Phenotypic Mutation 'fear-2' (pdf version)
List |< first << previous [record 23 of 74] next >> last >|
Allelefear-2
Mutation Type critical splice donor site (2 bp from exon)
Chromosome1
Coordinate14,891,303 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Trpa1
Gene Name transient receptor potential cation channel, subfamily A, member 1
Synonym(s) ANKTM1
Chromosomal Location 14,872,648-14,918,862 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in altered nociception and neuron responses to isothiocyanate or thiosulfinate compounds like those found in mustard oil and garlic. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_177781 (variant 1), NM_001348288 (variant 2); MGI:3522699

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000043594]
SMART Domains Protein: ENSMUSP00000043594
Gene: ENSMUSG00000032769

DomainStartEndE-ValueType
ANK 63 94 1.01e2 SMART
ANK 98 127 9.7e-8 SMART
ANK 131 161 1.36e-2 SMART
ANK 165 194 5.45e-2 SMART
ANK 198 226 3.07e2 SMART
ANK 239 268 1.99e-4 SMART
ANK 272 302 1.33e2 SMART
ANK 309 338 4.19e-3 SMART
ANK 342 371 2.34e-1 SMART
ANK 413 442 3.41e-3 SMART
ANK 446 475 5.75e-1 SMART
ANK 482 511 4.1e-6 SMART
ANK 514 543 1.68e-2 SMART
ANK 548 577 4.97e-5 SMART
Blast:ANK 580 609 2e-11 BLAST
Pfam:Ion_trans 736 975 1.8e-11 PFAM
Predicted Effect probably null
Phenotypic Category Autosomal Recessive
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) Targeted(8)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Trpa1 APN 1 14891333 missense probably damaging 0.97
IGL00937:Trpa1 APN 1 14880277 splice site probably benign
IGL00957:Trpa1 APN 1 14881668 missense probably damaging 0.99
IGL01307:Trpa1 APN 1 14896547 missense probably benign 0.23
IGL01336:Trpa1 APN 1 14886880 splice site probably benign
IGL01408:Trpa1 APN 1 14889413 missense probably benign 0.03
IGL01504:Trpa1 APN 1 14882219 missense possibly damaging 0.79
IGL01543:Trpa1 APN 1 14900076 missense probably damaging 1.00
IGL01609:Trpa1 APN 1 14912383 missense probably damaging 0.99
IGL01895:Trpa1 APN 1 14887643 missense possibly damaging 0.87
IGL02449:Trpa1 APN 1 14898157 missense probably damaging 1.00
IGL02936:Trpa1 APN 1 14875969 splice site probably null
petrified UTSW 1 14884116 missense probably damaging 1.00
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0317:Trpa1 UTSW 1 14881632 missense probably benign 0.03
R0454:Trpa1 UTSW 1 14885748 critical splice donor site probably null
R0828:Trpa1 UTSW 1 14875884 missense probably damaging 1.00
R0944:Trpa1 UTSW 1 14912361 splice site probably null
R0962:Trpa1 UTSW 1 14898163 missense possibly damaging 0.61
R1025:Trpa1 UTSW 1 14904183 missense probably benign 0.01
R1035:Trpa1 UTSW 1 14891303 critical splice donor site probably null
R1134:Trpa1 UTSW 1 14881748 missense possibly damaging 0.95
R1278:Trpa1 UTSW 1 14918723 critical splice donor site probably null
R1497:Trpa1 UTSW 1 14885812 missense probably benign 0.30
R1617:Trpa1 UTSW 1 14873675 missense probably damaging 1.00
R1800:Trpa1 UTSW 1 14874424 missense probably benign 0.04
R1856:Trpa1 UTSW 1 14899388 nonsense probably null
R1886:Trpa1 UTSW 1 14889425 missense probably benign 0.00
R2004:Trpa1 UTSW 1 14905983 missense possibly damaging 0.83
R2152:Trpa1 UTSW 1 14899401 missense probably damaging 1.00
R2172:Trpa1 UTSW 1 14881656 missense probably benign 0.01
R2198:Trpa1 UTSW 1 14910746 missense probably benign
R2221:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2223:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2307:Trpa1 UTSW 1 14912381 missense probably benign 0.00
R2338:Trpa1 UTSW 1 14884245 missense probably damaging 0.97
R2698:Trpa1 UTSW 1 14905998 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2873:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2874:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R3418:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3419:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3796:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R3799:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R4238:Trpa1 UTSW 1 14884116 missense probably damaging 1.00
R4320:Trpa1 UTSW 1 14874452 missense probably benign 0.00
R4591:Trpa1 UTSW 1 14882108 splice site probably null
R4834:Trpa1 UTSW 1 14896523 missense possibly damaging 0.72
R4991:Trpa1 UTSW 1 14910746 missense probably benign 0.00
R4999:Trpa1 UTSW 1 14875861 missense probably benign 0.05
R5038:Trpa1 UTSW 1 14910866 missense probably damaging 1.00
R5055:Trpa1 UTSW 1 14875959 missense probably damaging 1.00
R5158:Trpa1 UTSW 1 14881661 missense probably benign 0.01
R5193:Trpa1 UTSW 1 14875917 missense possibly damaging 0.92
R5558:Trpa1 UTSW 1 14898268 missense probably damaging 1.00
R5578:Trpa1 UTSW 1 14887008 missense probably damaging 1.00
R5680:Trpa1 UTSW 1 14875854 missense probably benign 0.00
R5738:Trpa1 UTSW 1 14875950 missense probably damaging 1.00
R5801:Trpa1 UTSW 1 14898078 missense probably damaging 1.00
R5945:Trpa1 UTSW 1 14898135 missense probably benign 0.03
R6092:Trpa1 UTSW 1 14889486 missense probably damaging 1.00
R6776:Trpa1 UTSW 1 14912377 missense probably benign
X0028:Trpa1 UTSW 1 14890420 missense probably benign 0.16
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-07-19 10:00 AM by Anne Murray
Record Created 2015-11-19 4:40 PM
Record Posted 2018-07-19
Phenotypic Description

