Phenotypic Mutation 'inwood3' (pdf version)
Alleleinwood3
Mutation Type nonsense
Chromosome13
Coordinate100,358,411 bp (GRCm39)
Base Change G ⇒ A (forward strand)
Gene Naip5
Gene Name NLR family, apoptosis inhibitory protein 5
Synonym(s) Birc1e, Naip-rs3, Lgn1
Chromosomal Location 100,348,247-100,382,831 bp (-) (GRCm39)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010870; MGI:1298220

MappedYes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000058611]
AlphaFold Q9R016
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: Q942*

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Probably nonessential (E-score: 0.079) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(3) : Spontaneous(1) Targeted(1) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100382683 nonsense probably null
IGL00493:Naip5 APN 13 100367279 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100353588 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100358453 missense probably benign 0.11
IGL01568:Naip5 APN 13 100353609 missense probably benign 0.26
IGL01804:Naip5 APN 13 100358092 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100359847 missense probably benign 0.01
IGL02183:Naip5 APN 13 100358150 missense probably benign 0.41
IGL02449:Naip5 APN 13 100358683 missense probably benign 0.34
IGL02815:Naip5 APN 13 100359239 missense probably benign
IGL02992:Naip5 APN 13 100359536 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100359524 missense probably benign 0.00
IGL03234:Naip5 APN 13 100349135 missense probably damaging 1.00
inwood2 UTSW 13 100359522 nonsense probably null
Nuchal UTSW 13 100351171 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100356268 missense probably benign 0.00
PIT4131001:Naip5 UTSW 13 100356247 missense probably benign
R0001:Naip5 UTSW 13 100359622 missense probably benign
R0001:Naip5 UTSW 13 100351158 critical splice donor site probably null
R0462:Naip5 UTSW 13 100358240 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100356196 missense probably benign
R0674:Naip5 UTSW 13 100359707 missense probably benign 0.04
R0764:Naip5 UTSW 13 100353613 missense probably benign 0.03
R0837:Naip5 UTSW 13 100367251 missense probably benign
R1179:Naip5 UTSW 13 100356338 missense probably benign
R1302:Naip5 UTSW 13 100358099 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100356225 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100358714 missense probably benign
R1638:Naip5 UTSW 13 100349177 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100358419 missense probably benign 0.41
R1707:Naip5 UTSW 13 100379363 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100359726 nonsense probably null
R1836:Naip5 UTSW 13 100356195 missense probably benign 0.18
R1972:Naip5 UTSW 13 100349278 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100358041 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100359679 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100356246 missense probably benign 0.01
R3055:Naip5 UTSW 13 100358386 missense probably benign 0.23
R3401:Naip5 UTSW 13 100358411 nonsense probably null
R3723:Naip5 UTSW 13 100359522 nonsense probably null
R3775:Naip5 UTSW 13 100359883 missense probably benign 0.00
R3775:Naip5 UTSW 13 100359902 missense probably benign 0.00
R4019:Naip5 UTSW 13 100359883 missense probably benign 0.00
R4019:Naip5 UTSW 13 100359902 missense probably benign 0.00
R4020:Naip5 UTSW 13 100359902 missense probably benign 0.00
R4020:Naip5 UTSW 13 100359883 missense probably benign 0.00
R4074:Naip5 UTSW 13 100382572 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100382338 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100356247 missense probably benign
R4227:Naip5 UTSW 13 100349276 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100356338 missense probably benign
R4640:Naip5 UTSW 13 100356338 missense probably benign
R4641:Naip5 UTSW 13 100356338 missense probably benign
R4644:Naip5 UTSW 13 100356338 missense probably benign
R4645:Naip5 UTSW 13 100356338 missense probably benign
R4700:Naip5 UTSW 13 100359922 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100358378 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100358639 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100356189 missense probably benign 0.32
R4816:Naip5 UTSW 13 100356195 missense probably benign 0.01
R4816:Naip5 UTSW 13 100356204 missense probably benign 0.00
R4869:Naip5 UTSW 13 100381639 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100359914 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100382170 missense probably benign 0.08
R5411:Naip5 UTSW 13 100382254 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100367170 splice site probably null
R5760:Naip5 UTSW 13 100379346 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100359209 missense probably benign 0.02
R6302:Naip5 UTSW 13 100359674 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100359674 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100359913 missense probably benign 0.01
R6474:Naip5 UTSW 13 100351171 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100358102 missense probably benign
