Phenotypic Mutation 'lps3'

• Allele: lps3
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 66,841,097 bp (GRCm38)
• Base Change: A ⇒ T (forward strand)
• Gene: Tlr4
• Gene Name: toll-like receptor 4
• Synonym(s): Rasl2-8, Lps, lipopolysaccharide response
• Chromosomal Location: 66,827,584-66,930,284 bp (+)
• MGI Phenotype: FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015] ; PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9QUK6
• PDB Structure: Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION] ; Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000045770; Gene: ENSMUSG00000039005; AA Change: D709V

Domain	Start	End	E-Value	Type
LRR	76	99	7.36e0	SMART
LRR	100	123	1.86e0	SMART
LRR	173	196	8.24e0	SMART
LRR	370	401	4.33e1	SMART
LRR	468	492	2.54e2	SMART
LRR	493	516	1.86e2	SMART
LRR	517	540	1.67e2	SMART
LRR	541	563	1.92e2	SMART
LRRCT	576	626	4.74e-3	SMART
transmembrane domain	636	658	N/A	INTRINSIC
TIR	671	816	7.3e-39	SMART
low complexity region	822	833	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000048096)
• SMART Domains: Protein: ENSMUSP00000102988; Gene: ENSMUSG00000039005

Domain	Start	End	E-Value	Type
PDB:3VQ2|B	22	86	2e-38	PDB
SCOP:d1m0za_	27	86	4e-6	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Embryos, Sperm
• MMRRC Submission: 030238-UCD
• Last Updated: 2018-12-14 10:57 AM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2007-12-28
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Owen M. Siggs, Bruce Beutler

Accession Number

NCBI RefSeq: NM_021297; MGI: 96824

Alleles Listed at MGI

All alleles(8) : Targeted, knock-out(1) Spontaneous(5) Chemically induced(2)

Phenotypic Description

The lps3 phenotype was identified in a G3 screen for mutants with impaired response to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from lps3 mice produce normal amounts of tumor necrosis factor (TNF)-α in response to all TLR ligands tested, except lipopolysaccharide (LPS). In response to LPS, homozygous lps3 macrophages produce no TNF-α. In addition, they fail to produce type I interferon (IFN) in response to LPS. Heterozygous lps3 macrophages produce TNF-α and type I IFN at wild type levels (Figure 1).

 

Nature of Mutation

The Tlr4 gene on Chromosome 4 of Lps3 mice was sequenced, and an A to T transversion was identified in exon 3 (of 3 total exons) at position 2147 of the Tlr4 transcript.

 

2131 TGCCTTCACTACAGAGACTTTATTCCTGGTGTA

704  -C--L--H--Y--R--D--F--I--P--G--V-

 

The mutated nucleotide is indicated in red lettering, and results in an aspartic acid to valine change at amino acid 709 of the TLR4 protein.

Protein Prediction

Figure 2. Protein and domain structure of TLR4. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the Lps3 mutation is highlighted. 3D image was created using UCSF Chimera. B) TLR4 is an 835 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The Lps3 mutation (red asterisk) results in an aspartic acid to valine change at position 709 of the TLR4 protein. This image is interactive. Click on the image to view other mutations found in TLR4 (red). Click on the mutations for more specific information.

TLR4, a type I integral membrane glycoprotein containing 835 amino acids, is the receptor for LPS (1). Like the other TLRs, its cytoplasmic domain (at its C terminus) shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (2;6), which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (named for the α-helix and β-strand they connect; e.g. AA connects βA with αA). The crystal structures of the TLR1 and TLR2 TIR domains reveal that they fold into a structure with the five β-strands forming a central parallel β-sheet which is surrounded by five α-helices (3) (see the record for languid). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. Indeed, TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain 3 conserved boxes (boxes 1, 2 and 3) required for signaling, which form part of the βA-strand, BB loop and αE-helix, respectively (4;5). A proline to histidine mutation in the BB loop, identified in Tlr4^Lps-d mice abolishes LPS-induced signaling in mice (1), and MyD88 binding to the TLR4 TIR domain (7) (Figure 2).

