Phenotypic Mutation 'Pillar'

• Allele: Pillar
• Mutation Type: nonsense
• Chromosome: 1
• Coordinate: 194,838,196 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Cr2
• Gene Name: complement receptor 2
• Synonym(s): C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
• Chromosomal Location: 194,819,119-194,859,024 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 195136811 - 195176715 bp
• Amino Acid Change: Cysteine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000080938] [ENSMUSP00000141706] [ENSMUSP00000141276] [ENSMUSP00000141538] [ENSMUSP00000147804]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000080938; Gene: ENSMUSG00000026616; AA Change: C713*

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000141706; Gene: ENSMUSG00000026616; AA Change: C416*

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

• Predicted Effect: probably null
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000141276; Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000141538; Gene: ENSMUSG00000026616; AA Change: C713*

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.142)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-12-04 11:00 PM by Jin Huk Choi
• Record Posted: 2018-10-16
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, James Butler, Bruce Beutler

Accession Number

NCBI RefSeq: NM_007758; MGI:88489

Alleles Listed at MGI

All Mutations and Alleles(10) : Targeted(7) Transgenic(3)

Phenotypic Description

Figure 1. Pillar mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Pillar phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4427, some of which showed a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent IgG responses to rSFV-β-gal phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 36 mutations (X-axis) identified in the G1 male of pedigree R4427. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 36 mutations. The diminished T-dependent antibody response to rrSFV-β-gal phenotype was linked by continuous variable mapping to a mutation in Cr2: a T to A transversion at base pair 195,155,888 (v38) on chromosome 1, or base pair 21,303 in the GenBank genomic region NC_000067 encoding Cr2. Linkage was found with an additive model of inheritance, wherein five variant homozygotes and 25 heterozygous mice departed phenotypically from 15 homozygous reference mice with a P value of 0.000167 (Figure 2).  

The mutation corresponds to residue 2,244 in the mRNA sequence NM_007758 within exon 12 of 19 total exons.

2227 AAAAAGATTGAAGTTTGTACAGTTATTCTCTGT 708  -K--K--I--E--V--C--T--V--I--L--C-

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine 713 to a premature stop codon (C713*) in the CR2 protein.

Protein Prediction

Figure 3. Domain organization of CR2. The location of the pillar mutation is indicated. Domain information is from UniProt. Abbreviations: SCR, short consensus repeats; TM, transmembrane domain.

Figure 4. Crystal structure of human CR2 in complex with its C3d ligand. Residues 1-134 are shown and colored as in Figure 3. UCSF Chimera model is based on PDB 1GHQ, Szakonyi, et al. Science. 292, 1725-1728 (2001). Click on the 3D structure to view it rotate.

Cr2 encodes the type I transmembrane protein complement receptor 2 (CR2; alternatively, CD21). Alternative splicing of mouse Cr2 also produces the CR1 (alternatively, CD35) protein (1). Human CR2 only produces the CR2 protein; humans express a CR1 that is similar to Cr2-derived CR1, but it is derived from the CRRY gene (2).

CR2 has a 954-amino acid extracellular domain, a 24-amino acid transmembrane domain, and a 34-amino acid cytoplasmic domain (Figure 3) (3). CR1 and CR2 have multiple (21 in CR1 and 15 in CR2) short consensus repeats (SCRs; alternatively, Sushi or CCP domains) in the extracellular region. SCRs are 60 to 70 amino acids in length, and each SCR contains invariant residues involved in a triple-loop conformation. SCRs are typically present in complement factors and adhesion proteins whereby they facilitate ligand binding. The first two SCR domains are primarily involved in interactions with most CR2 ligands (4-6). The SCR1-SCR2 domains assume a compact V-shaped confirmation [Figure 4; PDB:1LY2; (5) and PDB:1GHQ; (6)]. The CR2 ligand CD23 interacts with CR2 at SCR1 and SCR2 as well as with SCR5 through SCR8 (7). The CR1 unique N-terminus has binding sites for C3b and C4b.

