Phenotypic Mutation 'halloween'

• Allele: halloween
• Mutation Type: missense
• Chromosome: 18
• Coordinate: 66,992,892 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Mc4r
• Gene Name: melanocortin 4 receptor
• Synonym(s): Pkcp, Fatboy
• Chromosomal Location: 66,990,776-66,993,558 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012] ; PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Asparagine changed to Tyrosine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000054776]
• AlphaFold: P56450
• SMART Domains: Protein: ENSMUSP00000054776; Gene: ENSMUSG00000047259; AA Change: N74Y

Domain	Start	End	E-Value	Type
Pfam:7tm_4	51	228	8.1e-11	PFAM
Pfam:7TM_GPCR_Srsx	55	317	6e-12	PFAM
Pfam:7tm_1	61	302	2.7e-31	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000057942)
• Meta Mutation Damage Score: 0.9328
• Is this an essential gene?: Probably nonessential (E-score: 0.105)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• MMRRC Submission: 038241-MU
• Last Updated: 2019-09-04 9:44 PM by Diantha La Vine
• Record Created: 2015-10-31 4:05 PM by Zhe Chen
• Record Posted: 2015-11-09
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Ryan Solt, Jianhui Wang, Zhe Chen, Jeff SoRelle, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_016977; MGI:99457

Alleles Listed at MGI

All Mutations and Alleles: 13; Chemically induced (ENU): 5; Targeted: 8

Phenotypic Description

Figure 1. Halloween mice exhibited increased body weights compared to wild-type littermates. Normalized weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. The halloween mice (top) exhibit increased body weights compared to wild-type (C57BL/6J) mice (bottom).

The halloween phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3715, some of which showed increased body weights compared to wild-type mice (Figure 1 & 2).

Nature of Mutation

Figure 3. Linkage mapping of the increased body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R3715. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. The increased body weight phenotype was linked to a mutation in Mc4r: an A to T transversion at base pair 66,859,821 (v38) on chromosome 18, or base pair 667 in the GenBank genomic region NC_000084 for the Mc4r gene. Linkage was found with a recessive model of inheritance (P = 4.533 x 10^-7), wherein six variant homozygotes departed phenotypically from five homozygous reference mice and nine heterozygous mice (Figure 3).  A semidominant effect was observed, but the mutation is preponderantly recessive.

The mutation corresponds to residue 667 in the mRNA sequence NM_016977 within exon 1 of 1 total exons. 

652 ATAGCCAAGAACAAGAACCTGCACTCACCCATG 69  -I--A--K--N--K--N--L--H--S--P--M-

The mutated nucleotide is indicated in red.  The mutation results in an asparagine (N) to tyrosine (Y) substitution at position 74 (T74Y) in the MC4R protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999) (1).

Protein Prediction

Figure 4. Domain structure and topography of mouse MC4R. The locations of the transmembrane (TM) domains are indicated. The halloween mutation causes a conversion of asparagine 74 to a tyrosine in the MC4R protein. The image is interactive; click to view other MC4R mutations.

Figure 5. 3D model of Melanocortin-4 receptor. The locations of the Big_boned, Cetacean, chubby, halloween, and Southbeach mutations are indicated. UCSF Chimera model is based on PDB 2IQR. Click on the 3D structure to view it rotate.

MC4R belongs to the family of melanocortin receptors, which are seven transmembrane (TM) spanning G-protein coupled receptors (GPCRs) (Figure 4 & 5). MC4R activates the heterotrimeric G-protein G_s, which stimulates adenylyl cyclase production of cAMP from ATP (2). GPCRs have seven transmembrane helices connected by loops, and ligand binding occurs at extracellular loops facilitated by specific transmembrane helices. Based on a pure modeling approach modeled upon the crystal structure of bovine rhodopsin, another GPCR, residues in transmembrane domain (TM)3, TM4, TM5 and TM6 were predicted to flank the ligand binding site. Extracellular loops 2 and 3 also participate in docking of ligand (3). Interestingly, TM1 and TM7 were not predicted to contribute to ligand binding, although F284 was found at the edge of the ligand-binding pocket (3). The third intracellular loop of MC4R is predicted to form an α-helical segment, and play an important role in coupling the receptor to G_s. The halloween mutation results in a asparagine (N) to tyrosine (Y) substitution at position 74 (T74Y) in the cytoplasmic region between TM1 and TM2.

Please see the record for Southbeach for more information about Mc4r.

Putative Mechanism

A main mechanism of energy balance regulation involves the control of signaling by the central melanocortin receptors (MCRs) MC3R and MC4R within a defined hypothalamic neural network. Two sets of neurons in the arcuate nucleus (a region surrounding the third ventricle in the most ventral portion of the hypothalamus) act as sensors of whole-body energy status and initiate signals to maintain energy stores at a constant level. The Agrp/Npy neurons (producing Agrp and neuropeptide Y) are inhibited by the leptin peptide (see the record for Potbelly) by signaling through the leptin receptor (see the record for Business_class), while Pomc/Cart neurons (producing Pomc; its proteolytic products and cocaine- and amphetamine-regulated transcript) are stimulated by leptin (4-6). Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons (4;7). Thus, when leptin levels are low, Agrp/Npy neurons are activated and Pomc/Cart neurons are inhibited, producing Agrp but not Pomc, and resulting in inhibition of MC4R and increased food intake.

