Phenotypic Mutation 'silver_decerebrate_2'

• Allele: silver_decerebrate_2
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 75,118,408 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Myo5a
• Gene Name: myosin VA
• Synonym(s): flail, Myo5, MVa, Dbv, 9630007J19Rik, MyoVA
• Chromosomal Location: 74,978,297-75,130,970 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008] ; PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q99104
• PDB Structure: Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION] ; Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION] ; Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000116028; Gene: ENSMUSG00000034593; AA Change: Q1610L

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000123128)
• SMART Domains: Protein: ENSMUSP00000120444; Gene: ENSMUSG00000034593; AA Change: Q1585L

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
  (Using ENSMUST00000136731)
• SMART Domains: Protein: ENSMUSP00000121158; Gene: ENSMUSG00000034593; AA Change: Q342L

Domain	Start	End	E-Value	Type
coiled coil region	71	175	N/A	INTRINSIC
Blast:DIL	275	305	4e-13	BLAST
Blast:DIL	330	355	5e-6	BLAST
DIL	417	522	2.47e-51	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
  (Using ENSMUST00000148144)
• SMART Domains: Protein: ENSMUSP00000117493; Gene: ENSMUSG00000034593; AA Change: Q1612L

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
  (Using ENSMUST00000155282)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably essential (E-score: 0.958)
• Phenotypic Category: Autosomal Recessive
• Penetrance: Probably 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, Sperm, gDNA
• Last Updated: 2018-05-22 9:40 AM by Anne Murray
• Record Created: unknown
• Record Posted: 2008-03-07
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Sophie Rutschmann, Celine Eidenschenk, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010864; MGI: 105976

Alleles Listed at MGI

All alleles(71) : Gene trapped(2) Spontaneous(52) Chemically induced(17)

Repository

none

Phenotypic Description

The silver decerebrate 2 phenotype was identified among ENU-induced G3 mice, and is identical to that of silver decerebrate. Homozygous mutants exhibit defects in both coat color and behavior. The fur, ears, feet and tail of homozygotes are dark gray. Several behavioral phenotypes are distinct in supine versus prone positions. When placed in a supine position, silver decerebrate 2 mutants exhibit opisthotonus (a convulsive arching of the head and neck), abrupt movements of the feet, and have difficulty righting themselves. In the normal prone position, mutants extend all four feet caudally. In either circumstance, all of the digits are splayed. Homozygous silver decerebrate 2 mice die at approximately three weeks of age. A similar spectrum of phenotypes is observed in dilute lethal and dilute opisthotonus mutants, which contain mutations in the Myo5a gene (1).

Nature of Mutation

Figure 1. Domain structure of myosin Va.  The head domain contains the actin-binding and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains six calmodulin binding IQ motifs.  The C-terminal half of myosin Va consists of the coiled coil (CC) segments responsible for myosin heavy chain dimerization and a globular tail domain (GTD) that mediates cargo binding.  The silver decerebrate 2 mutation changes a glutamine to a stop codon at amino acid 1610 (red asterisk). This image is interactive. Click on the image to view other mutations found in Myo5a (red). Click on the mutations for more specific information.

The silver decerebrate 2 mutation corresponds to a C to T transition at position 5255 of the Myo5a transcript, in exon 37 of 41 total exons.

 

5231 ATTCAGATCTATCAGCAGCTTGTGAGGGTGTTA

1605 -I--Q--I--Y--Q--Q--L--V--R--V--L-

 

The mutated nucleotide is indicated in red lettering, and changes the codon for glutamine 1610 to a stop codon (Figure 1).

 

Please see the record for new gray for information about Myo5a.