The extracellular domain has 11 N-glycosylation consensus sequences (Asn-X-Ser/Thr) (8). The cytoplasmic domain of CR2 has a TSQK sequence, which is a putative protein kinase C substrate target. An EAREVY sequence (i.e., a tyrosine kinase target sequence) is also within the cytoplasmic domain.

CR2 can be cleaved to release a soluble CR2 (sCR2) (9). sCR2 corresponds to the extracellular portion of full-length CR2. In addition to cleavage of full-length CR2, sCR2 can be produced by alternative splicing of exon 11 of CR2 (10). sCR2 is able to bind the same ligands as the membrane form (9). The function of sCR2 is unknown, but it putatively interferes with ligand-receptor interactions. In addition, increased amounts of sCR2 is found in the sera of patients with B cell chronic lymphocytic leukemia (11). A sCR2 containing 16 SCRs (designated long CR2) was detected in human blood, and is proposed to be derived from follicular dendritic cells (12;13). Another study found that the sCR2 in human plasma is predominantly the short form (14).

The Pillar mutation results in substitution of cysteine 713 to a premature stop codon (C713*); residue 713 is within the twelfth SCR domain.

Expression/Localization

Mouse and human CR2 are expressed on B cells and follicular dendritic cells (15). Human CR2 is also expressed on red blood cells, myeloid cells, and lymphocytes (13;16;17). Expression of CR2 on mouse B cells first appears at the T1-T2 transitional stage on B220^low/IgM^high B cells. CR2 expression is terminated when the cells differentiate into plasma cells. CR2 is constitutively expressed on memory B cells and follicular dendritic cells within germinal centers. In the spleen, CR2 is highly expressed on marginal zone B cells and follicular B cells; CR2 is expressed at low levels on B1 cells (18). CR2 is primarily expressed on IgM⁺/IgD⁻ cells in humans during bone marrow development (19). CR2 is expressed almost on all mature peripheral human B lymphocytes.

Background

Figure 5. CD21/CR2 role in complement activation. CR2 binds to C3d on antigens binding to IgM on B cells, leading to an enhanced response. CR2 on follicular dendritic cells can also capture C3d-opsonized antigen and present the antigen to previously primed B cells in the germinal center (not shown).

Figure 6. BCR signaling. The tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn), causing them to take an open conformation and serve as docking sites for the adapter protein BLNK and the SH2 domains of SYK. SYK phosphorylates a number of downstream targets including BLNK, PLC-γ2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP₃), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-γ2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-4,5-diphosphate (PIP₂) to inositol-1,4,5-trisphosphate (IP₃) and diacylglycerol (DAG). Soluble IP₃ and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca²⁺) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The complement pathway marks non-self proteins and microbes for phagocytic uptake and destruction. The pathway is comprised of several serum and membrane-bound proteins that regulate the pathway so that it recognizes foreign antigens, but recognizes normal self tissue and cells [reviewed in (20)]. The complement pathway is initiated by the activation of the C3 protein, which generates C3a and C3b. C3b putatively forms a covalent thiol-ester bond to the substrate as well as joins with the C3 convertases to function as a C5 convertase to release C5a and C5b. C3b can be degraded into small, inactive forms (i.e., iC3b and C3dg) by the serine protease factor I. The C3b cleavage products maintain their bonds to the substrate and are recognized by a series of receptors. CR2 functions as a receptor for the gp350/220 viral coat protein of the Epstein-Barr virus, C3dg, iC3b, C3d, the low-affinity IgE receptor CD23, and the type I cytokine, IFN-alpha (Figure 5) (7;21-24). CR1 binds both C4b and C3b, and functions as a cofactor to inactivate C3b and C4b to iC3b and iC4b, respectively. The CR2-associated complement pathway enhances humoral immunity to T-dependent and T-independent foreign antigens (25;26).