 

The extracellular domains of TLRs, unlike those of the interleukin receptors, contain multiple leucine-rich repeats (LRRs), which mediate ligand recognition by TLRs and consist of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) followed by XØXXØX₄FXXLX (residues ~11-24, but variable in length, sequence and structure), where X is any amino acid and Øis a hydrophobic amino acid [discussed in (8)]. Crystal structures of several TLRs reveal that each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (9-12). In addition, the XLXXLXLXX sequence folds into a β-strand, with the remaining LRR residues oriented on the convex side of the structure.

 

TLR4 has 22 predicted LRRs in its ectodomain encoded by the N-terminal half of the protein (2;6;8). The crystal structure of the TLR4 ectodomain reveals a horseshoe structure, but composed of distinct N-terminal, central and C-terminal domains (12). The β-sheet of the central domain has an unusually small radius and large twist angle (12). The concave N-terminal and central domains of the TLR4 ectodomain provide the binding surface for MD-2 (see Background; Figure 3, PDB ID 2Z64) (12).

 

The lps3 mutation results in an aspartic acid to valine change at position 709 of the TLR4 protein, which lies in the BB loop of the TIR domain (Figure 3).

Expression/Localization

Tlr4 transcripts of two sizes are detected in multiple human tissues, including heart, brain, placenta, lung, skeletal muscle, kidney, pancreas, thymus, prostate, testis, ovary, small intestine and colon, but not in liver (2;6). Tlr4 expression is highest in spleen and peripheral blood leukocytes (6). RT-PCR analysis of several cell lines indicates Tlr4 expression in monocytes, macrophages, dendritic cells, γ/δ T cells, Th1 and Th2 α/β T cells, a small intestinal epithelial cell line, and a B cell line (6). TLR4 is localized on the cell surface.

Background

Many years before the identification of TLR4 as its receptor, LPS, a glycolipid of the outer membrane of Gram-negative bacteria, was known to cause fever and shock and sometimes death by inducing cytokine production (particularly TNF) by hematopoietic cells (13-15). However, two spontaneously occurring mouse strains, C3H/HeJ and C57BL/10ScCr, were found to be resistant to the lethal effect of LPS (16-18). The existence of a single locus responsible for the response to LPS was strongly supported by analysis of progeny of C3H/HeJ mice backcrossed to LPS-sensitive CWB mice (19), and later confirmed and mapped to mouse Chromosome 4 using classical phenotypic markers (20;21). These mapping studies demonstrated that the locus, designated Lps, lay between the major urinary protein (Mup1) and polysyndactyly (Ps) loci (21). Furthermore, complementation studies showed that the affected loci in C3H/HeJ and C57BL/10ScCr strains were allelic (17;18).

 

Although the existence of the mammalian TLR4 sequence was known from EST databases, and a full-length sequence was cloned and shown to activate NF-κB in transfected Jurkat cells (2;6), its definitive identity as the LPS receptor was unknown until the positional cloning of the Lps gene. Lps was identified through high-resolution mapping studies using LPS-resistant or –sensitive mice (22-25), and ultimately through sequencing a minimal contig composed of 12 BACs and one YAC, which revealed Tlr4 as a promising candidate gene within the critical region (1). Sequencing of Tlr4 cDNA from both C3H/HeJ and LPS-sensitive strains revealed a point mutation in the Tlr4 coding sequence of C3H/HeJ mice, predicted to substitute histidine for proline at position 712 of TLR4, located in the cytoplasmic domain (1). A small deletion encompassing the entire Tlr4 locus but no other genes was found in the C57BL/10ScCr strain and results in a protein-null animal (1;26). These results were subsequently confirmed by other workers (27), and later, by phenotypic analysis of mice with a targeted deletion of TLR4 (28).  Still later, the LPS unresponsive phenotype was corrected by BAC transgenesis in animals lacking the Tlr4 locus (29). This study also showed that the Tlr4 locus is haploinsufficient, and that augmented LPS signaling occurred with increasing copy number over a fairly broad range. Hence, the quantity of TLR4 protein (rather than another component of the LPS sensing apparatus) seems to limit the LPS response.

