Phenotypic Mutation 'snowdrop'

• Allele: snowdrop
• Mutation Type: critical splice donor site
• Chromosome: 19
• Coordinate: 25,184,941 bp (GRCm38)
• Base Change: G ⇒ A (forward strand)
• Gene: Dock8
• Gene Name: dedicator of cytokinesis 8
• Synonym(s): A130095G14Rik, 5830472H07Rik, 1200017A24Rik
• Chromosomal Location: 24,999,529-25,202,432 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010] ; PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 24999529 - 25202432 bp
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000025831 ^†] † probably from a misspliced transcript
• AlphaFold: Q8C147
• PDB Structure: Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000025831; Gene: ENSMUSG00000052085

Domain	Start	End	E-Value	Type
Pfam:DUF3398	71	164	3.9e-25	PFAM
Pfam:DOCK-C2	557	739	6.7e-49	PFAM
low complexity region	786	803	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1123	1138	N/A	INTRINSIC
low complexity region	1236	1246	N/A	INTRINSIC
low complexity region	1371	1383	N/A	INTRINSIC
Pfam:DHR-2	1534	2060	5e-210	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9593
• Is this an essential gene?: Probably nonessential (E-score: 0.092)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-12-11 7:49 PM by Jin Huk Choi
• Record Posted: 2016-01-11
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jin Huk Choi, James Butler, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_028785; MGI:1921396

Alleles Listed at MGI

All Mutations and Alleles(11) : Chemically induced (ENU)(4) Gene trapped(4) Targeted(3)

Phenotypic Description

Figure 1. Homozygous snowball mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The snowdrop phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3959, some of which  exhibited a diminished T-dependent antibody (IgG) response to ovalbumin administered with aluminum hydroxide (OVA/alum) (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent antibody response to OVA/alum using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 38 mutations (X-axis) identified in the G1 male of pedigree R3959. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 38 mutations. The reduced T-dependent antibody response to OVA/alum was linked by continuous variable mapping to a mutation in Dock8: a G to A transition at base pair 25,184,941 (v38) on chromosome 19, or base pair 185,431 in the GenBank genomic region NC_000085 encoding the Dock8 gene. Linkage was found with a recessive model of inheritance, wherein five variant homozygotes departed phenotypically from eight homozygous reference mice and 11 heterozygous mice with a P value of 7.041 x 10^-6 (Figure 2). A substantial semidominant effect was observed, but the mutation is preponderantly recessive. 

The effect of the mutation at the cDNA and protein levels have not examined, but the mutation is predicted to result in skipping of the 90-base pair exon 43 (out of 48 total exons), which begins after amino acid 1831 (out of 2100 total amino acids) of the protein.

<--exon 42        <--exon 43 intron 43-->     exon 44-->            <--exon 48 184099 ……TCACATAGACTAGAG ……TTGGATCCTAACAAG gtatggaaaaaata…… GCCTACATTCAG…… ……TCACAGGGCAGCTGA 1827   ……-S--H--R--L--E- ……-L--D--P--N--K-                  -A--Y--I--Q-…… ……-S--Q--G--S--*-             correct           deleted                                  correct

Genomic numbering corresponds to NC_000085. The donor splice site of intron 43, which is destroyed by the snowdrop mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 3. Domain structure of DOCK8, a member of the DOCKC subfamily. DHR-1 domain shares a weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac and/or Cdc42. The snowball mutation results in abnormal splicing of Dock8 causing deletion of exon 44, which encodes amino acids 1862-1940 C-terminal to the DHR-2 domain. Click on the image to view other mutations found in DOCK8. Click on the mutation for more specific information.

DOCK8 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases (1-4). The DOCK C subfamily (which includes DOCK8 and DOCK7; see the record for moonlight) has dual specificity for Rac and Cdc42 (1;3;5;6). Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain and the DHR-1 or CZH-1 domain (Figure 3). The DHR-1 domain is located N-terminal to the DHR-2 domain (2;4).

The snowdrop mutation results in abnormal splicing of Dock8 causing deletion of exon 44, which encodes amino acids 1862-1940 C-terminal to the DHR-2 domain.

For more information on Dock8, please see the record for captain morgan.

Putative Mechanism

The Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription, and neurite extension and retraction. Like DOCK2, DOCK8 is likely to regulate the activity of GTPases and thus be involved in cytoskeletal changes associated with various cellular processes. DOCK8 is proposed to serve as an effector downstream of CD19 and PI3K to promote G protein signaling events critical for integrin polarization at the synapse and for the survival of marginal zone B cells and germinal center (GC) B cells. 