Figure 1. Fear-2 mice exhibit decreased innate fear responses than wild-type littermates. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The fear-2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1035, some of which showed reduced innate fear/defensive behaviors compared to wild-type littermates after exposure to predator odor 2,4,5-trimethyl-3-thiazoline (TMT) and its potent analog 2-methyl-2-thiazoline (2MT) (1) (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced innate fear response using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 31 mutations (X-axis) identified in the G1 male of pedigree R1035. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 31 mutations. The reduced innate fear phenotype was linked by continuous variable mapping to a mutation in Trpa1: a T to C transition at base pair 14,891,303 (v38) on chromosome 1, or base pair 27,712 in the GenBank genomic region NC_000067 within the donor splice site of intron 15 (1). Linkage was found with a recessive model of inheritance to the fear response, wherein four variant homozygotes departed phenotypically from seven homozygous reference mice and six heterozygous mice with a P value of 2.134 x 10-11 (Figure 2).  

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 94-nucleotide exon 15 (out of 27 total exons), resulting in a frame-shifted protein product beginning after amino acid 605, and termination after the inclusion of two aberrant amino acids.

 

            <--exon 14        <--exon 15 intron 15-->    exon 16-->

25819 ……ATCAGAAATAAAAG ……CCCGAGTGCATGAAA gtaagcccaagtg…… GTTCTTTTAG……
601   ……-I--R--N--K--R ……-P--E--C--M--K-                 --F--F--*-
            correct          deleted                      aberrant

 

Genomic numbering corresponds to NC_000067. The donor splice site of intron 15, which is destroyed by the fear-2 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain organization and topology of TRPA1. The fear-2 mutation occurs in the donor splice site of intron 15. Domain and topology information is from SMART and UniProt. Other mutations found in TRPA1 are noted. Click on each mutation for more information.

Figure 4. Structure of the (human) TRPA1 ion channel. Domains are colored as in Figure 3. Figure generated by UCSF Chimera and is based on PDB:3J9P.