Figure 4. Overview of Toll-like receptor (TLR) signaling pathways. Shown are the signaling events downstream of TLR activation that ultimately lead to the induction of thousands of genes including TNF and type I IFN, which are critical in activating innate and adaptive immune responses. TLR1,2,4,5 and 6 are located at the cell surface, while TLR3,7, and 9 are localized in the endosome. Once TLR complexes recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions.

In the MyD88-dependent pathway utilized by all TLRs except TLR3, MyD88 (lime green) recruits IRAK kinases through their death domains (DD). TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination (small light blue circles) of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2. Activation of TAK1 leads to activation of MAP kinase cascades and the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, p105, and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus and permitting TPL2 to become activated, respectively. Activation of the p38, JNK and ERK1/2 kinases leads to the activation of both CREB and AP1, which in turn induce many target genes. In pDCs, activation of TLR7 and 9 in endosomes recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN.
 
In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM (bright yellow) recruits polyubiquitinated RIP1, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3.

Note that TLR4 signals through the MyD88-dependent pathway from the cell membrane and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway. When bound to vesicular stomatitis virus glycoprotein G (VSV-G) (far left), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM. Upon viral stimulation, TLR2 may also be internalized into endosomes to activate both IRF3 and IRF7 by an unknown mechanism. LTA = lipoteichoic acid; LP2 = lipopeptide 2. PAM3CSK4 is a triacyl lipopeptide. Phosphorylation events are represented by small yellow circles labeled with a “P”. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Figure 5. Toll-like receptor 4 (TLR4) signaling pathways. Once TLR4 homodimers recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions. TLR4 signals through the MyD88-dependent pathway from the cell membrane to produce proinflammatory cytokines and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway to produce IFN. When bound to vesicular stomatitis virus glycoprotein G (VSV-G), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM.

The signaling partners and pathways activated by TLR4 continue to be extensively studied. TLR4 is now known to be served by the adapters MyD88 in combination with Mal (activating the MyD88-dependent pathway), and Trif in combination with Tram (activating the MyD88-independent pathway) [reviewed in (30;31)] (Figures 4 and 5). Stimulation of TLR4 by LPS activates two branches of signaling, one defined by early NF-κB activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as interferon responsive factor (IRF)-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by Trif) (32-34). Upon activation, the MyD88-dependent pathway proceeds by recruitment of MyD88 to the receptor, where it functions as an adapter to recruit IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6 (35;36). The ensuing signaling pathway culminates in the activation of NF-κB-dependent transcription. Briefly, IRAK-1 and TRAF6 dissociate from the receptor complex, and freed TRAF6 interacts with TAK1, activating it to phosphorylate the IκB kinase (IKK) complex. The IKK complex phosphorylates IκB, targeting it for degradation and relieving its inhibition of NF-κB which translocates to the nucleus and activates expression of target genes including interleukin (IL)-6, IL-1, TNF, IL-12p40 and type I interferon, cytokines required for the inflammatory response.

 

The MyD88-independent pathway was evidenced by the intact (but slightly delayed) LPS-dependent activation of NF-κB, JNK and MAP kinases in MyD88-deficient macrophages (32). This pathway relies on the adapter Trif, and its hallmark is the production of type I IFN. Trif signals to TRAF3 and TBK1, both of which are required for IRF-3 activation and subsequent IFN induction downstream of TLR4 (37;38).

 

While TLR4 is absolutely required for LPS sensing, the membrane-associated molecules CD14 (see heedless) and MD-2 have also been implicated in the TLR4-dependent LPS response (39-41). In MD-2-deficient fibroblasts, TLR4 is not properly localized at the plasma membrane, and MD-2-null mice do not respond to LPS (41). Cd14^-/- mice are resistant to LPS-induced shock, demonstrating that CD14 is required for the LPS response (39). CD14 allows the TLR4-MD-2 complex to distinguish between smooth and rough LPS chemotypes (40). Evidence indicates that CD14 may serve to bind to and transfer LPS to the TLR4-MD-2 (42;43).