During a T cell-dependent humoral immune response, CD4⁺ T helper cell subsets including T_FH, Th1 and Th2 cells migrate to the T cell/B cell borders in secondary lymphoid organs, and interact with cognate antigen-specific B cells through the pairing of T cell and B cell surface ligands and receptors such as CD40 with its ligand (see the record for walla).  This interaction results in the secretion by T helper cells of certain cytokines known to promote B cell survival, proliferation, and antibody production (7;8).

In humans, DOCK8 deficiency results in an autosomal recessive form of hyper-IgE recurrent infection syndrome (HIES; OMIM #243700) (9;10).  Autosomal dominant HIES is characterized by recurrent Staphylococcus aureus skin abscesses, increased serum IgE, and abnormalities of the connective tissue, skeleton, and dentition (11).  The autosomal recessive form shares hyper-IgE, eosinophilia, and recurrent Staphylococcal infections, but is distinguished from autosomal dominant HIES by the lack of connective tissue and skeletal involvement (12). Patients with DOCK8 deficiency are unusually susceptible to viral infections and virally-caused cancers. Reduced numbers of T, B, and NK cells have been reported along with a selective defect in CD8⁺ T cell activation (9). However, another study suggests most patients have normal numbers of B and NK cells, a greater decrease in the CD4⁺ T cell population than the CD8⁺ T cell population, and a more comprehensive T cell activation defect involving both T cell subsets (10). Both autosomal dominant and autosomal recessive HIES are linked to a lack of Th17 cell function including the failure to produce the interleukin 17 (IL-17) cytokine (12). Th17 are a subset of CD4⁺ T helper cells that play an important role in the development of autoimmune diseases like rheumatoid arthritis, as well as being critical in the clearance of fungal and extracellular bacterial infections (13).    

The relatively normal initiation of antibody production by mice with Dock8 mutations suggests that the extrafollicular B cell clonal expansion, plasma cell formation, and immunoglobulin class switching, which depends on interactions with T helper cells, is intact. However, subsequent antibody responses and affinity maturation occurring in the germinal centers (GCs) is significantly impaired. The humoral deficits are due to a defect in GC B cell survival and selection during the affinity maturation phase of GC responses (14).

Primers

PCR Primer
snowdrop_pcr_F: ATCAACAAATCCTGCCTTGTGC
snowdrop_pcr_R: GGTGCTAAACTCCAGCTTGC

Sequencing Primer
snowdrop_seq_F: CTTGTTCCAAAGGAGTGCAAGC
snowdrop_seq_R: TAAACTCCAGCTTGCACATGTGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 19, + strand):

1   atcaacaaat cctgccttgt gcttgttcca aaggagtgca agctttcaaa ctgaacttta
61  tatactctgg gcctctcttc cctagggatt ttatggccag tgtttcggtg cagagtttgt
121 ggaagtgata aaagactcta ctccagtgga caaaaccaag ttggatccta acaaggtatg
181 gaaaaaatat atactaaaag tggttatcac actctaccct aacagtagaa aatggcagac
241 ccagaggtct ggactccccc agtccttcaa atgtgaccat gttttagttt gttttttagg
301 ggggaggggt gcacacacat gtatgaatgg agtgtatgca tgtgtgtgtg caggctcact
361 cttccataca tgcccacatg tgcaagctgg agtttagcac c

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Cote, J. F., and Vuori, K. (2002) Identification of an Evolutionarily Conserved Superfamily of DOCK180-Related Proteins with Guanine Nucleotide Exchange Activity. J Cell Sci. 115, 4901-4913.

  2. Cote, J. F., and Vuori, K. (2007) GEF what? Dock180 and Related Proteins Help Rac to Polarize Cells in New Ways. Trends Cell Biol. 17, 383-393.

  3. Meller, N., Irani-Tehrani, M., Kiosses, W. B., Del Pozo, M. A., and Schwartz, M. A. (2002) Zizimin1, a Novel Cdc42 Activator, Reveals a New GEF Domain for Rho Proteins. Nat Cell Biol. 4, 639-647.

  4. Meller, N., Irani-Tehrani, M., Ratnikov, B. I., Paschal, B. M., and Schwartz, M. A. (2004) The Novel Cdc42 Guanine Nucleotide Exchange Factor, zizimin1, Dimerizes Via the Cdc42-Binding CZH2 Domain. J Biol Chem. 279, 37470-37476.