Transient receptor potential ankyrin 1 (TRPA1; alternatively, ANKTM1) is one of 28 members of the mammalian transient receptor potential (TRP) channel superfamily. The TRP channels can be subdivided into six subfamilies: TRP Canonical (TRPC), TRP Melastatin (TRPM), TRP Ankyrin (TRPA), TRP Mucolipin (TRPML), TRP Polycystin (TRPP), and TRP Vanilloid (TRPV). Mammals do not have a representative of the seventh TRP subfamily, TRPN (no mechanoreceptor potential C [nompC] TRP). TRPA1 is the only member of the TRPA family.

 

The TRP proteins have large intracellular N- and C-terminal tails as well as six transmembrane (TM)-spanning domains, with a putative hydrophobic, pore-forming region between the fifth and sixth domains. The TRP proteins have variable combinations of other domains within the cytoplasmic regions, including ankyrin repeats, coiled-coil regions, a NUDIX domain, an EF hand Ca2 +-binding motif, a CIRB motif, a PDZ motif, and a TRP box [reviewed in (2)].

 

The N-terminal tail of TRPA1 is 721 amino acids in length and contains 14 ankyrin repeats (Figure 3). TRPA1 also has three EF hands within the N-terminal tail that mediate channel activation in response to increased levels of intracellular calcium (3). The ankyrin repeat domain (ARD) is proposed to mediate trafficking of TRPA1 to the plasma membrane or plasma membrane insertion (4). In addition, ARDs facilitate protein-protein interactions. The ARD is proposed to function in the regulation of gating and integration of multiple stimuli. Three point mutations affecting the sixth ankyrin repeat of mouse TRPA1 makes the protein warm activated (5). The chemical sensitivity of the mutant channel was not affected.

 

Single-particle electron cryo-microscopy has been used to determine the structure of full-length human TRPA1 [Figure 4; PDB: 3J9P; (6)]. TRPA1 has a “TRP-like” domain in the C-terminal tail (6). The TRP domain is a short hydrophobic segment that is necessary for phosphatidylinositol 4,5-bisphosphate (PIP2) binding. PIP2 is a ubiquitously expressed phospholipid and regulator of channel function. Within the C-terminus is a coiled-coil that mediates subunit interactions.

 

Four pore-forming TRP subunits assemble as homo- or heterotetramers to comprise a TRP channel. In addition to forming a homotetramer, TRPA1 can form a heterotetrameric complex with TRPV1 in vitro (7). TRPA1 is proposed to form four disulfide bonds within the N-terminus. Cys619, Cys639, and Cys663 are conserved cysteines within the linker region between the ARD and the first transmembrane domain.

 

Gly878 in mouse and rat TM5 is proposed to mediate the cold sensing property of the mouse and rat TRPA1. TM5 is also a determinant of menthol sensitivity in mammalian TRPA1 channels (8). Mutation of Gly878 to valine, similar to what is found in human and monkey TRPA1 (Val875), resulted in loss of cold sensitivity in rat TRPA1 (9).

Expression/Localization

TRPA1 is expressed in the cerebellum, hippocampus, and forebrain (10) as well as in primary sensory neurons of the trigeminal, dorsal root, and nodose ganglia (11). TRPA1 is predominantly expressed in small-diameter, unmyelinated and partially myelinated C- and Aδ-fibers in the periphery. TRPA1 is also expressed in airway and lung epithelial and smooth muscle cells (12), peptidergic sensory neurons (13), enterochromaffin cells in the gastrointestinal tract (14;15), pancreas (16), the inner ear (17), skin (14), dental pulp (18), vascular endothelia, and airway epithelial cells (12;17).

