Phenotypic Mutation 'inwood2'

• Allele: inwood2
• Mutation Type: nonsense
• Chromosome: 13
• Coordinate: 100,223,014 bp (GRCm38)
• Base Change: G ⇒ T (forward strand)
• Gene: Naip5
• Gene Name: NLR family, apoptosis inhibitory protein 5
• Synonym(s): Birc1e, Lgn1, Naip-rs3
• Chromosomal Location: 100,211,739-100,246,323 bp (-)
• MGI Phenotype: PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000058611]
• AlphaFold: Q9R016
• SMART Domains: Protein: ENSMUSP00000058611; Gene: ENSMUSG00000071203; AA Change: Y571*

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
BIR	58	129	1.08e-19	SMART
BIR	157	229	1.06e-36	SMART
BIR	276	347	2.14e-32	SMART
Pfam:NACHT	464	618	1.7e-36	PFAM
low complexity region	851	862	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.132)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-11-29 11:01 PM by Hexin Shi
• Record Posted: 2015-12-23
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Hexin Shi and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010870; MGI:1298220

Alleles Listed at MGI

All Mutations and Alleles(3) : Spontaneous(1) Targeted(1) Transgenic(1)

Phenotypic Description

Figure 1. Inwood2 mice exhibited decreased IL-1β secretion in response to priming with flagellin. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The inwood2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3723, some of which exhibited impaired peritoneal macrophage NLRC4 inflammasome responses, marked by decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with flagellin (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced NLRC4 inflammasome function using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R3723. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. The diminished NLRC4 inflammasome function phenotype was linked by continuous variable mapping to a mutation in Naip5: a C to A transversion at base pair 100,223,014 (v38) on chromosome 13, or base pair 31,758 in the GenBank genomic region NC_000079 for the Naip5 gene. Linkage was found with a recessive model of inheritance (P = 4.547 x 10^-5), wherein four variant homozygotes departed phenotypically from 17 homozygous reference mice and 27 heterozygous mice (Figure 2).  

The mutation corresponds to residue 1,926 in the mRNA sequence NM_010870 within exon 9 of 14 total exons.

1909 CTGATTACAAAAAACTACTTGTCACGGACCTGC 566  -L--I--T--K--N--Y--L--S--R--T--C-

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine (Y) 571 for a premature stop codon (Y571*) in the NAIP5 protein.

Protein Prediction

Figure 3. Protein domain structure of NAIP5. Shown are the baculovirus inhibitor of apoptosis repeats (BIRs), the NACHT [NAIP (neuronal apoptosis inhibitor protein), C2TA (MHC class 2 transcription activator), HET-E (incompatibility locus protein from Podospora anserina) and TP1 (telomerase-associated protein)] domain, and the leucine-rich repeat (LRR) region. The amino acid altered by the inwood2 mutation is shown. The image is interactive; click to view other Naip5 mutations.

Neuronal apoptosis inhibitor protein 5 [NAIP5; alternatively, baculoviral inhibitor of apoptosis protein (IAP) repeat-containing 1e (Birc1e)] is a member of the NACHT-LRR (NLR) family of cytosolic proteins that recognize pathogen-associated molecular patterns (PAMPs) on pathogens. NACHT-LRR is an acronym for NAIP (neuronal apoptosis inhibitor protein), C2TA (MHC class 2 transcription activator), HET-E (incompatibility locus protein from Podospora anserina), and TP1 (telomerase-associated protein)-leucine-rich repeat.

The NLR proteins have similar domains, including a conserved NACHT domain [alternatively, nucleotide-binding domain (NBD)] that mediates protein dimerization, a conserved leucine-rich repeat (LRR) region that recognizes ligands, and a signaling module (alternatively, effector domain) that assists in binding downstream signaling molecules. The signaling modules are unique to each subclass of NLR family members. For example, the NLRC proteins have caspase recruitment domains (CARDs), the NLRP proteins have a pyrin domain (PYD), and the NAIP proteins have baculovirus inhibitor of apoptosis repeats (BIRs). NAIP5 has three BIRs (amino acids 60-127, 159-227, and 278-345), a NACHT domain (amino acids 464-648, SMART), and several leucine-rich repeats (LRRs) [Figure 3; reviewed in (1)]. The BIR1 and BIR2 domains, but not the BIR3 domain, are required for NAIP5-associated responses to Legionella pneumophila (L. pneumophila) infection (2). NAIP5 and NLRC4 interact via the NACHT domain. The LRR region is proposed to function in the recognition of microbes, whereby promoting NAIP5 oligomerization. Deletion of the LRR domain results in diminished response to bacterial infection and low constitutive activity (2).