  5. Brugnera, E., Haney, L., Grimsley, C., Lu, M., Walk, S. F., Tosello-Trampont, A. C., Macara, I. G., Madhani, H., Fink, G. R., and Ravichandran, K. S. (2002) Unconventional Rac-GEF Activity is Mediated through the Dock180-ELMO Complex. Nat Cell Biol. 4, 574-582.

  6. Miyamoto, Y., Yamauchi, J., Sanbe, A., and Tanoue, A. (2007) Dock6, a Dock-C Subfamily Guanine Nucleotide Exchanger, has the Dual Specificity for Rac1 and Cdc42 and Regulates Neurite Outgrowth. Exp Cell Res. 313, 791-804.

  7. MacLennan, I. C., Toellner, K. M., Cunningham, A. F., Serre, K., Sze, D. M., Zuniga, E., Cook, M. C., and Vinuesa, C. G. (2003) Extrafollicular Antibody Responses. Immunol Rev. 194, 8-18.

  8. King, C., Tangye, S. G., and Mackay, C. R. (2008) T Follicular Helper (TFH) Cells in Normal and Dysregulated Immune Responses. Annu Rev Immunol. 26, 741-766.

  9. Zhang, Q., Davis, J. C., Lamborn, I. T., Freeman, A. F., Jing, H., Favreau, A. J., Matthews, H. F., Davis, J., Turner, M. L., Uzel, G., Holland, S. M., and Su, H. C. (2009) Combined Immunodeficiency Associated with DOCK8 Mutations. N Engl J Med. 361, 2046-2055.

  10. Engelhardt, K. R., McGhee, S., Winkler, S., Sassi, A., Woellner, C., Lopez-Herrera, G., Chen, A., Kim, H. S., Lloret, M. G., Schulze, I., Ehl, S., Thiel, J., Pfeifer, D., Veelken, H., Niehues, T., Siepermann, K., Weinspach, S., Reisli, I., Keles, S., Genel, F., Kutukculer, N., Camcioglu, Y., Somer, A., Karakoc-Aydiner, E., Barlan, I., Gennery, A., Metin, A., Degerliyurt, A., Pietrogrande, M. C., Yeganeh, M., Baz, Z., Al-Tamemi, S., Klein, C., Puck, J. M., Holland, S. M., McCabe, E. R., Grimbacher, B., and Chatila, T. A. (2009) Large Deletions and Point Mutations Involving the Dedicator of Cytokinesis 8 (DOCK8) in the Autosomal-Recessive Form of Hyper-IgE Syndrome. J Allergy Clin Immunol. 124, 1289-302.e4.

  11. Grimbacher, B., Holland, S. M., Gallin, J. I., Greenberg, F., Hill, S. C., Malech, H. L., Miller, J. A., O'Connell, A. C., and Puck, J. M. (1999) Hyper-IgE Syndrome with Recurrent Infections--an Autosomal Dominant Multisystem Disorder. N Engl J Med. 340, 692-702.

  12. Renner, E. D., Puck, J. M., Holland, S. M., Schmitt, M., Weiss, M., Frosch, M., Bergmann, M., Davis, J., Belohradsky, B. H., and Grimbacher, B. (2004) Autosomal Recessive Hyperimmunoglobulin E Syndrome: A Distinct Disease Entity. J Pediatr. 144, 93-99.

  13. Weaver, C. T., Hatton, R. D., Mangan, P. R., and Harrington, L. E. (2007) IL-17 Family Cytokines and the Expanding Diversity of Effector T Cell Lineages. Annu Rev Immunol. 25, 821-852.

  14. Randall, K. L., Lambe, T., Johnson, A. L., Treanor, B., Kucharska, E., Domaschenz, H., Whittle, B., Tze, L. E., Enders, A., Crockford, T. L., Bouriez-Jones, T., Alston, D., Cyster, J. G., Lenardo, M. J., Mackay, F., Deenick, E. K., Tangye, S. G., Chan, T. D., Camidge, T., Brink, R., Vinuesa, C. G., Batista, F. D., Cornall, R. J., and Goodnow, C. C. (2009) Dock8 Mutations Cripple B Cell Immunological Synapses, Germinal Centers and Long-Lived Antibody Production. Nat Immunol. 10, 1283-1291.