As CR2 binds the inactive forms of C3, it has minimal complement regulatory functions, but functions primarily as a member of the B cell co-receptor complex with CD19 (see the record for hive) and CD81 (Figure 6) (27). CR2 (in complex with CD19 and CD81) stabilizes the B-cell receptor (BCR) in lipid rafts (28). In BCR signaling, following the aggregation of BCR molecules, the ITAMs in the tails of Igα (see the record for crab) and Igβ (see the record for hallasan) become phosphorylated by Src family kinases (typically Lyn) (29;30). These phosphotyrosines then act as docking sites for the SH2 domains of Syk, resulting in Syk phosphorylation and activation. Syk phosphorylates a number of downstream targets including BLNK (see the record for busy), PLCγ2 (see the record for queen), and protein kinase C β (PKCβ; see the record for Untied). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of PIP₃, which binds selectively to the pleckstrin homology domain of Btk, facilitating membrane recruitment of the kinase. Lyn phosphorylates the cytoplasmic tail of CD19 upon CD19 activation. Phosphorylated CD19 recruits another Lyn molecule, leading to Lyn phosphorylation. CD19 subsequently recruits VAV, which is phosphorylated by Lyn. Phosphorylated BLNK also provides docking sites for Btk, as well as PLCγ2, which results in the additional phosphorylation and activation of PLCγ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP₂) to inositol-1,4,5-trisphosphate (IP₃) and diacylglycerol (DAG) (31). The recruitment of Vav1, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK) [reviewed in (32)]. Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for puff, xander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (33)]. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (Malt1), and caspase recruitment domain family, member 11 (CARMA1, alternatively Card11; see the record for king), which are involved in NF-κB activation along with PKCβ (34).

Mutations in human CR2 are linked to common variable immunodeficiency-7 (CVID7; OMIM: #614699; (35)) and are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9; OMIM: #610927; (36;37)). Patients with CVID7 exhibit persistent myalgias, fever, sore throat, respiratory tract infections, chronic diarrhea associated with Haemophilus influenza infection, splenomegaly, and hypogammaglobulinemia affecting mainly IgG; IgA values were slightly reduced and IgM levels were low-normal (35). 

Cr2-deficient (Cr2^{tm1.1Jhws/tm1.1Jhws}; MGI:5547494) mice exhibit reduced B1a cell numbers, increased susceptibility to S. pneumoniae, failure to produce activated germinal center B cells after sheep red blood cell immunization, and reduced IgG2b, IgG2c, and IgG3 levels compared to wild-type littermates (38). A second Cr2-deficeint mouse (Cr2^{tm1Crr/tm1Crr}; MGI:2448261) exhibited reduced numbers of follicular B cells, B1a cells, and neutrophils with concomitant increased numbers of marginal zone B cells compared to wild-type littermates (25;39;40). The Cr2^{tm1Crr/tm1Crr} mice exhibited diminished T-dependent antibody responses as well as decreased IgG and IgM levels (25;41). The amount of TNF secretion was reduced in the peritoneal lavage after cecal ligation and puncture (40). Female Cr2^{tm1Crr/tm1Crr} mice had increased anti-dsDNA antibodies compared to controls at five to six months of age (42). A third Cr2-deficient model (Cr2^{tm1Hmo/tm1Hmo}; MGI:1932568) exhibited increased susceptibility to pneumococcal infection than controls (43). After immunization with a T-dependent antigen, serum levels of IgG and IgM were reduced in the Cr2^{tm1Hmo/tm1Hmo} mice compared to wild-type controls (26). Cr2^{tm1Hmo/tm1Hmo} mice showed abnormal B cell activation, memory B cell differentiation and class switch recombination in response to low-dose antigen (44). A fourth Cr2-deficient mouse (Cr2^{tm1Tft/tm1Tft}; MGI:3531094) exhibited reduced frequencies of spleen germinal centers, reduced T-independent and T-dependent antibody responses, increased susceptibility to S. pneumoniae, and reduced IgM and IgG levels (45).