Four NAIP proteins, NAIP1, NAIP2, NAIP5, and NAIP6, are expressed in the mouse from a multigene cluster on chromosome 13qD1 (3); there is a single known human NAIP ortholog. Mouse NAIP1 and human NAIP recognize type III secretion system (T3SS) needle proteins, NAIP2 binds with the T3SS rod component PrgJ, and NAIP5 and NAIP6 interact with flagellin (4).

The inwood2 mutation results in the substitution of tyrosine (Y) 571 for a premature stop codon. Tyr571 is within the NACHT domain.

Expression/Localization

Naip5 mRNA is highly expressed in the intestinal tract, spleen, lung, liver, and isolated primary macrophages (5). NAIP5 protein is expressed in the ileum, colon, spleen, and macrophages (5).

Background

Figure 4. Activation of the NLRC4 inflammasome. Infection of macrophages with various gram-negative bacteria activates caspase-1 via NLRC4. A critical step is the cytosolic delivery of flagellin or proteins through the bacterial T3SS or T4SS. Flagellin is recognized by Naip5 or Naip6, whereas rod proteins are recognized by Naip2. S. flexneri activates the NLRC4 inflammasome independently of flagellin through IpaB. Activation of caspase-1 via NLRC4 leads to the processing and release of IL-1β and IL-18, the processing of caspase-7, and pyroptosis. The image is interactive; click to view other mutations associated with the NLRC4 inflammasome. This image is interactive; click to view other mutations associated with the NLRC4 inflammasome pathway.

Members of the NLR family, including NLRC4 (see the record for inwood), NLRP1b, and NLRP3 (see the record for Nd1), are able to oligomerize through their NACHT domains and assemble into large caspase-1-activating multiprotein complexes, termed inflammasomes, upon the detection of pathogenic or other danger signals in the cytoplasm. Inflammasome assembly is activated in response to diverse signals, including pathogens, DNA, single-stranded (ss) RNA, double-stranded (ds) RNA, bacterial toxins, and environmental irritants as well as endogenous danger signals [reviewed by (6;7)]. 

The NLRC4 inflammasome stimulates caspase-1 activation and subsequent IL-1β secretion from macrophages after exposure to lipopolysaccharide, peptidoglycan, and pathogenic bacteria (Figure 4) (8). Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18 and IL-33 to generate biologically active proteins. In turn, these cytokines mediate a wide variety of biological effects associated with infection, inflammation, and autoimmune processes by activating the nuclear factor κB (NF-κB; see the record for panr2) and mitogen-activated protein kinase (MAPK; see the record for wabasha) signaling pathways. For more information about the NLRC4 inflammasome, please see the record for inwood.

The NAIP5/NLRC4 inflammasome is primarily activated by Gram-negative bacteria including L. pneumophila (2;3;9), Aeromonas veronii (10), Pseudomonas aeruginosa (11), Salmonella enterica serovar typhimurium (S. typhimurium) (11-14), Yersinia pestis (15), and Shigella flexneri (16). NLRC4-mediated responses to S. typhimurium are only partially dependent on NAIP5 (9). NAIP5 is essential for NLRC4 inflammasome activation by L. pneumophila, a Gram-negative bacteria found in aquatic environments and leads to a severe form of pneumonia called Legionnaires’ disease (2;9;17-19). L. pneumophila is ingested by phagocytic cells, and survives in a vacuole that segregates from the endocytic network (20).  The L. pneumophila-containing phagosomes do not mature into phagolysosomes, but the L. pneumophila localizes within a membrane-bound vacuole. L. pneumophila infection requires flagellin (21;22). Inside of host macrophages, L. pneumophila induces the expression of genes that encode factors in the Dot/Icm T4SS (23;24). NAIP5 interacts with the 35 C-terminal amino acids as well as the conserved N-helix of flagellin (25). After cytosolic flagellin recognition, NAIP5 associates with NLRC4, forming an oligomeric complex, and subsequently leading to the activation of caspase-1 in a TLR5-independent manner (26;27). The NLRC4 inflammasome promotes both caspase-1-dependent and –independent responses to restrict the growth of L. pneumonphila (22;28). In addition, caspase-7 is activated downstream of the NLRC4 inflammasome (24).

