Phenotypic Mutation 'bakers_dozen' (pdf version)
Allelebakers_dozen
Mutation Type frame shift
Chromosome3
Coordinate68,697,987 bp (GRCm38)
Base Change TCAC ⇒ TC (forward strand)
Gene Il12a
Gene Name interleukin 12a
Synonym(s) IL-12p35, p35
Chromosomal Location 68,690,644-68,698,547 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001159424 (variant 1), NM_008351 (variant 2); MGI:96539

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000029345] [ENSMUSP00000103446]
SMART Domains Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
Pfam:IL12 27 236 2.5e-106 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776

DomainStartEndE-ValueType
Pfam:IL12 1 215 6.8e-128 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
MCMV proliferation in macrophages - increased
MCMV susceptibility
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (other)(1) Radiation induced(1) Targeted(6) Transgenic (1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Il12a APN 3 68691555 missense possibly damaging 0.96
IGL01820:Il12a APN 3 68692162 splice site probably benign
IGL01989:Il12a APN 3 68691576 splice site probably benign
R0388:Il12a UTSW 3 68695187 splice site probably null
R0646:Il12a UTSW 3 68697890 splice site probably benign
R1083:Il12a UTSW 3 68695333 missense probably damaging 1.00
R1588:Il12a UTSW 3 68695563 missense probably benign 0.04
R2240:Il12a UTSW 3 68694184 nonsense probably null
R2909:Il12a UTSW 3 68697987 frame shift probably null
R2925:Il12a UTSW 3 68697987 frame shift probably null
R3696:Il12a UTSW 3 68697987 frame shift probably null
R3697:Il12a UTSW 3 68697987 frame shift probably null
R3698:Il12a UTSW 3 68697987 frame shift probably null
R4332:Il12a UTSW 3 68695261 intron probably benign
R5809:Il12a UTSW 3 68695262 intron probably benign
R6279:Il12a UTSW 3 68697979 missense probably damaging 0.96
R6305:Il12a UTSW 3 68694178 missense possibly damaging 0.80
R6847:Il12a UTSW 3 68695566 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-12-20 12:52 PM by Anne Murray
Record Created 2015-12-10 1:43 PM by Bruce Beutler
Record Posted 2018-12-05
Phenotypic Description

Figure 1. Bakers_dozen mice exhibited increased MCMV titers in the spleen after MCMV infection. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The bakers_dozen phenotype was identified among G3 mice of the pedigree R2925, some of which showed increased mouse cytomegalovirus (MCMV) proliferation in macrophages of the spleen after MCMV infection, indicating increased MCMV susceptibility (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the MCMV susceptibility phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 48 mutations (X-axis) identified in the G1 male of pedigree R2925. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. The increased susceptibility to MCMV infection phenotype was linked by continuous variable mapping to a mutation in Il12a: a TCAC>TC substitution at base pair 68,697,987 (v38) on chromosome 3, or base pair 7,344 in the GenBank genomic region NC_000069 within exon 8 out of 8 total exons. Linkage was found with a recessive model of inheritance (P = 1.28 x 10-4), wherein seven variant homozygotes departed phenotypically from 14 homozygous reference mice and 21 heterozygous mice (Figure 2).

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in a frame-shift in the encoded protein. The frame-shift is predicted to result in coding of 34 aberrant amino acids after amino acid 216, and is predicted to result in loss of the original stop codon after amino acid 236. The frame-shift results in coding of a stop codon 45-base pairs within the 3’-untranslated region (3’-UTR) of exon 8.

 

7330 CTCTGCATCCTGCTTCACGCCTTCAGCACCCGC

212  -L--C--I--L--L--H--A--F--S--T--R-

                 correct

 

7330 CTCTGCATCCTGCTTCGCCTT……CACAGATAG

212  -L--C--I--L--L--R--L-……-H--R--*-

         correct        aberrant

 

Genomic numbering corresponds to NC_000069. The mutated nucleotides are indicated in red.  The highlighted portion indicates nucleotides with the 3’-UTR.

Protein Prediction
Figure 3. The IL-12p35 protein. IL-12p35 has no structural domains. The bakers_dozen mutation causes a frame-shift resulting in the coding of 34 aberrant amino acids after amino acid 216. It is predicted to result in loss of the original stop codon after amino acid 236.