 

In a study comparing the coding sequences of TLR4 in healthy patients or patients with meningococcal sepsis, rare heterozygous missense mutations of TLR4 were found in excess frequency among patients with disease compared to ethnically matched healthy patients (44). Interestingly, no one mutation was predominant in the diseased group (44), and in particular, the commonest variant allele, exhibiting a double amino acid substitution (D299G; T399I), was not represented at an excess frequency in the diseased group. These findings suggest that rare TLR4 mutations can affect LPS responsiveness to certain infections, and can contribute to increased risk of disease in humans. In another report, the single nucleotide polymorphisms D299G and T399I were reportedly associated with an impaired response to inhaled LPS in humans (45). However, this finding was challenged by the observation that the same polymorphic allele has no effect on TNF production by human mononuclear cells (46).

Putative Mechanism

Residues of the BB loop are highly conserved between TLRs, and mutation of prolines corresponding to the Lps-d mutation in TLR2 (3;47), MyD88 (48), Mal (49) or IL-1 receptor accessory protein (IL1RAcP) (50) abrogates signaling by these proteins. The crystal structure of the TLR2 TIR domain indicates that the BB loop forms part of a large conserved surface patch, with the BB loop extending away from the rest of the TIR domain in a protruding hydrophobic knob (3). Interestingly, studies of the structure and binding functions of the P681H mutant of TLR2 (corresponding to TLR4 P712H) demonstrate that P681 is not likely to contribute to the structural integrity of TLR2, since mutation to histidine had no significant effects on overall TIR domain structure (3). The effect on signaling is therefore likely to be caused by impaired binding of TLR2 P681H to its signaling partners. Consistent with this, the P681H-mutated TLR2 TIR domain fails to bind MyD88 in vitro (3), and the MyD88 TIR domain with P200H mutation fails to act as a dominant negative inhibitor of IL-1β signaling in HEK293 cells (5).

 

The lps3 mutation substitutes valine for aspartic acid at position 709 of TLR4. With the exception of TLRs 1 and 6, an aspartic acid at this position is conserved in all TLRs, as well as in MyD88, Mal and IL1RAcP. This residue, only 3 amino acids from the canonical P712H Tlr4^Lps-d mutation, lies within the critical BB loop. In contrast to the conserved proline residue of the BB loop, the nearby aspartic acid residue which is mutated in lps3, in addition to other adjacent amino acids (arginine, glycine), are predicted to form ion-pair interactions that may stabilize the conformation of the BB loop (3). Mutation of the arginine, aspartic acid or glycine residue in TLR4 prevents activation of an NF-κB reporter (3), and mutation of arginine and aspartic acid in MyD88 results in a dominant negative protein that inhibits signaling stimulated by IL-1β (5). Thus, the effect of such mutations is ultimately to block signal transduction by TIR domains, whether primarily by destabilizing the BB loop, or by otherwise preventing interactions between signaling partners. The lps3 phenotype further supports this hypothesis. Interestingly, lps3 is a purely recessive phenotype, suggesting that residual signaling from the Tlr4^lps3 allele can support a normal response to LPS stimulation in heterozygous lps3 mice. TLR4 functions as a dimer, and codominance of the Lps-d mutation suggests that the presence of one P712H-mutant TLR4 molecule blocks recruitment of signaling partners to the receptor complex. In contrast, the recessive nature of the lps3 mutation suggests that both subunits of the complex must contain the mutation to abrogate signaling.

 

The P681H mutation in TLR2 only partially abrogates signaling, in a ligand-dependent manner, from the TLR2/6 complex (48). Although it may be predicted that engrafting the lps3 mutation onto TLR2 would result in signaling similar to that supported by TLR2 P681H, examination of the effect of the lps3 mutation on signaling by the TLR2/6 complex may provide further insight into the mechanism of this receptor:adapter interaction.

Primers

Primers cannot be located by automatic search.