NAIP5, NLRC4, and caspase-1 are required for the activation of inducible nitric oxide synthase (iNOS) and secretion of nitric oxide (NO) in response to cytosolic flagellin in a TLR5-, IL-1β-, and IL-18-independent manner (29). NAIP5/NLRC4/caspase-1-dependent NO secretion controls L. pneumophila (29) and S. typhimurium growth. The NAIP5/NLRC4 inflammasome is also proposed to mediate the activation of the cytoplasmic enzyme phospholipase A2 (cPLA2) with a subsequent production of lipid inflammatory mediators including prostaglandins and leukotrienes (30). Stimulation with flagellin initiates inflammation and loss of vascular fluids, leading to rapid death in mice in an IL-1β/IL-18- or necroptosis-independent manner.

Naip5 alleles determine macrophage permissiveness to L. pneumophila replication (3;31). For example, L. pneumophila proliferates in macrophages derived from A/J mice, but in cultures derived from other strains (e.g., C57BL/6J), proliferation of L. pneumophila is not noted. The A/J Naip5 allele only exhibits a slight defect in pyroptosis and caspase-1 activation in response to L. pneumophila infection (9). There are 14 amino acid substitutions between C57BL/6 and A/J NAIP5 proteins (3). A/J macrophages are able to restrict the intracellular replication of other intracellular pathogens, including Salmonella, Mycobacterium bovis, and Leishmania donovani, indicating that the permissiveness is specific to the replication of L. pneumophila. The alteration in L. pneumophila permissiveness is due to change in NAIP5 function (3;18).  A/J and C57BL/6 mice produce equivalent amounts of IL-6, IL-12, and Cxc11, but A/J mice fail to produce IL-18 (32).

Putative Mechanism

Naip5-deficient (Naip5^-/-) macrophages cannot activate caspase-1, release IL-1β, or promote pyroptosis in response to L. pneumophila infection (9). The reduced amount of IL-1β observed in the inwood2 mice in response to flagellin indicates a loss-of-function in NAIP5^inwood2.

Primers

PCR Primer
inwood2_pcr_F: ACTGCTGCTACAAAGAGAGG
inwood2_pcr_R: TGGCCAACATCATCTGTGCC

Sequencing Primer
inwood2_seq_F: AGAGGGGTCTTGTAAACTCCC
inwood2_seq_R: ATCTGTGCCCAACTCCTAGGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 13, - strand):

1   tggccaacat catctgtgcc caactcctag gggcaggagg ttgcattagt gaagtgtgtc
61  tgagcagcag catccagcag ttacaacacc aggtgctgtt cctgttggat gactacagtg
121 ggctggcctc actcccccaa gccctacaca cactgattac aaaaaactac ttgtcacgga
181 cctgcttatt gatcgctgtg catacaaaca gggtcagaga catccgccta tacctaggta
241 caagtctaga gatccaagag tttcccttct ataatactgt ctctgtatta cggaagtttt
301 tttcacatga cataatctgt gtggaaaagc ttataattta ctttattgat aataaagatt
361 tacagggagt ttacaagacc cctctctttg tagcagcagt 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Inohara, Chamaillard, McDonald, C., and Nunez, G. (2005) NOD-LRR Proteins: Role in Host-Microbial Interactions and Inflammatory Disease. Annu Rev Biochem. 74, 355-383.

  2. Zamboni, D. S., Kobayashi, K. S., Kohlsdorf, T., Ogura, Y., Long, E. M., Vance, R. E., Kuida, K., Mariathasan, S., Dixit, V. M., Flavell, R. A., Dietrich, W. F., and Roy, C. R. (2006) The Birc1e Cytosolic Pattern-Recognition Receptor Contributes to the Detection and Control of Legionella Pneumophila Infection. Nat Immunol. 7, 318-325.

  3. Wright, E. K., Goodart, S. A., Growney, J. D., Hadinoto, V., Endrizzi, M. G., Long, E. M., Sadigh, K., Abney, A. L., Bernstein-Hanley, I., and Dietrich, W. F. (2003) Naip5 Affects Host Susceptibility to the Intracellular Pathogen Legionella Pneumophila. Curr Biol. 13, 27-36.

  4. Kofoed, E. M., and Vance, R. E. (2011) Innate Immune Recognition of Bacterial Ligands by NAIPs Determines Inflammasome Specificity. Nature. 477, 592-595.

  5. Diez, E., Yaraghi, Z., MacKenzie, A., and Gros, P. (2000) The Neuronal Apoptosis Inhibitory Protein (Naip) is Expressed in Macrophages and is Modulated After Phagocytosis and during Intracellular Infection with Legionella Pneumophila. J Immunol. 164, 1470-1477.