R6544:Naip5 UTSW 13 100359652 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100382437 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100359922 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100358855 missense probably benign 0.01
R7138:Naip5 UTSW 13 100356338 missense probably benign
R7141:Naip5 UTSW 13 100356338 missense probably benign
R7375:Naip5 UTSW 13 100356204 missense probably benign 0.00
R7375:Naip5 UTSW 13 100356205 missense not run
R7401:Naip5 UTSW 13 100356204 missense probably benign 0.00
R7401:Naip5 UTSW 13 100356205 missense not run
R7447:Naip5 UTSW 13 100356204 missense probably benign 0.00
R7447:Naip5 UTSW 13 100356205 missense not run
R7466:Naip5 UTSW 13 100358494 nonsense probably null
R7491:Naip5 UTSW 13 100353579 missense probably benign 0.18
R7559:Naip5 UTSW 13 100356205 missense not run
R7559:Naip5 UTSW 13 100356204 missense probably benign 0.00
R7562:Naip5 UTSW 13 100356205 missense not run
R7562:Naip5 UTSW 13 100356204 missense probably benign 0.00
R7588:Naip5 UTSW 13 100356205 missense not run
R7588:Naip5 UTSW 13 100356204 missense probably benign 0.00
R7589:Naip5 UTSW 13 100356205 missense not run
R7589:Naip5 UTSW 13 100356204 missense probably benign 0.00
R7590:Naip5 UTSW 13 100356205 missense not run
R7590:Naip5 UTSW 13 100356204 missense probably benign 0.00
R7742:Naip5 UTSW 13 100356338 missense probably benign
R7886:Naip5 UTSW 13 100382689 missense probably benign 0.28
R7996:Naip5 UTSW 13 100358164 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100382406 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100358741 missense probably benign
R8319:Naip5 UTSW 13 100358167 missense probably benign 0.12
R8471:Naip5 UTSW 13 100358153 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100358743 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100349247 missense probably benign 0.00
R8500:Naip5 UTSW 13 100359220 missense probably damaging 0.98
R8712:Naip5 UTSW 13 100359604 missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100356338 missense probably benign
R8781:Naip5 UTSW 13 100356338 missense probably benign
R8788:Naip5 UTSW 13 100356338 missense probably benign
R8817:Naip5 UTSW 13 100349207 missense probably benign 0.01
R8833:Naip5 UTSW 13 100359442 missense probably damaging 0.97
R8835:Naip5 UTSW 13 100356338 missense probably benign
R8958:Naip5 UTSW 13 100354117 nonsense probably null
R9031:Naip5 UTSW 13 100356338 missense probably benign
R9032:Naip5 UTSW 13 100356338 missense probably benign
R9074:Naip5 UTSW 13 100358264 missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100366127 missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100359008 missense probably damaging 1.00
R9223:Naip5 UTSW 13 100364184 missense probably benign 0.05
R9358:Naip5 UTSW 13 100356338 missense probably benign
R9389:Naip5 UTSW 13 100356338 missense probably benign
R9403:Naip5 UTSW 13 100356338 missense probably benign
R9518:Naip5 UTSW 13 100358367 missense probably benign
R9568:Naip5 UTSW 13 100359821 missense probably benign 0.00
R9568:Naip5 UTSW 13 100356338 missense probably benign
R9569:Naip5 UTSW 13 100359821 missense probably benign 0.00
R9569:Naip5 UTSW 13 100356338 missense probably benign
R9570:Naip5 UTSW 13 100359821 missense probably benign 0.00
R9572:Naip5 UTSW 13 100359821 missense probably benign 0.00
R9581:Naip5 UTSW 13 100351194 missense probably benign 0.11
R9627:Naip5 UTSW 13 100356338 missense probably benign
R9725:Naip5 UTSW 13 100358784 missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100367269 missense probably damaging 0.99
R9764:Naip5 UTSW 13 100367269 missense probably damaging 0.99
R9765:Naip5 UTSW 13 100367269 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
Repository
Last Updated 2019-09-04 9:44 PM by Anne Murray
Record Created 2015-11-29 11:02 PM by Hexin Shi
Record Posted 2015-12-23
Phenotypic Description
Figure 1. Inwood3 mice exhibited decreased IL-1β secretion in response to priming with flagellin. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The inwood3 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3401, some of which exhibited impaired peritoneal macrophage NLRC4 inflammasome responses, marked by decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with flagellin (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of the reduced NLRC4 inflammasome function using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 32 mutations (X-axis) identified in the G1 male of pedigree R3401. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 32 mutations. The diminished NLRC4 inflammasome function phenotype was linked by continuous variable mapping to a mutation in Naip5:  a C to T transition at base pair 100,221,903 (v38) on chromosome 13, or base pair 32,869 in the GenBank genomic region NC_000079 for the Naip5 gene. Linkage was found with a recessive model of inheritance (P = 1.38 x 10-4), wherein three variant homozygotes departed phenotypically from eight homozygous reference mice and 14 heterozygous mice (Figure 2).  

The mutation corresponds to residue 3,037 in the mRNA sequence NM_010870 within exon 9 of 14 total exons.