Background
Figure 5. TRPA1 signaling. Activated TRPA1 on the central terminals of primary sensory neurons putatively dampens pain signaling to dorsal horn neurons by depolarizing the membrane and by inhibiting voltage-gated sodium and calcium channels. Agonists (2MT/TMT shown) bind to TRPA1 resulting in TRPA1 activation. GPCR-dependent activation of PLC results in removal of PIP2-assoicated TRPA1 inhibition. PLC also promotes IP3-associated calcium release from intracellular stores. TRPA1 putatively enhances bradykinin B2- and prostaglandin EP3 receptor-associated signaling.

The TRPV, TRPM, and TPRA subfamilies function in the sensory detection transduction of nociception and pain. The TRP channels respond to several external stimuli such as light (i.e. phototransduction), chemicals, and temperature as well as mechanical and osmotic pressures (19-23). TRP channels have roles in diverse processes including olfaction, nociception, speech, regulation of blood circulation, pain signal transduction, gut motility, mineral absorption, fluid balance epithelial Ca2+ transport, development of airway and bladder hypersensitivities, cell survival, growth, and death (19).

 

The TRP channels function by facilitating the transmembrane flow of cations (i.e. Na+ and Ca2+) down electrochemical gradients to depolarize the cell as well as to mediate signal transduction (24;25). TRP channels can be activated through the activation of phospholipase C (PLC) by G protein-coupled receptors and receptor tyrosine kinases.  Activation of PLC leads to hydrolysis of PIP2, producing diacylglycerol (DAG) and inositol (1,4,5) triphosphate (IP3) (Figure 5). PIP2 hydrolysis and DAG production modulate TRP channel activity. The TRP channels can also be activated by exogenous small organic molecules (e.g. capsaicin), endogenous lipids, purine nucleotides and their metabolites (e.g. adenosine diphosphoribose (ADP-ribose)), and inorganic ions (e.g. Ca2+ and Mg2+) (25). TRP channels can also be directly activated by temperature changes, mechanical stimuli, coupling to IP3 receptors, cell swelling, channel phosphorylation through protein kinases A, C, and G (PKA, PKC, and PKG, respectively), and Ca2+/calmodulin signaling (25). The function of TRP channels as “store-operated calcium entry” channels activated by IP3-mediated release of intracellular Ca2+ stores is controversial (25).

 

TRPA1 is activated by several stimulants, including allyl isothiocyanate (AITC; a compound in horseradish, wasabi, and mustard), allicin and diallyl disulfide (in raw garlic), cinnamaldehyde (in cinnamon), gingerol (in ginger), thymol (in thyme), eugenol (in cloves), and carvacrol (in oregano), and acrolein and tear gas (environmental irritants). TRPA1 can also be activated by endogenous stimulants and inflammatory proteins, including reactive oxygen, nitrogen, and carbonyl species, hydrogen peroxide, peroxynitrite, and 4-hydroxynonenal (26;27). TRPA1 activation by inflammatory proteins facilitates the transduction of nociceptive signals related to tissue damage and inflammation. After injury, the cyclooxygenase pathway leads to the production of prostaglandins. The prostaglandin 15-deoxy-Δ12,14-prostaglandin J2 (15d-PGJ2) activates dissociated dorsal root ganglion cells (28).

 

The role of TRPA1 in sensing cold temperatures is controversial; however, the role of TRPA1 in mediating cold hypersensitivity in models of neuropathic pain has been shown (26). While primate TRPA1 can be activated by cold temperatures, rodent TRPA1 is insensitive to cold temperatures. The differences between the studies have been attributed to differences in experimental conditions (e.g., expression system and expression level). Also, the differences may be due to species-specific properties of TRPA1. In a study that performed a side-by-side comparison of mouse, rat, human, and monkey TRPA1 under identical conditions determined that all four TRPA1s were potentiated by AITC, while cold only activated the mouse and rat orthologs. The primate TRPA1s were insensitive to temperature changes.

 

TRPA1 is associated with bradykinin B2 and prostaglandin EP3 receptor-associated signaling (29). When TRPA1 was coexpressed with the bradykinin receptor and the M1 muscarinic acetylcholine receptor, a dramatic increase in the magnitude of the signal was observed compared to when the proteins were expressed alone.