  6. Schroder, K., Zhou, R., and Tschopp, J. (2010) The NLRP3 Inflammasome: A Sensor for Metabolic Danger? Science. 327, 296-300.

  7. Tschopp, J., and Schroder, K. (2010) NLRP3 Inflammasome Activation: The Convergence of Multiple Signalling Pathways on ROS Production? Nat Rev Immunol. 10, 210-215.

  8. Damiano, J. S., Newman, R. M., and Reed, J. C. (2004) Multiple Roles of CLAN (Caspase-Associated Recruitment Domain, Leucine-Rich Repeat, and NAIP CIIA HET-E, and TP1-Containing Protein) in the Mammalian Innate Immune Response. J Immunol. 173, 6338-6345.

  9. Lightfield, K. L., Persson, J., Brubaker, S. W., Witte, C. E., von Moltke, J., Dunipace, E. A., Henry, T., Sun, Y. H., Cado, D., Dietrich, W. F., Monack, D. M., Tsolis, R. M., and Vance, R. E. (2008) Critical Function for Naip5 in Inflammasome Activation by a Conserved Carboxy-Terminal Domain of Flagellin. Nat Immunol. 9, 1171-1178.

  10. McCoy, A. J., Koizumi, Y., Higa, N., and Suzuki, T. (2010) Differential Regulation of Caspase-1 Activation Via NLRP3/NLRC4 Inflammasomes Mediated by Aerolysin and Type III Secretion System during Aeromonas Veronii Infection. J Immunol. 185, 7077-7084.

  11. Miao, E. A., Alpuche-Aranda, C. M., Dors, M., Clark, A. E., Bader, M. W., Miller, S. I., and Aderem, A. (2006) Cytoplasmic Flagellin Activates Caspase-1 and Secretion of Interleukin 1beta Via Ipaf. Nat Immunol. 7, 569-575.

  12. Miao, E. A., Mao, D. P., Yudkovsky, N., Bonneau, R., Lorang, C. G., Warren, S. E., Leaf, I. A., and Aderem, A. (2010) Innate Immune Detection of the Type III Secretion Apparatus through the NLRC4 Inflammasome. Proc Natl Acad Sci U S A. 107, 3076-3080.

  13. Broz, P., Newton, K., Lamkanfi, M., Mariathasan, S., Dixit, V. M., and Monack, D. M. (2010) Redundant Roles for Inflammasome Receptors NLRP3 and NLRC4 in Host Defense Against Salmonella. J Exp Med. 207, 1745-1755.

  14. Franchi, L., Amer, A., Body-Malapel, M., Kanneganti, T. D., Ozoren, N., Jagirdar, R., Inohara, N., Vandenabeele, P., Bertin, J., Coyle, A., Grant, E. P., and Nunez, G. (2006) Cytosolic Flagellin Requires Ipaf for Activation of Caspase-1 and Interleukin 1beta in Salmonella-Infected Macrophages. Nat Immunol. 7, 576-582.

  15. Brodsky, I. E., Palm, N. W., Sadanand, S., Ryndak, M. B., Sutterwala, F. S., Flavell, R. A., Bliska, J. B., and Medzhitov, R. (2010) A Yersinia Effector Protein Promotes Virulence by Preventing Inflammasome Recognition of the Type III Secretion System. Cell Host Microbe. 7, 376-387.

  16. Suzuki, T., Franchi, L., Toma, C., Ashida, H., Ogawa, M., Yoshikawa, Y., Mimuro, H., Inohara, N., Sasakawa, C., and Nunez, G. (2007) Differential Regulation of Caspase-1 Activation, Pyroptosis, and Autophagy Via Ipaf and ASC in Shigella-Infected Macrophages. PLoS Pathog. 3, e111.

  17. Lamkanfi, M., Amer, A., Kanneganti, T. D., Munoz-Planillo, R., Chen, G., Vandenabeele, P., Fortier, A., Gros, P., and Nunez, G. (2007) The Nod-Like Receptor Family Member Naip5/Birc1e Restricts Legionella Pneumophila Growth Independently of Caspase-1 Activation. J Immunol. 178, 8022-8027.

  18. Diez, E., Lee, S. H., Gauthier, S., Yaraghi, Z., Tremblay, M., Vidal, S., and Gros, P. (2003) Birc1e is the Gene within the Lgn1 Locus Associated with Resistance to Legionella Pneumophila. Nat Genet. 33, 55-60.

  19. Coers, J., Vance, R. E., Fontana, M. F., and Dietrich, W. F. (2007) Restriction of Legionella Pneumophila Growth in Macrophages Requires the Concerted Action of Cytokine and Naip5/Ipaf Signalling Pathways. Cell Microbiol. 9, 2344-2357.