Putative Mechanism

The Pillar mice showed a diminished T-dependent antibody responses similar to that in Cr2^{tm1Crr/tm1Crr}  and Cr2^{tm1Tft/tm1Tft} mice indicating loss of CR2-associated function (25;41;45).

Primers

PCR Primer
Pillar_pcr_F: TGGAAACTAGAGCATGCTTTCG
Pillar_pcr_R: CCAAGGGGCTCATTTAGAAATATCTC

Sequencing Primer
Pillar_seq_F: CTAGAGCATGCTTTCGGTTAAATAAC
Pillar_seq_R: TAGGTACCAGTTGACTGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 446 nucleotides is amplified (chromosome 1, - strand):

1   ccaaggggct catttagaaa tatctctata aatgtacttt ttatgatgaa gaagtaaaat
61  attgagaaga aatgtaatat aacatctttt tctaggtacc agttgactgg atatacttat
121 gagaagtgtc aaaatgctga gaatgggact tggtttaaaa agattgaagt ttgtacaggt
181 aaattatgga catgggagaa gccaacccta gattagagag ttagaaaagg aaaatcaatt
241 aatggagagc aagcttacaa ctactttaat agtttatact ttttcttgct atgtataaga
301 catgttaaat cttttagttt tgatcaaaac tatttatttc tttatacttt attttatttt
361 ctgagttttt tggaatgaac atgtagtact tacataagta taacatttga taaagttatt
421 taaccgaaag catgctctag tttcca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Molina, H., Kinoshita, T., Inoue, K., Carel, J. C., and Holers, V. M. (1990) A Molecular and Immunochemical Characterization of Mouse CR2. Evidence for a Single Gene Model of Mouse Complement Receptors 1 and 2. J Immunol. 145, 2974-2983.

  2. Jacobson, A. C., and Weis, J. H. (2008) Comparative Functional Evolution of Human and Mouse CR1 and CR2. J Immunol. 181, 2953-2959.

  3. Moore, M. D., Cooper, N. R., Tack, B. F., and Nemerow, G. R. (1987) Molecular Cloning of the cDNA Encoding the Epstein-Barr virus/C3d Receptor (Complement Receptor Type 2) of Human B Lymphocytes. Proc Natl Acad Sci U S A. 84, 9194-9198.

  4. Carel, J. C., Myones, B. L., Frazier, B., and Holers, V. M. (1990) Structural Requirements for C3d,g/Epstein-Barr Virus Receptor (CR2/CD21) Ligand Binding, Internalization, and Viral Infection. J Biol Chem. 265, 12293-12299.

  5. Prota, A. E., Sage, D. R., Stehle, T., and Fingeroth, J. D. (2002) The Crystal Structure of Human CD21: Implications for Epstein-Barr Virus and C3d Binding. Proc Natl Acad Sci U S A. 99, 10641-10646.

  6. Szakonyi, G., Guthridge, J. M., Li, D., Young, K., Holers, V. M., and Chen, X. S. (2001) Structure of Complement Receptor 2 in Complex with its C3d Ligand. Science. 292, 1725-1728.

  7. Aubry, J. P., Pochon, S., Gauchat, J. F., Nueda-Marin, A., Holers, V. M., Graber, P., Siegfried, C., and Bonnefoy, J. Y. (1994) CD23 Interacts with a New Functional Extracytoplasmic Domain Involving N-Linked Oligosaccharides on CD21. J Immunol. 152, 5806-5813.

  8. Fremeaux-Bacchi, V., Fischer, E., and Kazatchkine, M. D. (1996) Membrane and Soluble Forms of CD21 (the C3dg/EBV Receptor). Immunol Lett. 54, 201-204.

  9. Fremeaux-Bacchi, V., Bernard, I., Maillet, F., Mani, J. C., Fontaine, M., Bonnefoy, J. Y., Kazatchkine, M. D., and Fischer, E. (1996) Human Lymphocytes Shed a Soluble Form of CD21 (the C3dg/Epstein-Barr Virus Receptor, CR2) that Binds iC3b and CD23. Eur J Immunol. 26, 1497-1503.

