Phenotypic Mutation 'Pacific' (pdf version)
AllelePacific
Mutation Type missense
Chromosome4
Coordinate3,745,330 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Lyn
Gene Name LYN proto-oncogene, Src family tyrosine kinase
Synonym(s) Hck-2
Chromosomal Location 3,678,115-3,813,122 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001111096, NM_10747; MGI:96892

MappedYes 
Amino Acid Change Tryptophan changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000038838] [ENSMUSP00000100075]
AlphaFold P25911
PDB Structure Lyn Tyrosine Kinase Domain, apo form [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-AMP-PNP complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-PP2 complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-Dasatinib complex [X-RAY DIFFRACTION]
Structure of unliganded Lyn SH2 domain [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: W99C

DomainStartEndE-ValueType
SH3 66 122 9.24e-21 SMART
SH2 127 217 5.38e-33 SMART
TyrKc 247 497 3.25e-137 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000041377)
SMART Domains Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: W78C

DomainStartEndE-ValueType
SH3 45 101 5.8e-23 SMART
SH2 106 196 3.3e-35 SMART
TyrKc 226 476 1.6e-139 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000103010)
Meta Mutation Damage Score 0.9452 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - increased
FACS CD8+ T cells - decreased
FACS macrophages - increased 19021855
FACS NK cells - decreased
FACS T cells - decreased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.722; ML prob: 0.67; human score: 0
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(16) : Chemically induced (ENU)(6) Targeted(9) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lyn APN 4 3743286 missense probably benign
IGL02744:Lyn APN 4 3738808 missense probably benign 0.00
IGL02860:Lyn APN 4 3745594 missense possibly damaging 0.77
IGL03328:Lyn APN 4 3745327 missense probably benign 0.01
IGL03370:Lyn APN 4 3780931 missense possibly damaging 0.81
Cress UTSW 4 3789908 nonsense probably null
Friede UTSW 4 3789834 nonsense probably null
Kohlrabi UTSW 4 3783089 missense possibly damaging 0.74
lechuga UTSW 4 3783050 missense probably damaging 1.00
Lemon UTSW 4 3746768 missense probably damaging 1.00
R1615_Lyn_036 UTSW 4 3748765 missense probably benign 0.11
water UTSW 4 3748787 missense possibly damaging 0.93
R0079:Lyn UTSW 4 3746768 missense probably damaging 1.00
R0089:Lyn UTSW 4 3748768 missense probably benign 0.23
R0582:Lyn UTSW 4 3743296 missense probably damaging 1.00
R0747:Lyn UTSW 4 3745638 splice site probably benign
R1460:Lyn UTSW 4 3789908 nonsense probably null
R1615:Lyn UTSW 4 3748765 missense probably benign 0.11
R1654:Lyn UTSW 4 3789912 missense probably damaging 0.99
R1703:Lyn UTSW 4 3738867 splice site probably null
R2301:Lyn UTSW 4 3780959 missense probably damaging 1.00
R2421:Lyn UTSW 4 3748787 missense possibly damaging 0.93
R2512:Lyn UTSW 4 3745542 missense probably benign 0.01
R3418:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3419:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3701:Lyn UTSW 4 3742455 missense probably benign
R3702:Lyn UTSW 4 3742455 missense probably benign
R3736:Lyn UTSW 4 3745330 missense probably damaging 1.00
R4350:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4351:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4352:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4649:Lyn UTSW 4 3738850 missense probably benign
R5738:Lyn UTSW 4 3782987 missense probably damaging 1.00
R5875:Lyn UTSW 4 3745631 splice site probably null
R6375:Lyn UTSW 4 3745527 missense probably damaging 1.00
R7029:Lyn UTSW 4 3782996 missense probably damaging 0.98
R7621:Lyn UTSW 4 3789834 nonsense probably null
R7726:Lyn UTSW 4 3756428 nonsense probably null
R7940:Lyn UTSW 4 3783089 missense possibly damaging 0.74
R8169:Lyn UTSW 4 3783050 missense probably damaging 1.00
R8341:Lyn UTSW 4 3743304 critical splice donor site probably null
R8782:Lyn UTSW 4 3783055 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-09-04 9:44 PM by Diantha La Vine
Record Created 2015-12-08 11:59 PM by Bruce Beutler
Record Posted 2016-09-19
Phenotypic Description

Figure 1. Pacific mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Pacific mice exhibit increased frequencies of peripheral CD11c+ dendritic cells. Flow cytometric analysis of peripheral blood was utilized to determine dendritic cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Pacific mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Pacific mice exhibit reduced frequencies of peripheral natural killer cells. Flow cytometric analysis of peripheral blood was utilized to determine natural killer cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Pacific mice exhibit reduced frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Pacific mice exhibit reduced frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Pacific mice exhibit reduced frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Pacific phenotype was identified among G3 mice of the pedigree R3736, some of which showed an increased frequency of B1 cells (Figure 1), an increased frequency of CD11c+ dendritic cells (Figure 2), an increased frequency of macrophages (Figure 3), a reduced frequency of natural killer cells (Figure 4), and a reduced frequency of T cells (Figure 5) including CD4+ T cells (Figure 6) and CD8+ T cells (Figure 7), all in the peripheral blood.

