) culture filtrate, J. Natl. Canc. Inst. 4, 81-97.

 21.  O'Malley, W. E., Achinstein, B., and Shear, M. J. (1962) Action of bacterial polysaccharide on tumors. II. Damage of sarcoma 37 by serum of mice treated with Serratia marcescens polysaccharide, and induced tolerance, J. Natl. Canc. Inst. 29, 1169-1175.

 22.  Carswell, E. A., Old, L. J., Kassel, R. L., Green, S., Fiore, N., and Williamson, B. (1975) An endotoxin-induced serum factor that causes necrosis of tumors, Proc. Natl. Acad. Sci. ,USA 72, 3666-3670.

 23.  Baud, V. and Karin, M. (2001) Signal transduction by tumor necrosis factor and its relatives, Trends Cell Biol. 11, 372-377.

 24.  Bazzoni, F., Alejos, E., and Beutler, B. (1995) Chimeric tumor necrosis factor receptors with constitutive signaling activity, Proc. Natl. Acad. Sci. USA 92, 5376-5380.

 25.  Bazzoni, F. and Beutler, B. (1996) The tumor necrosis factor ligand and receptor families, N. Engl. J. Med. 334, 1717-1725.

 26.  Loetscher, H., Brockhaus, M., Dembic, Z., Gentz, R., Gubler, U., Hohmann, H.-P., Lahm, H.-W., Van Loon, A. P. G. M., Pan, Y.-C. E., Schlaeger, E.-J., Steinmetz, M., Tabuchi, H., and Lesslauer, W. (1991) Two distinct tumour necrosis factor receptors-members of a new cytokine receptor gene family, in Oxford Surveys on Eukaryotic Genes (Maclean, N., Ed.) 7 ed., pp 119-141, Oxford University Press, London.

 27.  Legler, D. F., Micheau, O., Doucey, M. A., Tschopp, J., and Bron, C. (2003) Recruitment of TNF receptor 1 to lipid rafts is essential for TNFalpha-mediated NF-kappaB activation, Immunity 18, 655-664.

 28.  Beutler, B. and Cerami, A. (1989) The biology of cachetin/TNF. A primary mediator of the host response., Annu. Rev. Immunol. 7, 625-655.

 29.  Gamble, J. R., Harlan, J. M., Klebanoff, S. J., Lopez, A. F., and Vadas, M. A. (1985) Stimulation of the adherence of neutrophils to umbilical vein endothelium by human recombinant tumor necrosis factor, Proc. Natl. Acad. Sci. ,USA 82, 8667-8671.

 30.  Pohlman, T. H., Stanness, K. A., Beatty, P. G., Ochs, H. D., and Harlan, J. M. (1986) An endothelial cell surface factor(s) induced in vitro by lipopolysaccharide, interleukin 1, and tumor necrosis factor-alpha increases neutrophil adherence by a CDw18-dependent mechanism, J. Immunol. 136, 4548-4553.

 31.  Bevilacqua, M. P., Pober, J. S., Majeau, G. R., Fiers, W., Cotran, R. S., and Gimbrone, M. A. Jr. (1986) Recombinant tumor necrosis factor induces procoagulant activity in cultured human vascular endothelium: characterization and comparison with the actions of interleukin 1, Proc. Natl. Acad. Sci. ,USA 83, 4533-4537.

 32.  McDermott, M. F., Aksentijevich, I., Galon, J., McDermott, E. M., Ogunkolade, B. W., Centola, M., Mansfield, E., Gadina, M., Karenko, L., Pettersson, T., McCarthy, J., Frucht, D. M., Aringer, M., Torosyan, Y., Teppo, A. M., Wilson, M., Karaarslan, H. M., Wan, Y., Todd, I., Wood, G., Schlimgen, R., Kumarajeewa, T. R., Cooper, S. M., Vella, J. P., Amos, C. I., Mulley, J., Quane, K. A., Molloy, M. G., Ranki, A., Powell, R. J., Hitman, G. A., O'Shea, J. J., and Kastner, D. L. (1999) Germline mutations in the extracellular domains of the 55 kDa TNF receptor, TNFR1, define a family of dominantly inherited autoinflammatory syndromes, Cell 97, 133-144.

 33.  Pasparakis, M., Alexopoulou, L., Episkopou, V., and Kollias, G. (1996) Immune and inflammatory responses in TNFa-deficient mice:   A critical requirement for TNFa in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response, J. Exp. Med. 184, 1397-1411.