Genotyping

Lps3 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Lps3(F): 5’- AGCACCTGGATTTTCAGCACTCTAC -3’

Lps3(R): 5’- AAGGCCCAGTGAAGACTGGTTCTC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:30

4) 68°C             1:00

5) repeat steps (2-4) 35X

6) 68°C             10:00

7) 4°C               ∞

 

Primers for sequencing

Lps3_seq(F): 5’- GGGGTATTTGACACCCTCCATAG -3’

Lps3_seq(R): 5’- TAGGTAATTCATACCCCTGGAAAGG -3’

 

The following sequence of 1528 nucleotides (from Genbank genomic region NC_000070 for linear DNA sequence of Tlr4) is amplified:

 

12429         ag cacctggatt ttcagcactc tactttaaaa agggtcacag aattctcagc

12481 gttcttatcc cttgaaaagc tactttacct tgacatctct tatactaaca ccaaaattga

12541 cttcgatggt atatttcttg gcttgaccag tctcaacaca ttaaaaatgg ctggcaattc

12601 tttcaaagac aacacccttt caaatgtctt tgcaaacaca acaaacttga cattcctgga

12661 tctttctaaa tgtcaattgg aacaaatatc ttggggggta tttgacaccc tccatagact

12721 tcaattatta aatatgagtc acaacaatct attgtttttg gattcatccc attataacca

12781 gctgtattcc ctcagcactc ttgattgcag tttcaatcgc atagagacat ctaaaggaat

12841 actgcaacat tttccaaaga gtctagcctt cttcaatctt actaacaatt ctgttgcttg

12901 tatatgtgaa catcagaaat tcctgcagtg ggtcaaggaa cagaagcagt tcttggtgaa

12961 tgttgaacaa atgacatgtg caacacctgt agagatgaat acctccttag tgttggattt

13021 taataattct acctgttata tgtacaagac aatcatcagt gtgtcagtgg tcagtgtgat

13081 tgtggtatcc actgtagcat ttctgatata ccacttctat tttcacctga tacttattgc

13141 tggctgtaaa aagtacagca gaggagaaag catctatgat gcatttgtga tctactcgag

13201 tcagaatgag gactgggtga gaaatgagct ggtaaagaat ttagaagaag gagtgccccg

13261 ctttcacctc tgccttcact acagagactt tattcctggt gtagccattg ctgccaacat

13321 catccaggaa ggcttccaca agagccggaa ggttattgtg gtagtgtcta gacactttat

13381 tcagagccgt tggtgtatct ttgaatatga gattgctcaa acatggcagt ttctgagcag

13441 ccgctctggc atcatcttca ttgtccttga gaaggttgag aagtccctgc tgaggcagca

13501 ggtggaattg tatcgccttc ttagcagaaa cacctacctg gaatgggagg acaatcctct

13561 ggggaggcac atcttctgga gaagacttaa aaatgcccta ttggatggaa aagcctcgaa

13621 tcctgagcaa acagcagagg aagaacaaga aacggcaact tggacctgag gagaacaaaa

13681 ctctggggcc taaacccagt ctgtttgcaa ttaataaatg ctacagctca cctggggctc

13741 tgctatggac cgagagccca tggaacacat ggctgctaag ctatagcatg gaccttaccg

13801 ggcagaagga agtagcactg acaccttcct ttccaggggt atgaattacc taactcggga

13861 aaagaaacat aatccagaat ctttaccttt aatctgaagg agaagaggct aaggcctagt

13921 gagaacagaa aggagaacca gtcttcactg ggcctt

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.

References

   1.  Poltorak, A., He, X., Smirnova, I., Liu, M.-Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282, 2085-2088.

   2.  Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A., and Bazan, J. F. (1998) A family of human receptors structurally related to Drosophila Toll., Proc. Natl. Acad. Sci. U. S. A. 95, 588-593.

   3.  Xu, Y., Tao, X., Shen, B., Horng, T., Medzhitov, R., Manley, J. L., and Tong, L. (2000) Structural basis for signal transduction by the Toll/interleukin-1 receptor domains, Nature 408, 111-115.

   4.  Slack, J. L., Schooley, K., Bonnert, T. P., Mitcham, J. L., Qwarnstrom, E. E., Sims, J. E., and Dower, S. K. (2000) Identification of two major sites in the type I interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways, J. Biol. Chem. 275, 4670-4678.