Il12a encodes interleukin 12a (IL-12a; alternatively IL-12p35 or p35), a subunit of the cytokines IL-12 and IL-35. IL-12 and IL-35 are members of the IL-12 family of cytokines, which also includes IL-23 and IL-27. Each member of the IL-12 family forms a heterodimer containing an α-subunit (i.e., IL-12p35, IL-23p19 and IL-27p28) and a β-subunit (i.e., IL-12p40 and Ebi3); both subunits are required for secretion of an active cytokine (1). The IL-12p40 β-subunit can pair with both IL-12p35 and IL-23p19 to form IL-12 and IL-23, respectively, while Ebi3 can dimerize with IL-27p28 or IL-12p35 to form IL-27 or IL-35, respectively.

 

IL-12p35 has no structural domains, but the α-subunits of the IL-12 family have a four-helix bundle structure similar to type 1 cytokines (e.g., IL-6 and CNTF) [Figure 3; reviewed in (2;3)].

 

Il12a has alternative transcriptional start sites that produce p35 transcripts with variable translational efficiencies (4). The p35 mRNA is constitutively synthesized in unstimulated cells, but little protein is secreted due to an inhibitory ATG in the 5’-UTR. After LPS stimulation, the transcription start site changes so the inhibitory region is excluded, and translation occurs (4).

 

The bakers_dozen mutation is predicted to result in a frame-shift in the encoded protein. The frame-shift is predicted to result in coding of 34 aberrant amino acids after amino acid 216, and is predicted to result in loss of the original stop codon after amino acid 236 and coding of a new stop codon 45-base pairs within the 3’-UTR of exon 8.

Expression/Localization

p35 is expressed ubiquitously at low levels (4;5). IL-12 is secreted primarily by monocytes, dendritic cells, B cells, and macrophages in response to pathogens (6;7). IL-12 (primarily IL-12p40) is positively regulated by IFNγ (8) and negatively regulated by IL-4, IL-10, IL-11, IL-13, and type 1 IFNs (9). IL-12 expression in monocytes/macrophages and dendritic cells is also induced by TLR2, -4, -5, and -9 agonists (10). IL-35 is exclusively produced by regulatory T cells (11;12).

Background
Figure 4. IL-12 and IL-35 signal through the JAK-STAT pathway. Upon receptor stimulation, JAK proteins phosphorylate the receptor cytoplasmic domains. STAT proteins are recruited to the receptor, tyrosine phosphorylated by JAKs, and dimerize for translocation to the nucleus with the assistance of importin-α5 (associated with importin-β). Once STAT1 binds to its DNA target, importin-α5 is recycled to the cytoplasm by the cellular apoptosis susceptibility protein (CAS) export receptor. Suppressors of cytokine signaling (SOCS) proteins can directly bind and suppress JAKs or can compete with STATs for receptor binding. The tyrosine phosphatases SHP1 and SHP2 inhibit signaling by dephosphorylating STAT proteins.

IL-12 cytokines mediate their functions by the Janus activating kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway. Only the p35-associated cytokines (IL-12 and IL-35) will be discussed further. IL-12 binds the IL-12 receptor (IL-12Rβ1/IL-12Rβ2) on activated T cells, natural killer cells and dendritic cells, subsequently signaling through the JAK2/tyrosine kinase 2 (TYK2)-STAT4 signaling pathway [Figure 4; reviewed by (2)]. IL-35 binds a receptor that is composed of a IL-12Rβ2/gp130 heterodimer, and signals through both JAK2/STAT4 and JAK1/STAT1 (13). IL-35 can also bind receptors that contain gp130-gp130 and IL12Rβ2-lL12Rβ2 homodimers to signal via JAK1/STAT1 and JAK2/STAT4, respectively.

 

The canonical JAK-STAT signaling pathway begins with the binding of one or more cytokines to their cognate cell-surface receptors. These receptors are associated with JAK tyrosine kinases (see the record mount_tai for information about JAK3), which are normally dephosphorylated and inactive. Receptor stimulation results in dimerization/oligomerization and subsequent apposition of JAK proteins, which are now capable of trans-phosphorylation as they are brought in close proximity. This activates JAKs to phosphorylate the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT proteins (see the record domino for information about STAT1 and numb for information about STAT2). Once recruited to the receptor, STAT proteins are also tyrosine phosphorylated by JAKs, a phosphorylation event which occurs on a single tyrosine residue that is found at around residue 700 of all STATs. Tyrosine phosphorylation of STATs may allow formation and/or conformational reorganization of the activated STAT dimer, involving reciprocal SH2 domain-phosphotyrosine interactions between STAT monomers. Phosphorylated, activated STATs enter the nucleus and accumulate there to promote transcription. For more information about JAK-STAT signaling, see the record domino.