In humans, mutations in MC4R are associated with obesity (OMIM #601665). Human patients with MC4R mutations exhibit increased body mass index, increased appetite, increased height, increased lean mass, increased bone mineral density and hyperinsulinemia (8). With the exception of increased bone mineral density, these phenotypes are recapitulated in Mc4r null mice (9).

The obesity phenotype observed in halloween mice mirrored that of other ENU-induced mutations attributed to Mc4r, including Southbeach and Fatboy (MGI:2671841) (10), confirming that the Mc4r mutation in halloween was causative. The localization, expression, and function of the MC4R^halloween protein have not been determined; however, the obesity phenotype of the halloween mice indicates that the mutation results in loss of MC4R function.

Primers

PCR Primer
halloween_pcr_F: GGAGCTACAGATCACAGAGTC
halloween_pcr_R: TGCAGGAAGATGAACTCCACC

Sequencing Primer
halloween_seq_F: GAGCTACAGATCACAGAGTCAATGAC
halloween_seq_R: ACCACCATGGCATGTATACTTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 405 nucleotides is amplified (chromosome 18, - strand):

1   tgcaggaaga tgaactccac ccaccaccat ggcatgtata cttccctcca cctctggaac
61  cgcagcagct acgggctgca cggcaatgcc agcgagtcgc tggggaaggg ccacccggac
121 ggaggatgct atgagcaact ttttgtttcc cccgaggtgt ttgtgactct gggtgtcata
181 agcctgttgg agaacattct agtgatcgtg gcgatagcca agaacaagaa cctgcactca
241 cccatgtact ttttcatctg tagcctggct gtggcagata tgctggtgag cgtttcgaat
301 gggtcggaaa ccatcgtcat taccctgtta aacagtacgg atacggatgc ccagagcttc
361 accgtgaaca ttgataatgt cattgactct gtgatctgta gctcc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Gantz, I., Miwa, H., Konda, Y., Shimoto, Y., Tashiro, T., Watson, S. J., DelValle, J., and Yamada, T. (1993) Molecular Cloning, Expression, and Gene Localization of a Fourth Melanocortin Receptor. J Biol Chem. 268, 15174-15179.

  3. Yang, X., Wang, Z., Dong, W., Ling, L., Yang, H., and Chen, R. (2003) Modeling and Docking of the Three-Dimensional Structure of the Human Melanocortin 4 Receptor. J Protein Chem. 22, 335-344.

  4. Hahn, T. M., Breininger, J. F., Baskin, D. G., and Schwartz, M. W. (1998) Coexpression of Agrp and NPY in Fasting-Activated Hypothalamic Neurons. Nat Neurosci. 1, 271-272.

  5. Cowley, M. A., Smart, J. L., Rubinstein, M., Cerdan, M. G., Diano, S., Horvath, T. L., Cone, R. D., and Low, M. J. (2001) Leptin Activates Anorexigenic POMC Neurons through a Neural Network in the Arcuate Nucleus. Nature. 411, 480-484.

  6. Kristensen, P., Judge, M. E., Thim, L., Ribel, U., Christjansen, K. N., Wulff, B. S., Clausen, J. T., Jensen, P. B., Madsen, O. D., Vrang, N., Larsen, P. J., and Hastrup, S. (1998) Hypothalamic CART is a New Anorectic Peptide Regulated by Leptin. Nature. 393, 72-76.

  7. Bagnol, D., Lu, X. Y., Kaelin, C. B., Day, H. E., Ollmann, M., Gantz, I., Akil, H., Barsh, G. S., and Watson, S. J. (1999) Anatomy of an Endogenous Antagonist: Relationship between Agouti-Related Protein and Proopiomelanocortin in Brain. J Neurosci. 19, RC26.

  8. Farooqi, I. S., Keogh, J. M., Yeo, G. S., Lank, E. J., Cheetham, T., and O'Rahilly, S. (2003) Clinical Spectrum of Obesity and Mutations in the Melanocortin 4 Receptor Gene. N Engl J Med. 348, 1085-1095.

  9. Huszar, D., Lynch, C. A., Fairchild-Huntress, V., Dunmore, J. H., Fang, Q., Berkemeier, L. R., Gu, W., Kesterson, R. A., Boston, B. A., Cone, R. D., Smith, F. J., Campfield, L. A., Burn, P., and Lee, F. (1997) Targeted Disruption of the Melanocortin-4 Receptor Results in Obesity in Mice. Cell. 88, 131-141.

  10. Meehan, T. P., Tabeta, K., Du, X., Woodward, L. S., Firozi, K., Beutler, B., and Justice, M. J. (2006) Point Mutations in the Melanocortin-4 Receptor Cause Variable Obesity in Mice. Mamm Genome. 17, 1162-1171.