   5.  Li, C., Zienkiewicz, J., and Hawiger, J. (2005) Interactive sites in the MyD88 Toll/interleukin (IL) 1 receptor domain responsible for coupling to the IL1beta signaling pathway, J. Biol. Chem. 280, 26152-26159.

   6.  Medzhitov, R., Preston-Hurlburt, P., and Janeway, C. A., Jr. (1997) A human homologue of the Drosophila Toll protein signals activation of adaptive immunity, Nature 388, 394-397.

   7.  Rhee, S. H. and Hwang, D. (2000) Murine TOLL-like Receptor 4 Confers Lipopolysaccharide Responsiveness as Determined by Activation of NFkappa B and Expression of the Inducible Cyclooxygenase, J. Biol. Chem. 275, 34035-34040.

   8.  Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-rich repeats and pathogen recognition in Toll-like receptors, Trends Immunol. 24, 528-533.

   9.  Jin, M. S., Kim, S. E., Heo, J. Y., Lee, M. E., Kim, H. M., Paik, S. G., Lee, H., and Lee, J. O. (2007) Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide, Cell 130, 1071-1082.

 10.  Bell, J. K., Botos, I., Hall, P. R., Askins, J., Shiloach, J., Segal, D. M., and Davies, D. R. (2005) The molecular structure of the Toll-like receptor 3 ligand-binding domain, Proc. Natl. Acad. Sci. U. S. A 102, 10976-10980.

 11.  Choe, J., Kelker, M. S., and Wilson, I. A. (2005) Crystal Structure of Human Toll-Like Receptor 3 (TLR3) Ectodomain, Science 309, 581-585.

 12.  Kim, H. M., Park, B. S., Kim, J. I., Kim, S. E., Lee, J., Oh, S. C., Enkhbayar, P., Matsushima, N., Lee, H., Yoo, O. J., and Lee, J. O. (2007) Crystal structure of the TLR4-MD-2 complex with bound endotoxin antagonist Eritoran, Cell 130, 906-917.

 13.  Thomas, L. (1954) The physiological disturbances produced by endotoxins, Annu. Rev. Physiol 16, 467-490.

 14.  Beutler, B., Milsark, I. W., and Cerami, A. (1985) Passive immunization against cachectin/tumor necrosis factor (TNF) protects mice from the lethal effect of endotoxin, Science 229, 869-871.

 15.  Michalek, S. M., Moore, R. N., McGhee, J. R., Rosenstreich, D. L., and Mergenhagen, S. E. (1980) The primary role of lymphoreticular cells in the mediation of host responses to bacterial endotoxin, J. Infec. Dis. 141, 55-63.

 16.  Heppner, G. and Weiss, D. W. (1965) High susceptibility of strain A mice to endotoxin and endotoxin-red blood cell mixtures, J. Bacteriol. 90, 696-703.

 17.  Coutinho, A., Forni, L., Melchers, F., and Watanabe, T. (1977) Genetic defect in responsiveness to the B cell mitogen lipopolysaccharide, Eur. J. Immunol. 7, 325-328.

 18.  Coutinho, A. and Meo, T. (1978) Genetic basis for unresponsiveness to lipopolysaccharide in C57BL/10Cr mice, Immunogenetics 7, 17-24.

 19.  Watson, J. and Riblet, R. (1974) Genetic control of responses to bacterial lipopolysaccharides in mice. I. Evidence for a single gene that influences mitogenic and immunogenic respones to lipopolysaccharides, J. Exp. Med. 140, 1147-1161.

 20.  Watson, J., Riblet, R., and Taylor, B. A. (1977) The response of recombinant inbred strains of mice to bacterial lipopolysaccharides, J. Immunol. 118, 2088-2093.

 21.  Watson, J., Kelly, K., Largen, M., and Taylor, B. A. (1978) The genetic mapping of a defective LPS response gene in C3H/HeJ mice, J. Immunol. 120, 422-424.