  10. Illges, H., Braun, M., Peter, H. H., and Melchers, I. (1997) Analysis of the Human CD21 Transcription Unit Reveals Differential Splicing of Exon 11 in Mature Transcripts and Excludes Alternative Splicing as the Mechanism Causing Solubilization of CD21. Mol Immunol. 34, 683-693.

  11. Ling, N., Hansel, T., Richardson, P., and Brown, B. (1991) Cellular Origins of Serum Complement Receptor Type 2 in Normal Individuals and in Hypogammaglobulinaemia. Clin Exp Immunol. 84, 16-22.

  12. Liu, Y. J., Xu, J., de Bouteiller, O., Parham, C. L., Grouard, G., Djossou, O., de Saint-Vis, B., Lebecque, S., Banchereau, J., and Moore, K. W. (1997) Follicular Dendritic Cells Specifically Express the Long CR2/CD21 Isoform. J Exp Med. 185, 165-170.

  13. Masilamani, M., Kassahn, D., Mikkat, S., Glocker, M. O., and Illges, H. (2003) B Cell Activation Leads to Shedding of Complement Receptor Type II (CR2/CD21). Eur J Immunol. 33, 2391-2397.

  14. Lowe, J., Brown, B., Hardie, D., Richardson, P., and Ling, N. (1989) Soluble Forms of CD21 and CD23 Antigens in the Serum in B Cell Chronic Lymphocytic Leukaemia. Immunol Lett. 20, 103-109.

  15. Zabel, M. D., and Weis, J. H. (2001) Cell-Specific Regulation of the CD21 Gene. Int Immunopharmacol. 1, 483-493.

  16. Reynes, M., Aubert, J. P., Cohen, J. H., Audouin, J., Tricottet, V., Diebold, J., and Kazatchkine, M. D. (1985) Human Follicular Dendritic Cells Express CR1, CR2, and CR3 Complement Receptor Antigens. J Immunol. 135, 2687-2694.

  17. Tsoukas, C. D., and Lambris, J. D. (1988) Expression of CR2/EBV Receptors on Human Thymocytes Detected by Monoclonal Antibodies. Eur J Immunol. 18, 1299-1302.

  18. Takahashi, K., Kozono, Y., Waldschmidt, T. J., Berthiaume, D., Quigg, R. J., Baron, A., and Holers, V. M. (1997) Mouse Complement Receptors Type 1 (CR1;CD35) and Type 2 (CR2;CD21): Expression on Normal B Cell Subpopulations and Decreased Levels during the Development of Autoimmunity in MRL/lpr Mice. J Immunol. 159, 1557-1569.

  19. Tedder, T. F., Clement, L. T., and Cooper, M. D. (1984) Expression of C3d Receptors during Human B Cell Differentiation: Immunofluorescence Analysis with the HB-5 Monoclonal Antibody. J Immunol. 133, 678-683.

  20. Jacobson, A. C., and Weis, J. H. (2008) Comparative Functional Evolution of Human and Mouse CR1 and CR2. J Immunol. 181, 2953-2959.

  21. Weis, J. J., Tedder, T. F., and Fearon, D. T. (1984) Identification of a 145,000 Mr Membrane Protein as the C3d Receptor (CR2) of Human B Lymphocytes. Proc Natl Acad Sci U S A. 81, 881-885.

  22. Fingeroth, J. D., Weis, J. J., Tedder, T. F., Strominger, J. L., Biro, P. A., and Fearon, D. T. (1984) Epstein-Barr Virus Receptor of Human B Lymphocytes is the C3d Receptor CR2. Proc Natl Acad Sci U S A. 81, 4510-4514.

  23. Hannan, J. P. (2016) The Structure-Function Relationships of Complement Receptor Type 2 (CR2; CD21). Curr Protein Pept Sci. 17, 463-487.

  24. Iida, K., Nadler, L., and Nussenzweig, V. (1983) Identification of the Membrane Receptor for the Complement Fragment C3d by Means of a Monoclonal Antibody. J Exp Med. 158, 1021-1033.