Putative Mechanism

The silver decerebrate 2 mutation truncates the C-terminal 243 amino acids of myosin Va, which encodes part of the globular tail domain (GTD). The GTD both mediates binding to specific organelles, such as melanosomes (2;3), and serves as a negative regulator of motor activity by folding back and contacting residues in the head domain (4). Point mutations in the GTD abolish the ability of the GTD to inhibit motor activity and prevent folding of myosin Va into the inhibitory conformation (5), although the physiological consequences of such mutations are unknown. Interestingly, other alleles of Myo5a resulting in early postnatal death are null alleles (1;6;7). The silver decerebrate 2 mutation is predicted to abrogate the function of the GTD. Its similar phenotype to that of Myo5a null alleles suggests that the mutation quite fully and severely inhibits the function of myosin Va, and thus that the GTD is critical to normal myosin Va function. It remains possible that the silver decerebrate 2 mutation destabilizes the protein and leads to its degradation.

Primers

Primers cannot be located by automatic search.

Genotyping

Silver decerebrate 2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

SD2(F): 5’-ATTGAGAATAGTGACCCTGGCACGAGGTAG -3’

SD2(R): 5’-CTTTAGAGAGGAAGTCAACACGGATCCCAG -3’

 

PCR program

1) 94°C             3:00

2) 94°C             0:30

3) 60°C             0:30

4) 68°C             0:50

5) repeat steps (2-4) 35X

6) 68°C             3:00

7) 4°C              ∞

 

Primers for sequencing

SD2_seq(F): 5’- CTGGCACGAGGTAGAAGGGATGAG -3’

SD2_seq(R): 5’- AGTCAACACGGATCCCAGTGCTTCAGAC -3’

 

The following sequence of 428 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Myo5α) is amplified:

 

139705                           attgag aatagtgacc ctggcacgag gtagaaggga

139741 tgagcaggat gcagagtgag gcagacagag acattggctt cctgtgcacc actaacattg

139801 tgttgattct agggctttat gaagcacaac acgtctcgcc agaatgagca ctgcctcacc

139861 aattttgacc ttgctgaata tcggcaagta ctgagtgact tggccattca gatctatcag

139921 cagcttgtga gggtgttaga gaacattctt cagccaatga taggtaagac cagtgtcgct

139981 gagcatcatg ggtgcttgct gacaaatgag gtcagtggta cgtacgtgtg acaggcatga

140041 gttcatgtgg agaacataaa gcggtaactg cgacagaagt caggctccac gtgtctgaag

140101 cactgggatc cgtgttgact tcctctctaa ag

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1.  Searle, A. G. (1952) A lethal allele of dilute in the house mouse, Heredity 6, 395-401.

   2.  Wu, X. S., Rao, K., Zhang, H., Wang, F., Sellers, J. R., Matesic, L. E., Copeland, N. G., Jenkins, N. A., and Hammer, J. A., III (2002) Identification of an organelle receptor for myosin-Va, Nat. Cell Biol. 4, 271-278.

   3.  Fukuda, M. and Kuroda, T. S. (2004) Missense mutations in the globular tail of myosin-Va in dilute mice partially impair binding of Slac2-a/melanophilin, J. Cell Sci. 117, 583-591.

   4.  Wang, F., Thirumurugan, K., Stafford, W. F., Hammer, J. A., III, Knight, P. J., and Sellers, J. R. (2004) Regulated conformation of myosin V, J. Biol. Chem. 279, 2333-2336.

   5.  Li, X. D., Jung, H. S., Wang, Q., Ikebe, R., Craig, R., and Ikebe, M. (2008) The globular tail domain puts on the brake to stop the ATPase cycle of myosin Va, Proc. Natl. Acad. Sci. U. S. A 105, 1140-1145.

   6.  Moore, K. J., Seperack, P. K., Strobel, M. C., Swing, D. A., Copeland, N. G., and Jenkins, N. A. (1988) Dilute suppressor dsu acts semidominantly to suppress the coat color phenotype of a deletion mutation, dl20J, of the murine dilute locus, Proc. Natl. Acad. Sci. U. S. A 85, 8131-8135.

   7.  Strobel, M. C., Seperack, P. K., Copeland, N. G., and Jenkins, N. A. (1990) Molecular analysis of two mouse dilute locus deletion mutations: spontaneous dilute lethal20J and radiation-induced dilute prenatal lethal Aa2 alleles, Mol. Cell Biol. 10, 501-509.