Nature of Mutation

Figure 8. Linkage mapping of the increased frequency of macrophages in the peripheral blood using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 49 mutations (X-axis) identified in the G1 male of pedigree R3736. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 49 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Lyn: a G to T transversion at base pair 3,745,330 (v38) on chromosome 4, or base pair 67,210 in the GenBank genomic region NC_000070 encoding Lyn. The strongest association was found with an additive model of linkage to the normalized macrophage frequency, wherein 23 variant homozygotes and 38 heterozygotes departed phenotypically from 23 homozygous reference mice with a P value of 2.49 x 10-13 (Figure 8). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 546 in the mRNA sequence NM_001111096 (variant 1) within exon 5 of 13 total exons as well as residue 483 in the mRNA sequence NM_10747 (variant 2) within exon 5 or 13 total exons.

 

67198 GAAGAGCATGGGGAATGGTGGAAAGCTAAGTCC

94    -E--E--H--G--E--W--W--K--A--K--S-

 
Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red.  The mutation results in a tryptophan (W) to cysteine (C) substitution at position 99 (W99C) in the LYN protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000) (1).  
 
Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 9. Domain structure of Lynp56. Please see the text for details about the domains. The Pacific mutation results in a tryptophan to cysteine substitution at position 99. This image is interactive. Other mutations found in the protein are noted in red. Click on each mutation for more information.

Lyn is a member of the Src family of tyrosine kinases (SFKs) which also includes Src, Yes, Fgr, Fyn, Lck (see the record for iconoclast), Hck, Blk, and Yrk. The members of the SFKs share highly conserved domains including a Src-homology 3 (SH3) domain (amino acids 66-122 in Lyn), an SH2 domain (amino acids 127-217), a tyrosine kinase domain (amino acids 247-497), and a C-terminal regulatory region [Figure 6; reviewed in (1-3)]. A ‘unique’ domain of 50-70 amino acids between the N-terminus and the SH3 domain varies among the members of the SFKs (3). The function of the unique domain in Lyn is unknown; in Lck it mediates protein-protein interactions between Lck and the cytoplasmic tails of the T-cell coreceptors CD4 and CD8 (4;5). The Pacific mutation (W99C) occurs in SH3 domain in both Lyn isoforms. The SH3  domain of Lyn mediates protein-protein interactions between Lyn and Pro-rich motif-containing proteins.

 

Please see the record Lemon for information about Lyn.

Putative Mechanism

Lyn can act as both a positive and negative signaling molecule in several cell types including hematopoietic progenitors, mature myeloid cells (neutrophils, macrophages, monocytes, eosinophils, and dendritic cells), platelets, erythrocytes, and osteoclasts. As a result, Lyn regulates several cellular functions including proliferation, degranulation, cytokine production, adhesion, activation, migration, and survival. Following BCR ligation, Lyn phosphorylates the immunoreceptor tyrosine-based activation motifs (ITAMs) of the Igα/Igβ BCR subunits (6-8). These signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for Finlay and xander) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (9)]. Lyn has a non-redundant role in negative regulation of BCR signaling (6). Lyn phosphorylates the ITIMs of the BCR associated co-receptors CD22 (see the record for well), Fc receptor gamma IIb (FcγRIIb), and paired immunoglobulin-like receptor-B (PIR-B) (10-15).

 

Lyn-/- mice exhibit progressive splenomegaly and enlargement of lymph nodes, reduced numbers of mature follicular B cells, absence of marginal zone B cells, produce large quantities of anti-nuclear antibodies, and develop glomerulonephritis as early as 5 months of age (13;16-18). B cells from Lyn-/- mice are both hyperresponsive to BCR ligation and resistant to the inhibitory signals from FcγRIIb and CD22 (10-13). Peritoneal IgM+ B220+ B cell numbers were significantly lower in Lyn-/- mice at 2 months of age compared to wild-type mice and the size of the Peyer’s patches were reduced (17;18). As a result, CD5 B220high conventional B cells and B1 cells were also reduced (18). The Pacific mice did not exhibit reduced frequencies of peripheral B cell numbers, indicating that some Lyn function may persist in the Pacific mice.

Primers PCR Primer
Pacific_pcr_F: TTCTCTTCTATAGGGCACTGCAAG
Pacific_pcr_R: CATTTCATAGAGGTTGCAGCAGG

Sequencing Primer
Pacific_seq_F: CTGCAAGCCATATTGAAGTTGAAACG
Pacific_seq_R: TTTCATAGAGGTTGCAGCAGGGATAC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 401 nucleotides is amplified (chromosome 4, + strand):


1   ttctcttcta tagggcactg caagccatat tgaagttgaa acgatgtttt tttatttttg
61  catgtgacac taaatacatt tttctatgaa aaggaataca cttttacccc tgggtttagg
121 ggtttcagga atgctccctc ttgttttcag tctgcaaaag aaagacctta ggacaattgc
181 cgttacaact cttgaccttg acttctattc caggcatggg gaatggtgga aagctaagtc
241 cctttcatca aagagagaag gcttcatccc cagcaactac gtggccaagg tcaacacctt
301 agaaactgaa gagtgagttc tattacatgg ccatcctggt gtttctaaac gctacatagg
361 attgcttatt tttgtatccc tgctgcaacc tctatgaaat g


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsMing Zeng, Xue Zhong, and Bruce Beutler