 34.  Kuprash, D. V., Tumanov, A. V., Liepinsh, D. J., Koroleva, E. P., Drutskaya, M. S., Kruglov, A. A., Shakhov, A. N., Southon, E., Murphy, W. J., Tessarollo, L., Grivennikov, S. I., and Nedospasov, S. A. (2005) Novel tumor necrosis factor-knockout mice that lack Peyer's patches, Eur. J Immunol. 35, 1592-1600.

 35.  Flaherty, L., Messer, A., Russell, L. B., and Rinchik, E. M. (1992) Chlorambucil-induced mutations in mice recovered in homozygotes, Proc. Natl. Acad. Sci. U. S. A 89, 2859-2863.

 36.  Havell, E. A. (1989) Evidence that tumor necrosis factor has an important role in antibacterial resistance, Journal of Immunology 143, 2894-2899.

 37.  Havell, E. A. (1987) Production of tumor necrosis factor during murine listeriosis, Journal of Immunology 139, 4225-4231.

 38.  Kindler, V., Sappino, A.-P., Grau, G. E., Piguet, P.-F., and Vassalli, P. (1989) The inducing role of tumor necrosis factor in the development of bactericidal granulomas during BCG infection, Cell 56, 731-740.

 39.  Pfeffer, K., Matsuyama, T., Kündig, T. M., Wakeham, A., Kishihara, K., Shahinian, A., Wiegmann, K., Ohashi, P. S., Krönke, M., and Mak, T. W. (1993) Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection, Cell 73, 457-467.

 40.  Peppel, K., Crawford, D., and Beutler, B. (1991) A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity, J. Exp. Med. 174, 1483-1489.

 41.  Eck, M. J., Ultsch, M., Rinderknecht, E., de Vos, A. M., and Sprang, S. R. (1992) The structure of human lymphotoxin (TNF-Beta) at 1.9A resolution, J. Biol. Chem. 267, 2119-2122.

 42.  Zhang, X. M., Weber, I., and Chen, M. J. (1992) Site-directed mutational analysis of human tumor necrosis factor-alpha receptor binding site and structure-functional relationship, J Biol. Chem. 267, 24069-24075.

 43.  Yamagishi, J., Kawashima, H., Matsuo, N., Ohue, M., Yamayoshi, M., Fukui, T., Kotani, H., Furuta, R., Nakano, K., and Yamada, M. (1990) Mutational analysis of structure-activity relationships in human tumor necrosis factor-alpha, Prot. Engin. 3, 713-719.

 44.  Steed, P. M., Tansey, M. G., Zalevsky, J., Zhukovsky, E. A., Desjarlais, J. R., Szymkowski, D. E., Abbott, C., Carmichael, D., Chan, C., Cherry, L., Cheung, P., Chirino, A. J., Chung, H. H., Doberstein, S. K., Eivazi, A., Filikov, A. V., Gao, S. X., Hubert, R. S., Hwang, M., Hyun, L., Kashi, S., Kim, A., Kim, E., Kung, J., Martinez, S. P., Muchhal, U. S., Nguyen, D. H., O'Brien, C., O'Keefe, D., Singer, K., Vafa, O., Vielmetter, J., Yoder, S. C., and Dahiyat, B. I. (2003) Inactivation of TNF signaling by rationally designed dominant-negative TNF variants, Science 301, 1895-1898.

 45.  Van, O., X, Tavernier, J., Prange, T., and Fiers, W. (1991) Localization of the active site of human tumour necrosis factor (hTNF) by mutational analysis, EMBO J 10, 827-836.

 46.  Zalevsky, J., Secher, T., Ezhevsky, S. A., Janot, L., Steed, P. M., O'Brien, C., Eivazi, A., Kung, J., Nguyen, D. H., Doberstein, S. K., Erard, F., Ryffel, B., and Szymkowski, D. E. (2007) Dominant-negative inhibitors of soluble TNF attenuate experimental arthritis without suppressing innate immunity to infection, J Immunol. 179, 1872-1883.

 47.  Roach, D. R., Briscoe, H., Saunders, B. M., and Britton, W. J. (2005) Independent protective effects for tumor necrosis factor and lymphotoxin alpha in the host response to Listeria monocytogenes infection, Infect. Immun. 73, 4787-4792.

 48.  Tumanov, A. V., Kuprash, D. V., and Nedospasov, S. A. (2003) The role of lymphotoxin in development and maintenance of secondary lymphoid tissues, Cytokine Growth Factor Rev. 14, 275-288.