 

In humans, patients with elevated pain sensitivity exhibit differential DNA methylation in the vicinity of the TRPA1 gene, indicating that this may be a contributing factor in individual differences in pain sensitivity (30). A gain-of-function mutation in TRPA1 (N855S) is linked to familial episodic pain syndrome (FEPS; OMIM: #615040) (31). FEPS is an autosomal dominant neurological disorder characterized by early-onset of episodic upper body pain triggered by fatigue, fasting, cold, illness, and/or physical exertion (31). The pain episodes also included breathing difficulties, tachycardia, sweating, generalized pallor, peribuccal cyanosis, and stiffness of the abdominal wall. The patients did not report altered pain sensitivity outside of the episodes.

 

TRPA1 functions in several inflammatory conditions, including allergic contact dermatitis (32). The activation of TRPA1-expressing nerve fibers in the lung promotes neurogenic inflammation, subsequently contributing to airway constriction and cough in patients with asthma and other respiratory disorders (33;34). TRPA1 functions in conditions of chronic itch whereby it is involved in the transduction of the itching sensation as well as in the changes that occur in the skin associated with chronic itch (35).

 

Trpa1-deficient (Trpa1-/-) mice exhibit behavioral deficits in response to mechanical stimulation, AITC, and cold temperatures (36). Two independent knockout mouse models were generated and characterized. One model was reported to not have menthol-insensitive, cold-activated trigeminal neurons (37). In addition, this model was comparable to wild-type mice in the latency to lift the paw in cold plate assays, flinching in acetone-induced cooling of the paw, and in temperature preference assay (37). Bautista et al. concluded that TRPA1 does not behave as a cold sensor. In the second TRPA1 knockout model, the mice exhibited reduced paw lifting upon exposure to a cold plate as well as reduced responses to acetone application compared to wild-type mice ((36).

Putative Mechanism
Figure 6. Trpa1 mediates 2MT/TMT/snake skin-evoked innate fear/defensive responses. Wild-type, heterozygous, and homozygous Trpa1 knockout mice were examined for innate freezing behaviors evoked by 2MT or TMT. Data are presented as mean ± SEM (Student’s t-test, ***P < 0.001; **P < 0.01; ns not significant). Figure and legend adapted from (1).
Figure 7. Trpa1−/− mice can smell and learn to fear 2MT. (a) Representative images showing c-fos mRNA in situ hybridization (ISH) of the central nucleus of amygdala (CeA), paraventricular nucleus (PVN) of hypothalamus, ventral periaqueductal gray (vPAG), olfactory bulb (OB), and cortical amygdala (CoA) regions of the brains of 2MT-exposed Trpa1+/− and Trpa1−/− mice (bar: 100 µm). (b) Quantitative analysis of c-fos-positive neurons in the CeA, PVN, vPAG, OB, and CoA of Trpa1+/− and Trpa1−/− mouse brains (a). The relative measure (%) of c-fos signals of Trpa1−/− samples is normalized to those of Trpa1+/− controls. Data are presented as mean ± SEM (n = 4, Student’s t-test, ***P < 0.001; ns not significant). Figure and legend adapted from (1).

TRPA1 acts as a chemosensor for 2MT/TMT (1). Trpa1−/− mice displayed diminished freezing response to 2MT or TMT as compared to wild-type and heterozygous littermates (Figure 6) (1). 2MT-evoked c-fos induction was reduced in the CeA, vPAG, and the paraventricular nucleus (PVN) of the hypothalamus in Trpa1−/− brains relative to that in Trpa1+/− brains (Figure 7).

Primers PCR Primer
fear-2(F):5'- TCCCTACTTTCTGAGGAGGCAGTC -3'
fear-2(R):5'- TGACCAGCAATGCCAAGCAGTG -3'

Sequencing Primer
fear-2_seq(F):5'- TGTGAAGAGCATTCATTCAGC -3'
fear-2_seq(R):5'- CTCCAAGCAATCGATGTCCAATC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsQinghua Liu and Bruce Beutler
List |< first << previous [record 23 of 74] next >> last >|