  20. Fortier, A., Diez, E., and Gros, P. (2005) Naip5/Birc1e and Susceptibility to Legionella Pneumophila. Trends Microbiol. 13, 328-335.

  21. Pereira, M. S., Marques, G. G., Dellama, J. E., and Zamboni, D. S. (2011) The Nlrc4 Inflammasome Contributes to Restriction of Pulmonary Infection by Flagellated Legionella Spp. that Trigger Pyroptosis. Front Microbiol. 2, 33.

  22. Pereira, M. S., Morgantetti, G. F., Massis, L. M., Horta, C. V., Hori, J. I., and Zamboni, D. S. (2011) Activation of NLRC4 by Flagellated Bacteria Triggers Caspase-1-Dependent and -Independent Responses to Restrict Legionella Pneumophila Replication in Macrophages and in Vivo. J Immunol. 187, 6447-6455.

  23. Amer, A., Franchi, L., Kanneganti, T. D., Body-Malapel, M., Ozoren, N., Brady, G., Meshinchi, S., Jagirdar, R., Gewirtz, A., Akira, S., and Nunez, G. (2006) Regulation of Legionella Phagosome Maturation and Infection through Flagellin and Host Ipaf. J Biol Chem. 281, 35217-35223.

  24. Akhter, A., Gavrilin, M. A., Frantz, L., Washington, S., Ditty, C., Limoli, D., Day, C., Sarkar, A., Newland, C., Butchar, J., Marsh, C. B., Wewers, M. D., Tridandapani, S., Kanneganti, T. D., and Amer, A. O. (2009) Caspase-7 Activation by the Nlrc4/Ipaf Inflammasome Restricts Legionella Pneumophila Infection. PLoS Pathog. 5, e1000361.

  25. Halff, E. F., Diebolder, C. A., Versteeg, M., Schouten, A., Brondijk, T. H., and Huizinga, E. G. (2012) Formation and Structure of a NAIP5-NLRC4 Inflammasome Induced by Direct Interactions with Conserved N- and C-Terminal Regions of Flagellin. J Biol Chem. 287, 38460-38472.

  26. Lightfield, K. L., Persson, J., Trinidad, N. J., Brubaker, S. W., Kofoed, E. M., Sauer, J. D., Dunipace, E. A., Warren, S. E., Miao, E. A., and Vance, R. E. (2011) Differential Requirements for NAIP5 in Activation of the NLRC4 Inflammasome. Infect Immun. 79, 1606-1614.

  27. Zhao, Y., Yang, J., Shi, J., Gong, Y. N., Lu, Q., Xu, H., Liu, L., and Shao, F. (2011) The NLRC4 Inflammasome Receptors for Bacterial Flagellin and Type III Secretion Apparatus. Nature. 477, 596-600.

  28. Case, C. L., Shin, S., and Roy, C. R. (2009) Asc and Ipaf Inflammasomes Direct Distinct Pathways for Caspase-1 Activation in Response to Legionella Pneumophila. Infect Immun. 77, 1981-1991.

  29. Buzzo, C. L., Campopiano, J. C., Massis, L. M., Lage, S. L., Cassado, A. A., Leme-Souza, R., Cunha, L. D., Russo, M., Zamboni, D. S., Amarante-Mendes, G. P., and Bortoluci, K. R. (2010) A Novel Pathway for Inducible Nitric-Oxide Synthase Activation through Inflammasomes. J Biol Chem. 285, 32087-32095.

  30. von Moltke, J., Trinidad, N. J., Moayeri, M., Kintzer, A. F., Wang, S. B., van Rooijen, N., Brown, C. R., Krantz, B. A., Leppla, S. H., Gronert, K., and Vance, R. E. (2012) Rapid Induction of Inflammatory Lipid Mediators by the Inflammasome in Vivo. Nature. 490, 107-111.

  31. Fortier, A., de Chastellier, C., Balor, S., and Gros, P. (2007) Birc1e/Naip5 Rapidly Antagonizes Modulation of Phagosome Maturation by Legionella Pneumophila. Cell Microbiol. 9, 910-923.

  32. Lopez-Yglesias, A. H., Zhao, X., Quarles, E. K., Lai, M. A., VandenBos, T., Strong, R. K., and Smith, K. D. (2014) Flagellin Induces Antibody Responses through a TLR5- and Inflammasome-Independent Pathway. J Immunol. 192, 1587-1596.