 22.  Poltorak, A., Smirnova, I., He, X. L., Liu, M. Y., Van Huffel, C., McNally, O., Birdwell, D., Alejos, E., Silva, M., Du, X., Thompson, P., Chan, E. K. L., Ledesma, J., Roe, B., Clifton, S., Vogel, S. N., and Beutler, B. (1998) Genetic and physical mapping of the Lps locus- identification of the toll-4 receptor as a candidate gene in the critical region, Blood Cells Molecules & Diseases 24, 340-355.

 23.  Vogel, S. N., Wax, J. S., Perera, P. Y., Padlan, C., Potter, M., and Mock, B. A. (1994) Construction of a BALB/c congenic mouse, C.C3H-Lps^d, that expresses the Lps^d allele: Analysis of chromosome 4 markers surrounding the Lps gene, Infect. Immun. 62, 4454-4459.

 24.  Peiffer-Schneider, S., Schutte, B. C., Frees, K. L., Williamson, K., Swartz, S. J., and Schwartz, D. A. (1997) Genetic mapping of the Lps gene and construction of a physical map of the critical region at mid-chromosome 4, 11^th International Mouse Genome Conference.

 25.  Qureshi, S., Zhang, X., Clermont, S., Lariviere, L., Skamene, E., Gros, P., Eydoux, P., and Malo, D. (1996) Genetic and physical mapping of the Lps locus, 10th International Mouse Genome Conference.

 26.  Poltorak, A., Smirnova, I., Clisch, R., and Beutler, B. (2000) Limits of a deletion spanning Tlr4 in C57BL/10ScCr mice, J. Endotoxin Res. 6, 51-56.

 27.  Qureshi, S. T., Lariviere, L., Leveque, G., Clermont, S., Moore, K. J., Gros, P., Malo, D. (1999) Endotoxin-tolerant mice have mutations in toll-like receptor 4 (Tlr4), J. Exp. Med. 189, 615-625.

 28.  Hoshino, K., Takeuchi, O., Kawai, T., Sanjo, H., Ogawa, T., Takeda, Y., Takeda, and Akira, S. (1999) Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: Evidence for TLR4 as the Lps gene product, J. Immunol. 162, 3749-3752.

 29.  Kalis, C., Kanzler, B., Lembo, A., Poltorak, A., Galanos, C., and Freudenberg, M. A. (2003) Toll-like receptor 4 expression levels determine the degree of LPS-susceptibility in mice, Eur. J. Immunol. 33, 798-805.

 30.  Kawai, T. and Akira, S. (2006) Innate immune recognition of viral infection, Nat. Immunol. 7, 131-137.

 31.  Beutler, B., Jiang, Z., Georgel, P., Crozat, K., Croker, B., Rutschmann, S., Du, X., and Hoebe, K. (2006) Genetic analysis of host resistance: Toll-Like receptor signaling and immunity at large, Annu. Rev. Immunol. 24, 353-389.

 32.  Kawai, T., Adachi, O., Ogawa, T., Takeda, K., and Akira, S. (1999) Unresponsiveness of MyD88-deficient mice to endotoxin, Immunity 11, 115-122.

 33.  Hoshino, K., Kaisho, T., Iwabe, T., Takeuchi, O., and Akira, S. (2002) Differential involvement of IFN-beta in Toll-like receptor-stimulated dendritic cell activation, Int. Immunol 14, 1225-1231.

 34.  Kawai, T., Takeuchi, O., Fujita, T., Inoue, J., Muhlradt, P. F., Sato, S., Hoshino, K., and Akira, S. (2001) Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes, J. Immunol. 167, 5887-5894.

 35.  Wesche, H., Henzel, W. J., Shillinglaw, W., Li, S., and Cao, Z. (1997) MyD88: an adapter that recruits IRAK to the IL-1 receptor complex, Immunity 7, 837-847.

 36.  Medzhitov, R., Preston-Hurlburt, P., Kopp, E., Stadlen, A., Chen, C., Ghosh, S., and Janeway, C. A., Jr. (1998) MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways, Mol. Cell 2, 253-258.

 37.  McWhirter, S. M., Fitzgerald, K. A., Rosains, J., Rowe, D. C., Golenbock, D. T., and Maniatis, T. (2004) IFN-regulatory factor 3-dependent gene expression is defective in Tbk1-deficient mouse embryonic fibroblasts, Proc. Natl. Acad. Sci. U. S. A 101, 233-238.