  25. Ahearn, J. M., Fischer, M. B., Croix, D., Goerg, S., Ma, M., Xia, J., Zhou, X., Howard, R. G., Rothstein, T. L., and Carroll, M. C. (1996) Disruption of the Cr2 Locus Results in a Reduction in B-1a Cells and in an Impaired B Cell Response to T-Dependent Antigen. Immunity. 4, 251-262.

  26. Molina, H., Holers, V. M., Li, B., Fung, Y., Mariathasan, S., Goellner, J., Strauss-Schoenberger, J., Karr, R. W., and Chaplin, D. D. (1996) Markedly Impaired Humoral Immune Response in Mice Deficient in Complement Receptors 1 and 2. Proc Natl Acad Sci U S A. 93, 3357-3361.

  27. Matsumoto, A. K., Kopicky-Burd, J., Carter, R. H., Tuveson, D. A., Tedder, T. F., and Fearon, D. T. (1991) Intersection of the Complement and Immune Systems: A Signal Transduction Complex of the B Lymphocyte-Containing Complement Receptor Type 2 and CD19. J Exp Med. 173, 55-64.

  28. Cherukuri, A., Cheng, P. C., Sohn, H. W., and Pierce, S. K. (2001) The CD19/CD21 Complex Functions to Prolong B Cell Antigen Receptor Signaling from Lipid Rafts. Immunity. 14, 169-179.

  29. Geahlen, R. L. (2009) Syk and pTyr'd: Signaling through the B Cell Antigen Receptor. Biochim Biophys Acta. 1793, 1115-1127.

  30. Rolli, V., Gallwitz, M., Wossning, T., Flemming, A., Schamel, W. W., Zurn, C., and Reth, M. (2002) Amplification of B Cell Antigen Receptor Signaling by a Syk/ITAM Positive Feedback Loop. Mol Cell. 10, 1057-1069.

  31. Hashimoto, S., Iwamatsu, A., Ishiai, M., Okawa, K., Yamadori, T., Matsushita, M., Baba, Y., Kishimoto, T., Kurosaki, T., and Tsukada, S. (1999) Identification of the SH2 Domain Binding Protein of Bruton's Tyrosine Kinase as BLNK--Functional Significance of Btk-SH2 Domain in B-Cell Antigen Receptor-Coupled Calcium Signaling. Blood. 94, 2357-2364.

  32. Koretzky, G. A., Abtahian, F., and Silverman, M. A. (2006) SLP76 and SLP65: Complex Regulation of Signalling in Lymphocytes and Beyond. Nat Rev Immunol. 6, 67-78.

  33. Guo, B., Su, T. T., and Rawlings, D. J. (2004) Protein Kinase C Family Functions in B-Cell Activation. Curr Opin Immunol. 16, 367-373.

  34. Egawa, T., Albrecht, B., Favier, B., Sunshine, M. J., Mirchandani, K., O'Brien, W., Thome, M., and Littman, D. R. (2003) Requirement for CARMA1 in Antigen Receptor-Induced NF-Kappa B Activation and Lymphocyte Proliferation. Curr Biol. 13, 1252-1258.

  35. Thiel, J., Kimmig, L., Salzer, U., Grudzien, M., Lebrecht, D., Hagena, T., Draeger, R., Voelxen, N., Bergbreiter, A., Jennings, S., Gutenberger, S., Aichem, A., Illges, H., Hannan, J. P., Kienzler, A. K., Rizzi, M., Eibel, H., Peter, H. H., Warnatz, K., Grimbacher, B., Rump, J. A., and Schlesier, M. (2012) Genetic CD21 Deficiency is Associated with Hypogammaglobulinemia. J Allergy Clin Immunol. 129, 801-810.e6.