 
3022 TATTTTGAAAACTTACAGCCACCAGCTATAGAT
937  -Y--F--E--N--L--Q--P--P--A--I--D-

The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine (Q) 942 for a premature stop codon (Q942*) in the NAIP5 protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. Protein domain structure of NAIP5. Shown are the baculovirus inhibitor of apoptosis repeats (BIRs), the NACHT [NAIP (neuronal apoptosis inhibitor protein), C2TA (MHC class 2 transcription activator), HET-E (incompatibility locus protein from Podospora anserina) and TP1 (telomerase-associated protein)] domain, and the leucine-rich repeat (LRR) region. The amino acid altered by the inwood3 mutation is shown. The image is interactive; click to view other Naip5 mutations.

Neuronal apoptosis inhibitor protein 5 [NAIP5; alternatively, baculoviral inhibitor of apoptosis protein (IAP) repeat-containing 1e (Birc1e)] is a member of the NACHT-LRR (NLR) family of cytosolic proteins that recognize pathogen-associated molecular patterns (PAMPs) on pathogens. NAIP5 has three BIRs (amino acids 60-127, 159-227, and 278-345), a NACHT domain (amino acids 464-648, SMART), and several leucine-rich repeats (LRRs) [Figure; reviewed in (1)].

The inwood3 mutation results in the substitution of glutamine (Q) 942 for a premature stop codon. Gln942 is within the LRR region. The LRR region in NLR proteins is conserved and typically mediates ligand recognition.

For more information about Naip5, please see the entry for inwood2.

Putative Mechanism

Members of the NLR family, including NLRC4 (see the record for inwood), NLRP1b, and NLRP3 (see the record for Nd1), are able to oligomerize through their NACHT domains and assemble into large caspase-1-activating multiprotein complexes, termed inflammasomes, upon the detection of pathogenic or other danger signals in the cytoplasm. The NLRC4 inflammasome stimulates caspase-1 activation and subsequent IL-1β secretion from macrophages after exposure to lipopolysaccharide, peptidoglycan, and pathogenic bacteria. Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18 and IL-33 to generate biologically active proteins. For more information about the NLRC4 inflammasome, please see the record for inwood.

The NAIP5/NLRC4 inflammasome is primarily activated by Gram-negative bacteria including L. pneumophila (2-4), Aeromonas veronii (5), Pseudomonas aeruginosa (6), Salmonella enterica serovar typhimurium (S. typhimurium) (6-9), Yersinia pestis (10), and Shigella flexneri (11). NLRC4-mediated responses to S. typhimurium are only partially dependent on NAIP5 (3). NAIP5 interacts with the 35 C-terminal amino acids as well as the conserved N-helix of flagellin (12). After cytosolic flagellin recognition, NAIP5 associates with NLRC4, forming an oligomeric complex, and subsequently leading to the activation of caspase-1 in a TLR5-independent manner (13;14). Naip5 alleles determine macrophage permissiveness to L. pneumophila replication (2;15). For example, L. pneumophila proliferates in macrophages derived from A/J mice, but in cultures derived from other strains (e.g., C57BL/6J), proliferation of L. pneumophila is not noted. There are 14 amino acid substitutions between C57BL/6 and A/J NAIP5 proteins (2).

Naip5-deficient (Naip5-/-) macrophages cannot activate caspase-1, release IL-1β, or promote pyroptosis in response to L. pneumophila infection (3). The reduced amount of IL-1β observed in the inwood3 mice in response to flagellin indicates a loss-of-function in NAIP5inwood3.

Primers PCR Primer
inwood3_pcr_F: GCATCCGTGTTGTTCACTTG
inwood3_pcr_R: ACAGTTGCTGAATGCTCTCC

Sequencing Primer
inwood3_seq_F: AACTTCCAGCTTGGGGATC
inwood3_seq_R: CATTTATTTTGCAATTCCTTCGAGG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 404 nucleotides is amplified (chromosome 13, - strand):


1   acagttgctg aatgctctcc atttattttg caattccttc gaggaaaaac actggcttta
61  agagtactga atttacagta ctttagggac cacccagaaa gcctgttact gttgaggagc
121 ttaaaggttt ccataaatgg aaataaaatg tcatcttatg tagattattc attcaagaca
181 tattttgaaa acttacagcc accagctata gatgaggagt atacatctgc ctttgagcat
241 ataagtgaat ggaggagaaa ttttgctcaa gatgaggaga tcataaaaaa ctatgaaaat
301 atccgaccca gagccctacc agacatcagt gaagggtact ggaaactgtc ccccaagcca
361 tgcaagatcc ccaagctgga agttcaagtg aacaacacgg atgc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsHexin Shi and Bruce Beutler