 38.  Hacker, H., Redecke, V., Blagoev, B., Kratchmarova, I., Hsu, L. C., Wang, G. G., Kamps, M. P., Raz, E., Wagner, H., Hacker, G., Mann, M., and Karin, M. (2006) Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6, Nature 439, 204-207.

 39.  Haziot, A., Ferrero, E., Kontgen, F., Hijiya, N., Yamamoto, S., Silver, J., Stewart, C. L., and Goyert, S. M. (1996) Resistance to endotoxin shock and reduced dissemination of gram-negative bacteria in CD14-deficient mice., Immunity 4, 407-414.

 40.  Jiang, Z., Georgel, P., Du, X., Shamel, L., Sovath, S., Mudd, S., Huber, M., Kalis, C., Keck, S., Galanos, C., Freudenberg, M., and Beutler, B. (2005) CD14 is required for MyD88-independent LPS signaling, Nat. Immunol. 6, 565-570.

 41.  Nagai, Y., Akashi, S., Nagafuku, M., Ogata, M., Iwakura, Y., Akira, S., Kitamura, T., Kosugi, A., Kimoto, M., and Miyake, K. (2002) Essential role of MD-2 in LPS responsiveness and TLR4 distribution, Nat. Immunol. 3, 667-672.

 42.  Triantafilou, K., Triantafilou, M., Ladha, S., Mackie, A., Dedrick, R. L., Fernandez, N., and Cherry, R. (2001) Fluorescence recovery after photobleaching reveals that LPS rapidly transfers from CD14 to hsp70 and hsp90 on the cell membrane, J Cell Sci. 114, 2535-2545.

 43.  da Silva, C. J., Soldau, K., Christen, U., Tobias, P. S., and Ulevitch, R. J. (2001) Lipopolysaccharide is in close proximity to each of the proteins in its membrane receptor complex. transfer from CD14 to TLR4 and MD-2, J Biol. Chem. 276, 21129-21135.

 44.  Smirnova, I., Mann, N., Dols, A., Derkx, H. H., Hibberd, M. L., Levin, M., and Beutler, B. (2003) Assay of locus-specific genetic load implicates rare Toll-like receptor 4 mutations in meningococcal susceptibility, Proc. Natl. Acad. Sci. U. S. A 100, 6075-6080.

 45.  Arbour, N. C., Lorenz, E., Schutte, B. C., Zabner, J., Kline, J. N., Jones, M., Frees, K., Watt, J. I., and Schwartz, D. A. (2000) TLR4 mutations are associated with endotoxin hyporesponsiveness in humans, Nature Genetics 25, 187-192.

 46.  Erridge, C., Stewart, J., and Poxton, I. R. (2003) Monocytes heterozygous for the Asp299Gly and Thr399Ile mutations in the Toll-like receptor 4 gene show no deficit in lipopolysaccharide signalling, J. Exp. Med. 197, 1787-1791.

 47.  Underhill, D. M., Ozinsky, A., Hajjar, A. M., Stevens, A., Wilson, C. B., Bassetti, M., and Aderem, A. (1999) The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens [see comments], Nature 401, 811-815.

 48.  Jiang, Z., Georgel, P., Li, C., Choe, J., Crozat, K., Rutschmann, S., Du, X., Bigby, T., Mudd, S., Sovath, S., Wilson, I. A., Olson, A., and Beutler, B. (2006) Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis, Proc Natl Acad Sci U S A 103, 10961-10966.

 49.  Horng, T., Barton, G. M., and Medzhitov, R. (2001) TIRAP: an adapter molecule in the Toll signaling pathway, Nat. Immunol. 2, 835-841.

 50.  Radons, J., Dove, S., Neumann, D., Altmann, R., Botzki, A., Martin, M. U., and Falk, W. (2003) The interleukin 1 (IL-1) receptor accessory protein Toll/IL-1 receptor domain: analysis of putative interaction sites in vitro mutagenesis and molecular modeling, J. Biol. Chem. 278, 49145-49153.