 

The IL-12 family members prime naïve CD4 T cells, promote the differentiation of CD4 T cells to cytokine-producing T-helper subsets and memory T cells, and promote the activation of pro-inflammatory responses that subsequently protect against infection and prevent autoimmune diseases (12;14-16). IL-12 induces T-bet and promotes naïve CD4+ T cell differentiation into Th1 cells, while inhibiting IL-4 production and antagonizing Th2 responses [reviewed in (3)]. IL-12 also induces IFNg production by natural killer cells and innate lymphoid cells. IL-12 is required for bacterial and intracellular parasite infection resistance (17). CD8 T cells use IL-12, T-cell receptor, and/or type I interferon signals to promote differentiation and effector functions during an infection to aid in pathogen clearance and the generation of pathogen-specific memory T cells (18).

 

IL-35 suppresses T cell proliferation and Th17 cell development by inducing cell cycle arrest in G1 (19-21). IL-35 blocks Th2 development by repressing GATA3 and IL-4 expression and limiting Th2 proliferation [reviewed in (3)]. IL-35 also induces the development in the periphery of an induced regulatory T cell (iTreg) population from CD4+Foxp3- conventional T cells (19-21). iTreg cells, together with “natural” Tregs, are required for immune tolerance. Il12a-deficient T cells showed reduced regulatory activity as well as a failure to control homeostatic proliferation (20).

 

IL12A mutations are associated with cases of primary biliary cirrhosis (22), celiac disease (23;24), multiple sclerosis (25), Graves’ disease (26), and asthma (27). Patients with autoimmune diseases (e.g., rheumatoid arthritis, psoriasis, and inflammatory bowel disease) show increased levels of IL-12 in affected tissues (28-30). IL-12 promotes inflammation and the development of chronic inflammatory diseases, while IL-35 suppresses inflammation and mitigate autoimmune diseases.

Putative Mechanism

Il12a-deficient (Il12a-/-) mice lack both IL-12 and IL-35. Il12a-/- mice exhibited reduced numbers of natural killer cells producing IFNγ after MCMV, Leishmania major, or Leishmania infantum infections or in response to the TLR9 agonist CpG (31-34). After MCMV or LCMV infections, the levels of IFNγ was lower than that in controls (31;35). The levels of circulating IL-12 levels after LCMV infection or LPS injection were absent (35). Il12a-/- mice exhibited increased sensitivity to N-methyl-N-nitrosourea (MNU) compared to similarly treated wild-type controls (36) as well as increased incidence of tumors by chemical induction (37). Il12a-/- mice showed increased susceptibility to induced rheumatoid arthritis (38).

 

The phenotype of the bakers_dozen mice mimics that of Il12a-/- mice, indicating loss of p35-associated function.

Primers PCR Primer
bakers_dozen(F):5'- GGACTTTGCATTGACTGTCTCC -3'
bakers_dozen(R):5'- AGGTAGCTGTGCCACCTTTG -3'

Sequencing Primer
bakers_dozen_seq(F):5'- GACTGTCTCCCATTTTGCAGACAAAC -3'
bakers_dozen_seq(R):5'- CCACCTTTGGGGAGATGAG -3'
References
  23. Dubois, P. C., Trynka, G., Franke, L., Hunt, K. A., Romanos, J., Curtotti, A., Zhernakova, A., Heap, G. A., Adany, R., Aromaa, A., Bardella, M. T., van den Berg, L. H., Bockett, N. A., de la Concha, E. G., Dema, B., Fehrmann, R. S., Fernandez-Arquero, M., Fiatal, S., Grandone, E., Green, P. M., Groen, H. J., Gwilliam, R., Houwen, R. H., Hunt, S. E., Kaukinen, K., Kelleher, D., Korponay-Szabo, I., Kurppa, K., MacMathuna, P., Maki, M., Mazzilli, M. C., McCann, O. T., Mearin, M. L., Mein, C. A., Mirza, M. M., Mistry, V., Mora, B., Morley, K. I., Mulder, C. J., Murray, J. A., Nunez, C., Oosterom, E., Ophoff, R. A., Polanco, I., Peltonen, L., Platteel, M., Rybak, A., Salomaa, V., Schweizer, J. J., Sperandeo, M. P., Tack, G. J., Turner, G., Veldink, J. H., Verbeek, W. H., Weersma, R. K., Wolters, V. M., Urcelay, E., Cukrowska, B., Greco, L., Neuhausen, S. L., McManus, R., Barisani, D., Deloukas, P., Barrett, J. C., Saavalainen, P., Wijmenga, C., and van Heel, D. A. (2010) Multiple Common Variants for Celiac Disease Influencing Immune Gene Expression. Nat Genet. 42, 295-302.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsDuanwu Zhang, Tao Yue, and Bruce Beutler