  36. Wu, H., Boackle, S. A., Hanvivadhanakul, P., Ulgiati, D., Grossman, J. M., Lee, Y., Shen, N., Abraham, L. J., Mercer, T. R., Park, E., Hebert, L. A., Rovin, B. H., Birmingham, D. J., Chang, D. M., Chen, C. J., McCurdy, D., Badsha, H. M., Thong, B. Y., Chng, H. H., Arnett, F. C., Wallace, D. J., Yu, C. Y., Hahn, B. H., Cantor, R. M., and Tsao, B. P. (2007) Association of a Common Complement Receptor 2 Haplotype with Increased Risk of Systemic Lupus Erythematosus. Proc Natl Acad Sci U S A. 104, 3961-3966.

  37. Douglas, K. B., Windels, D. C., Zhao, J., Gadeliya, A. V., Wu, H., Kaufman, K. M., Harley, J. B., Merrill, J., Kimberly, R. P., Alarcon, G. S., Brown, E. E., Edberg, J. C., Ramsey-Goldman, R., Petri, M., Reveille, J. D., Vila, L. M., Gaffney, P. M., James, J. A., Moser, K. L., Alarcon-Riquelme, M. E., Vyse, T. J., Gilkeson, G. S., Jacob, C. O., Ziegler, J. T., Langefeld, C. D., Ulgiati, D., Tsao, B. P., and Boackle, S. A. (2009) Complement Receptor 2 Polymorphisms Associated with Systemic Lupus Erythematosus Modulate Alternative Splicing. Genes Immun. 10, 457-469.

  38. Donius, L. R., Handy, J. M., Weis, J. J., and Weis, J. H. (2013) Optimal Germinal Center B Cell Activation and T-Dependent Antibody Responses Require Expression of the Mouse Complement Receptor Cr1. J Immunol. 191, 434-447.

  39. Cariappa, A., Tang, M., Parng, C., Nebelitskiy, E., Carroll, M., Georgopoulos, K., and Pillai, S. (2001) The Follicular Versus Marginal Zone B Lymphocyte Cell Fate Decision is Regulated by Aiolos, Btk, and CD21. Immunity. 14, 603-615.

  40. Gommerman, J. L., Oh, D. Y., Zhou, X., Tedder, T. F., Maurer, M., Galli, S. J., and Carroll, M. C. (2000) A Role for CD21/CD35 and CD19 in Responses to Acute Septic Peritonitis: A Potential Mechanism for Mast Cell Activation. J Immunol. 165, 6915-6921.

  41. Chen, Z., Koralov, S. B., Gendelman, M., Carroll, M. C., and Kelsoe, G. (2000) Humoral Immune Responses in Cr2-/- Mice: Enhanced Affinity Maturation but Impaired Antibody Persistence. J Immunol. 164, 4522-4532.

  42. Chen, Z., Koralov, S. B., and Kelsoe, G. (2000) Complement C4 Inhibits Systemic Autoimmunity through a Mechanism Independent of Complement Receptors CR1 and CR2. J Exp Med. 192, 1339-1352.

  43. Ren, B., McCrory, M. A., Pass, C., Bullard, D. C., Ballantyne, C. M., Xu, Y., Briles, D. E., and Szalai, A. J. (2004) The Virulence Function of Streptococcus Pneumoniae Surface Protein A Involves Inhibition of Complement Activation and Impairment of Complement Receptor-Mediated Protection. J Immunol. 173, 7506-7512.

  44. Barrington, R. A., Schneider, T. J., Pitcher, L. A., Mempel, T. R., Ma, M., Barteneva, N. S., and Carroll, M. C. (2009) Uncoupling CD21 and CD19 of the B-Cell Coreceptor. Proc Natl Acad Sci U S A. 106, 14490-14495.

  45. Haas, K. M., Hasegawa, M., Steeber, D. A., Poe, J. C., Zabel, M. D., Bock, C. B., Karp, D. R., Briles, D. E., Weis, J. H., and Tedder, T. F. (2002) Complement Receptors CD21/35 Link Innate and Protective Immunity during Streptococcus Pneumoniae Infection by Regulating IgG3 Antibody Responses. Immunity. 17, 713-723.